Documents Found!
As seen in
Less Work, Better Grades
Join
Course Hero
Access
best resources
Ace
your classes
Ace your courses with Course Hero!

Submit your homework question or assignment here:
352 Tutors are online
 
We are so confident that you will love our service, we will answer your first homework question for FREE!
*  Attach Assignment (optional):
 
Study Smarter, Score Higher
 
Document Content (unformatted)
Course Hero has millions of student submitted documents similar to the one below including study guides, homework solutions, papers, exam answer keys and textbook solutions.
CAAAGATTATAACTAACCACATTTGCAATAACGCATAGGTCTCAAGTTTACTCATATCAATAGAATAATCAACTAGCAAGCCATAATAATAAATCTCGGATGACAACACTTTCTCAAAAC AAACATTTGCTTGTCCTCAAGCAATTCAGTTGACAAACTGAAAGTGGTAAAGAAAAACTTTTACAAACTCTGTTTTCTCTTGTTGTTGTAAATATGTAAAGCCAACATTCAAGTTTTCAG AATCATAATATGATATAACAAGATGGTATCTCGCTAGCCCTTTCTGAGACCGCAGAACATAAATGCAGAGCACCTTTAAAGACCAAGGACTGACTACACATTGTAATTCATGGTAAAAGA GATCCAGTCAAGCCATACTCAATGTAAACTAACAGTAATGAAAGCAAATGACAGCGGTGCTCTCTAACTGATGCTTTTTAATAAGAGGATGATGACTCAGGATAAAAGTAAATAGATAGG CCCTTCGCAGAGGCAAGCGGGGATTTGTAGAGGTGCCACAGCTCGGTTTTGAAATAGAGGTGAATAATATTTTGAGCGGTATACTTTCATTGTCAACATAACAACCAAGAGATGGCGATA TCTTCCATGCTACACACATTATAGGCGGTTCCCAAACAGAATGGTAAAGTTTATACTCCCCCTTCCACCAACAAGCATCAATCCATGGCTTGCTCGAAACAACGAGTGCCTCCAACTAAC AAGAGTCCCAGGGGGAGTTTTGTTTGCAATTATTTTGATTTAGTTTGCATAAAGCATGTGACTGGGCATCCCGGTGACCAGCCATTTATCTCGTGAGTGAGCAGCGGAGTCCACTCCTCT TGAGAATAACCCGCCTAACATGGAAGATACAGACAGCCCTAGCTGATACATGAGCTATTCGAGCATACAAAACAGGATACTTATTTGAAGGTTTAGAGTTTGGCACATACAAATTTACTT GGGATGGCAGGTAGATACCGTATATAGGTAGGTATAGTGGACTCATGTGGAATAACTTTGGGATTTAAGGGATTGGATGCACAAGCAGTATTCCCGCTTAGTACAGGTGAAGGCTAGCAA AAGACTGGGAAGCGACCAGCTAAAGAGCGACAACATTCATGAACATGGATTAAAATTAATCAACACCGAATGCAAGCATGAGTAGGATATAATCCACCATGAACATAAATATCGTGAAGG CTATGTTGATTTTGTTTCAACTACATGCGTGAACATGTACCAAGTCAAGTCACTTAAATCATTCAGAGGAGGATACCACCCTATCATACCACATCATAACTATCTCAATAGCATGTTGGC ACGCAAGGTAAACCATTATAACTCATAGCTAATCAAGCATGGCACAAGAAACTATGATCTCTAATTGTCATTGCAAACATGTTTATTCATAATTGGCTGAATCAGGAACGATGAACTAAT CATATTTACAAAAACAAAAGAGGTCGAGTTCATACCAGCTTTTCTCATCTCAGCCAGTCCATCATATATCATCATAATTGCCTTCACTTGCACGACTGAATAGTGTGAATAATAATAATA GTGCACGTGCATTGGACTAAGCTGGAATGTGCAAGCATTCAATAAACAGGAGAGGACAAGGCAATATGGGCTCTTTTGTCAGATAAACAATAATGCATAAAAGACCACTTCAACAATTTA ATTATGGTCTTCTCCTATCGACCCCCAAAGAAAAGAAAAGAAATAAAACTATTTACACAGGAAAGCTCCCAACAAGCAAAAGAAGAACAGGAAATCTTTTTGGGTATTATTTTTAATTAC TACTACAAGCACAGAAATTAAACTGATTAAAAGCTACAACTATTTTTTTTGGTTTTTCTTAAGGTTTCTTAAACACACAAGAAGAAAGCATAAAAAGGAAATTAAAATAGCATGGATGAT ACAATGAAAAAGTATGAGCACCGACATCTAGCAATGAGTGTGTGAACATAAATGTAATATCGGTGGGAAATACGTACTCCCCCAAGCTTATGCTTTTAGCCTAAGTTGGTCTATGGCCAC GGCTGGCCTGGCGGATATCCATAATAATAGTTGGGGTCGTAATGCAATGAGGAAGAAGAGGGCTCCGATTGCCACTGGCTGGCAATCATCTCTGGATCCCACTAGTAATTAGACTGTCGT GAGGGGTCAAATTGTGGTTCTGGCTCTGGCTCCTCGGCTGGTGCAGGGTTCCGGTAGGCTTGAATAGCCGTCACCGGAACAAGGTACGTGCCTGAAGATAGATCAAACAAAGAAGGAGCA GGCAGGGTAATAGTCCCAGGATGATGTTTATTAAAAAAAACAATTGATATTTAAGCTCTCCTGCCCTATTCTTAACAATAAAATCATGTGCCACCATACTTTTATAATCTAGATAAACAC GGGGCAGCACCTTTTCTTCCTTCTCAGCATGCCTAATAGGTATGTTAAAATGTGCAGCTAGGCGTGAGGCATAGATGCCTCCAAAGATGGGGCCCTTGGTATGGTTCAGACTTAACCGTT