2 Exam Spring 2007 Biol 1362 PINK VERSION 1. Which A) B) C) D) E) Ans: 2. All are A) B) C) D) E) Ans:
Bubble in name (last name first). Bubble in last 4 digits of student ID # in boxes G-H-I-J. Write color of exam above your name.
of the following are true of both eukaryotic and prokaryotic genes? In order to be transcribed, both require RNA polymerase to bind to a promoter. Transcription of both can be prevented by a regulatory (repressor) protein. Genes of similar function are organized and grouped under control of a single promoter. A, B, and, C are true. Only A and B are true. E applicable to PCR except: It requires a DNA polymerase that is heat-resistant. It is used to amplify tiny quantities of DNA. It only replicates target sequences. It goes through temperature cycles of heating and coooling. There are no exceptions; A-D are all applicable to PCR. E
3. Choose the incorrectly matched pair: A) Post-translational control: prevent ribosome binding B) Post-transcriptional control: remove polyA tail C) Pre-transcriptional control: histone modification D) Transcriptional control: regulation of RNA polymerase activity Ans: A Use the following to answer question 4: The restriction enzyme HindIII recognizes the DNA sequence: A*A G C T T T T C G A*A Below is a DNA molecule: C TTCGTTAAGCTTCTTAAGCTTACGAAGCTTT GAAGCAATTCGAAGAATTCGAATGCTTCGAAA 4. How many fragments are generated by cutting the DNA molecule with the HindIII enzyme? A) 2 B) 3 C) 4 D) 5 E) 6 Ans: C 5. ____________ is a technique that can be used to separate DNA molecules on the basis of their size. A) Southern blotting B) PCR C) Gel electrophoresis D) Cloning E) Reverse transcription Ans: C 6. Which A) B) C) D) E) Ans: of the following are false concerning reproductive cloning? Involves the technique of nuclear transplantation The source of the donor DNA is the one who is cloned. Reproductive cloning is a very efficient process providing nearly 100% success in every attempt. It requires a surrogate mother in which to implant the embryo. B and C are both false statements. C
7. DNA microarray Ans: B) contains known sequences of all or most of the genes of a cell 8. gene therapy Ans: D) typically employs the use of viral vectors 9. Southern blot Ans: A) transfer of DNA fragments to a filter
Page 1
10. tumor suppressor genes Ans: E) involved in the normal detection & repair of damaged DNA 11. oncogenes Ans: C) cancer causing forms of normal genes 12. Which A) B) C) D) E) Ans: pair is mis-matched? prion:infectious protein animal virus infection:host could survive and produce viral progeny viroid:capsid reverse transcriptase:retrovirus conjugation:genetic transfer through contact between bacterial cells C
13. The following statements are false concerning exons of eukaryotic genes, except: A) Translation of exons in pre-mRNA occurs in the cytoplasm. B) All exons are removed during the splicing process. C) The mature mRNA's of a gene can contain different orders of exons. D) Introns, not exons, contain translatable coding sequences. Ans: C 14. A bacterial cell has the metabolic pathway AB C. The genes in this operon that code for the proteins (enzymes) that catalyze this pathway are only transcribed when "A" is present. This operon would be characterized as A) repressible. B) always being on (i.e., constituitive). C) inducible. D) lysogenic. E) mutagenic. Ans: C 15. A genomic library consists of fragments of: A) all of the DNA that occurs in one species. B) all of the DNA that would be found in a typical cell of a particular organism. C) all of the DNA in a single, recombinant gene. D) all of the DNA that codes only for functional proteins in a typical cell of a particular organism. Ans: B 16. A transcriptional activator, such as a some hormones, can turn on different genes in different cells because these genes possess similar regulatory sequences. A) True B) False Ans: A 17. The objective of therapeutic cloning is to clone and develop fully-formed organisms, the goal of reproductive cloning is to form specialized tissues from stem cells in order to replace diseased or damaged tissues. A) True B) False Ans: B 18. In order to determine with absolute certainty whether a suspect was at a crime scene, his/her DNA fingerprint must be an exact match to a sample of evidence (hair, blood, etc.) taken from that crime scene. A) True B) False Ans: A 19. The number of proteins that are present in the cells of humans is exactly equal to the number of genes contained in their chromosomes. A) True B) False Ans: B 20. If the gene encoding the trp repressor is mutated such that the repressor can no longer bind tryptophan, then transcription of the trp operon will not be able to be repressed (i.e., shut off) and thus will always be on. A) True B) False Ans: A Use the following to answer questions 21-23: Match the type of bacteriophage infection in A-C to the statements below. A. Applies to lytic cycle only B. Applies to lysogenic cycle only Page 2 C. Applies to both lytic and lysogenic cycles
21. Immediate destruction of host DNA following viral penetration. Ans: A 22. The attachment and penetration steps of a bacteriophage infection. Ans: C 23. Prophage formation Ans: B 24. Viruses are characterized A) by having only DNA as their nucleic acid. B) by the ability to metabolize available energy sources like glucose or other carbon sources. C) as being able to divide asexually, creating 2 daughter viruses. D) as obligate intracellular parasites. E) as prokaryotic cells. Ans: D 25. The regulation of the lactose and tryptophan operons, respectively, are both examples of A) degradation protein B) transcriptional control C) mRNA splicing D) ribosome inhibition E) pre-transcriptional control Ans: B 26. Mature mRNA's of eukaryotes: A) contain both coding and non-coding sequences B) are translated in the nucleus C) possess modifications that greatly decrease their stability in the cytoplasm D) have completed the splicing procedure Ans: D 27. Which A) B) C) D) E) Ans: of the following is not true concerning cancer? Cancerous cells respond to inhibitory growth signals. Viruses cause some, but not all cancers. An increased incidence of cancer could result in an individual if he/she has inherited a mutated allele of a tumor suppressor gene. Cancerous cells do not undergo programmed cell death (apoptosis). Metastized tumors can spread to other tissues. A
Use the following to answer questions 28-29: Sam is an adopted child. Upon researching who his mother might be, the adoption agency provided 3 candidate mothers. RFLP analysis was carried out to perhaps identify the possible mother. Sam's DNA sample is in lane #1, samples from the possible mothers are in lanes #2, #3, and #4.