TAGCAATAATACCGCCCATGCTAAAAGTGTTATCACTATATAAACCTTGAAGCAAAATAATAATATCAGGGATACTAAGGTTTCCATAGTTTCCGCGACCAATTAAGAAACGATTAGCAA ATAATGCAAAGTAACGTAAAACAGGAAAATGTATGCTAGTGATTCGTGCATCGGAAACTTTCCTAGTTTCCCCTACAGCGATAGTATCAATAAAACCCTCCACATCATCACGATGTGGTT CTTCTGTCTTGCCCTCAGAAGGGACTAGACAAATCTGACAAAAATCATAAAGTGACATCTCCTTATGCTCATCATATAGATGAAACTCCACCGTAGGTGGTGAGTTCCTAGAATGAAAAT GAAAGTTTTGCACAAAGGTATTTGTGAGCAAGAGATACTGATCGCATTGGTCATGGAGGAAAGCGGTGAGGCCTGCATTATGAGCCAATTCATGAAAATCTTCATAAATCCCGGCTGCTC TCAAGAATTCATCGGAAGGCCATTCACACGCCCGAATCTCCGTGGTGCGCGGCAAATTATACATAGGCTATGGTGCCTTTTCCTTCGAGCTTTGGCTCGATGAGCCCCTCAATAGTCTCC TCGTCATTTTCTGAAAAATTCTGAAAATTTTAGTAACTTCAAAATAAAAGTAAACCAAACTCAATAATATTGATAGCAACTACTCCTACAAGTGCCTAGGGCCTATATCATGCATCAAAA CTACTTTTGACCATATAAATTTGACATGCAAGCTCAAGAACAGGGTCACCTAAGCAGCAAAAATTTGCAATGAATAAAGCACTAGAACAAAAACTAATTGGACCAATGGAGGAGTCACAT ACCAAGGAACAATCTCCCCAAGCAGTTTTGTGAGAGGTGCTTTGAGCAAGGAGATCGAAAATGGCAGCAAGATGAGCTAGAACTCGGGTTTGATCTGGTTATTCGTGTTTGTGGGAGGAA GATGAAGTGTGTGGGTGCAGGAATAAGTGGAGGAGGGCCACCGTGGGCCCATGAGGCAGCGGGCGCGCCCTACACCCTCGTGGGCAAGTGGTTGACCCCCCTGGTGTGTTTTCAGTTCCA TAAATCCTCAAATATTCTAGAAAAAATATATTTAAATTTCAAGGCATTTGGAGAACTTTTATTTTCGAGGTATTTTTATATTGCACGAATAATCAGATAACAGACAGAAAAATATTTATT TTATTTTTATTTAATATGAATAACAGAAAGTAAGAGTGGGGTATAATGCAAAGTAACGTAAAACAGGAAAATGTATGCTAGTGATTCGTGCATCGGAAACTTTCCTAGTTTCCCCTACAG CGATAGTATCAATAAAACCCTCCACATCATCACGATGTGGTTCTTCTGTCTTGCCCTCAGAAGGGACTAGACAAATCTGACAAAAATCATAAAGTGACATCTCCTTATGCTCATCATATA GATGAAACTCCACCGTAGGTGGTGAGTTCCTAGAATGAAAATGAAAGTTTTGCACAAAGGTATTTGTGAGCAAGAGATACTGATCGCATTGGTCATGGAGGAAAGCGGTGAGGCCTGCAT TATGAGCCAATTCATGAAAATCTTCATAAATCCCGGCTGCTCTCAAGAATTCATCGGAAGGCCATTCACACGCCCGAATCTCCGTGGTGCGCGGCAAATTATACATAGGCTATGGTGCCT TTTCCTTCGAGCTTTGGCTCGATGAGCCCCTCAATAGTCTCCTCGTCATTTTCTGAAAAATTCTGAAAATTTTAGTAACTTCAAAATAAAAGTAAACCAAACTCAATAATATTGATAGCA ACTACTCCTACAAGTGCCTAGGGCCTATATCATGCATCAAAACTACTTTTGACCATATAAATTTGACATGCAAGCTCAAGAACAGGGTCACCTAAGCAGCAAAAATTTGCAATGAATAAA GCACTAGAACAAAAACTAATTGGACCAATGGAGGAGTCACATACCAAGGAACAATCTCCCCAAGCAGTTTTGTGAGAGGTGCTTTGAGCAAGGAGATCGAAAATGGCAGCAAGATGAGCT AGAACTCGGGTTTGATCTGGTTATTCGTGTTTGTGGGAGGAAGATGAAGTGTGTGGGTGCAGGAATAAGTGGAGGAGGGCCACCGTGGGCCCATGAGGCAGCGGGCGCGCCCTACACCCT CGTGGGCAAGTGGTTGACCCCCCTGGTGTGTTTTCAGTTCCATAAATCCTCAAATATTCTAGAAAAAATATAATAATGCAAAGTAACGTAAAACAGGAAAATGTATGCTAGTGATTCGTG CATCGGAAACTTTCCTAGTTTCCCCTACAGCGATAGTATCAATAAAACCCTCCACATCATCACGATGTGGTTCTTCTGTCTTGCCCTCAGAAGGGACTAGACAAATCTGACAAAAATCAT AAAGTGACATCTCCTTATGCTCATCATATAGATGAAACTCCACCGTAGGTGGTGAGTTCCTAGAATGAAAATGAAAGTTTTGCACAAAGGTATTTGTGAGCAAGAGATACTGATCGCATT GGTCATGGAGGAAAGCGGTGAGGCCTGCATTATGAGCCAATTCATGAAAATCTTCATAAATCCCGGCTGCTCTCAAGAATTCATCGGAAGGCCATTCACACGCCCGAATCTCCGTGGTGC GCGGCAAATTATACATAGGCTATGGTGCCTTTTCCTTCGAGCTTTGGCTCGATGAGCCCCTCAATAGTCTCCTCGTCATTTTCTGAAAAATTCTGAAAATTTTAGTAACTTCAAAATAAA AGTAAACCAAACTCAATAATATTGATAGCAACTACTCCTACAAGTGCCTAGGGCCTATATCATGCATCAAAACTACTTTTGACCATATAAATTTGACATGCAAGCTCAAGAACAGGGTCA Sequence annotation Annotation performed on completed sequence Computer programs used to find the following: Genes Exons and introns Regulatory sequences Repetitive elements Gene discovery More difficult in Eukaryotes because of the presence of introns Extrinsic Methods Complete cDNAs and ESTs Comparative genomics Intrinsic methods Gene prediction programs Grail GENSCAN FGENES GeneSeqer http://bioinformatics.iastate.edu/cgi-bin/gs.cgi Method to identify potential exon/intron structure by splice site prediction and spliced alignment. Step 1: Select splice site model Step 2: Input genomic DNA sequence Step 3: Select or input cDNA/EST sequences Step 4: Submit job Be careful: retroelements are also present in EST collections! Dotplot Triticeae vs. rice BACs Barley BAC 635P2 (horizontal) vs. orthologous Rice BAC 36I05 (vertical) (Dubcovsky et al. 2001, Plant Physiology): G1 G2 G3 G4 Th G5 Ti G1 Ta Tb Tc G2 Td Te Tf Te G3 G 4a G 4b Tg Comparative genomics is a powerful approach to identify genes: Coding regions are more conserved than non-coding regions Programs used in human-mouse comparisons: TWINSCAN and SLAM Intrinsic Gene prediction Search by signal TATA box Translational start (ATG) 5 or donor splice site (GT, rarely GC) 3 or acceptor splicing site (AG) Translational stop (TAA, TAG, TGA) PolyA signal (AATAAA) TATAAAAATCGTTGTGGGGGCGGGATTG GGCGGCCATGGACACCTCTACTAGGGCG GCCAAGATCCCCTCCCTCCCCCAACAGA CGGAGATCAACTGGGACAAGTAAGCGCC CGCCCGCCCGCCCGCCTCCTCTTTCCTC AGCCGTTCCCCGGCTTATTTTTCTATTT TTTCCTCTAGGTTAATATCAACAAGCCA AAAGCCAGTGAAGTAGTTAGAAGATTGA TCGCATGGATGGAAAGGTTTCTAAGTAT GCCCATCCTTTCCGAGTCTTATTTCCTT CCGCTTCTTCCCAGAGCGTGTATGTGCT AAAGTTGAAGAGGCCCTGAGTCTATAAT ATTCTCATCAATAAA Search by content and compositional bias Absolute frequency of the pair A(k)A with k (0 to 50) in the first 200-bp from 1761 human genes and 1753 introns. In coding regions every 3rd base tends to be the same more often than by chance alone. Hidden Markov models Many uses in genomics Gene prediction Multiple sequence alignment Finding periodic patterns HMMs are trained on sequences that are members of known gene class HMM gives probability that a particular sequence belongs to the gene class A DNA sequence can be considered a fifth-order Markov model because the probability of a given base depends on the five preceding bases GENSCAN and GENIE are examples of HMM-based gene finding programs are ANALOGY: You can think of the HMMs as representing a trip across the country in which there are alternative routes (a,b,c) and places to eat (R1-4) and stay (H1-3). If we keep track of the trips of locals and tourists in a survey, we come up with the most common routes restaurants and hotels that locals and tourists use. We can calculate probabilities for each choice and probabilities for each transition. The product of all these probabilities is the probability of a certain trip. After enough data is collected we can predict with certain probability if a traveler is a local or a tourist based on a trip description. Similarly if we keep track of a of lot genes for a particular organism, going from one sequence position to the next and choosing a particular base at each location, skipping certain positions or adding more, we can come up with the best path that are followed by most gene sequences, representing the