1
2
3
4
28. Of the A) B) C) D) Ans:
three possible mothers, which candidate is likely to be Sam's biological mother? 2 3 4 There is no exact match with Sam, thus none of these mothers is a possibility. B
Page 3
29. Which A) B) C) D) E) Ans: 30. Which A) B) C) D) E) Ans:
of the following is not true regarding this analysis? VNTR sequences were likely analyzed. A Southern blot was performed. A probe was used to identify the restriction fragments. The size of fragments at the top of the gel (where the numbers are) are smaller than those at the bottom. A restriction digest was carried out. D statement(s) applies to a bacterial culture growing on lactose: Lactose would bind to the repressor protein thereby preventing transcription of the lac operon structural genes. The lactose repressor would not be bound to the operator of the lac operon. Once the lactose is completely consumed by the cells, then the lactose repressor becomes active. A and B are correct. B and C are correct. E
31. The goal of any gene therapy is to: A) replace all mutant alleles in all body cells. B) replace a mutant allele in specific tissues with a normal allele. C) repair mutant alleles in certain body cells. D) improve gene expression in all body cells. Ans: B Use the following to answer questions 32-34:
32. Which A) B) C) D) E) Ans: 33. Which A) B) C) D) E) Ans:
labeled part of the virus is the capsid? A B C D None of the above. C structure is responsible for the infectivity and host range of this virus? A B C D None of the above. A
34. The virus shown above: A) would most likely infect a bacterial cell. B) contains the machinery to carry out protein synthesis. C) could undergo mitosis. D) would most likely be an animal virus. Ans: D 35. Expression of a eukaryotic gene can be prevented by all of the following except: A) stopping the removal of an intron or introns from the gene transcript B) tagging proteins encoded for by the gene with ubiquitin C) removing the 5'cap from the gene transcript D) blocking ribosome binding to the gene transcript E) There are no exceptions here; A-D are all ways to prevent gene expression Ans: E
Page 4
36. Which A) B) C) D) Ans:
of the following statements regarding cDNA libraries is false? They are composed of DNA synthesized with the use of reverse transcriptase. They are composed of DNA synthesized from an mRNA template. They contain DNA that is complementary to the mRNA from which it was synthesized. A cDNA library of a particular tissue comprises all the genes contained in the DNA of the cells in that tissue. D
Use the following to answer questions 37-39: Shown below is a basic scheme to begin the search for a particular gene from the genomic DNA of a human. The host cells are grown on medium containing the appropriate antibiotic.
Source DNA Vector
DNA fragments Recombinant DNA molecules Linearized vector Host cells
Antibiotic resistance gene Grow cells
37. The replication of the recombinant molecules occurs: A) outside a host cell. B) by the process of growth and division of the host cells. C) by the process of transformation of the host cells. D) by the growth of the recombinant DNA molecules. Ans: B 38. Of the A) B) C) D) E) Ans: 39. Which A) B) C) D) Ans: cells that survive and grow to form colonies on growth medium containing antibiotic: some may contain only circularized human DNA fragments some may not contain any type of recombined DNA molecule all of the surviving cells will contain either plasmid vector alone or vector having DNA fragment inserts no cells will be able to grow on antibiotic containing medium A, B, and C are all applicable. C of the following is false regarding the formation of recombinant molecules shown here? Plasmid vectors containing source DNA fragments are formed. Circularized vector and circularized source DNA are formed. The source DNA and vector were cut with different restriction enzymes. DNA ligase is used to chemically bond the recombinant molecules together. C
Page 5
Use the following to answer questions 40-42: In step 2 below, "gene" refers to an exposed, accessible gene.
chromatin gene pre-mRNA mature mRNA
1 2 3 4
5 6
protein
40. Coiling or uncoiling of DNA, occurs here. A) 1 B) 2 C) 3 D) 4 E) 5 Ans: A 41. Preventing the binding and subsequent function of snRNP's would occur at which transition? A) 12 B) 23 C) E) Ans: 34 45 56 C D)
42. Enhancer sequences would have their effect at which transition? A) 12 B) 23 C) E) Ans: 34 45 D)
56 B
Page 6