conserved sequence positions, e.g. preferred codons and splice sites in that organism. Our gene sequence survey will allow us to calculate the probabilities that any new sequence is indeed a gene H1 H2 H3 R1 R2 R3 Site2 a, b, c R4 Site3 a, b, c BEG Site1 a, b, c END Neural Networks in gene prediction Computational model comprising a collection of neuron-like elements. Input neurons receive sequence, analyze one parameter and pass information to a hidden layer. The strength of the signals are trained to produce correct answer. The output layer integrates the signals and produce the answer The Grail II system for finding exons in eukaryotic genes uses a neural network to identify patterns characteristic of coding sequences. Similarities include the use of three layers, an input layer for the data with the data coming from a candidate exon sequence, and a hidden layer for discerning relationships among the input data. An output layer comprising one neuron indicates whether or not the region is likely to be an exon. Each neuron receives information from a set in the layer above (some with a positive value and others with a negative value), sums these values, and then converts them to an output of approximately 0 or 1. The system is trained using a set of known coding sequences, and, as each sequence is utilized, the strengths and types of connections (positive or negative) between the neurons are adjusted, decreasing or increasing the signal to the next neuron in a manner that produces the correct output. Neural networks for exon prediction use sequence pattern information as input. In Grail II, a candidate sequence is evaluated by calculating pattern frequencies in the sequence and applying these values to the neural network. If the output is close to a value of 1, then the region is predicted to be an exon . Discriminant analysis in gene prediction Discriminant function analysis is a frequently used technique aimed at determining which variables, can discriminate between two or more naturally occurring groups. In the area of gene prediction, multiple variables are used to try to discriminate whether a particular stretch of DNA is from an intron or an exon (presence of putative acceptor sites, donor sites, or start and stop codons, etc.). For two variables (for instance, splice site scores and exon length) the relationships can be represented by an XY graph The two different symbols on the graph represent different groups: x=: exon, whereas o =intron. A linear (Lx) or a quadratic function (Qx) can be used to try to separate the two groups. For three variable the graph will have a volume and for more than three variables you use ndimensional spaces. FGENESH lineal discriminant analysis http://sun1.softberry.com/berry.phtml?topic=fgenesh&gro up=programs&subgroup=gfind MZEF quadratic discriminant analysis http://rulai.cshl.org/tools/genefinder/ Gene Finding Programs Most gene finding programs use dynamic programming: Grail II, FGENESD, GENEID The use of HMM marked a significant advance in the area of gene prediction methodologies. Popular HMM-based gene finding programs are GENSCAN and GENIE Some programs combine ab initio predictions with BLASTX comparisons of translated predicted exons: GENOMESCAN, GENEID. GRAILEXP uses splice site models to align ESTs Different programs produce different results. Use more than one and be critical! Gene prediction of UROD gene( U30787) by FGENESH, GRAIL, GENEID and GENSCAN. The correct EMBL gene is indicated in red Gene Finding Programs: GeneID Uses a hierarchical approach: 1st predicts putative start, stop, and splicing sited 2nd exons are built from these defining sites 3rd calculates coding potential scores 4th the most likely structure is predicted The 2002 version combines ab initio predictions with BLASTX comparisons of translated predicted exons http://genome.imim.es/software/geneid/index.html Exon coordinates in the Protein Protein Gene Finding Programs: GENSCAN General purpose eukaryotic gene prediction program New method: maximal dependence decomposition, using several weight matrices (uses HMM) GenomeScan is an extension that incorporates sequence similarity to known proteins using BLASTX http://genes.mit.edu/GENSCAN.html http://genes.mit.edu/genomescan.html P values > 0.99 are 98% accurate, P>0.9= 88% accurate Gene Finding Programs FGENESH Uses linear discriminant analysis to identify exons and promoter elements (MZEF is another program that uses quadratic discriminant analysis) Filtered exons are assembled using dynamic programming FGENESH is a HMM version of FGENES FGENESH+ & FGENESH-C incorporates protein and cDNA sequence homology. Predicts TATA boxes and PolyA signals http://linux1.softberry.com/berry.phtml?topic=fgenes_plus&group=programs&subgroup=gfs Summary Genes Translate in all 6 frames and look for protein sequence databases (BLASTX) BLASTN to EST database Use gene prediction programs to locate gene Retest the predicted protein against protein database Transposable elements DNA regions flanked by repeats that can jump around the genome Transposable-element (TE) insertion can be fast Allows TEs to rapidly accumulate in genome 44% of human genome sequence is TEs Autonomous: all genes required for transposition Nonautonomous TEs can have different effects on the host Insertion into gene can destroy function TE can evolve into beneficial gene TE can affect gene expression But most TEs will have a neutral effect Inactive Class I transposable elements Use RNA to transcribe themselves Types Long terminal repeat (LTR) retrotransposons Non-LTR retrotransposons Class I transposable elements in the human genome account for ~42% of the total genome sequence Retrotransposon annotation TACAT TGTA Short inverted repeats flank the LTR Host dup. Inv. Flanking LTR LTR TREP annotation provides names and LTRs Wheat 5AL (FL 0.75) 215-kb LTR TGTA TACAT Short host duplications flank the retroelements Inv. Flanking LTR Host dup. They are useful to define borders of nested elements Class II transposable elements Use DNA-based method of transposition Approximately 200,000 copies of this type of TE in the human genome Class II also includes P-element transposons in Drosophila and activation-dissociation (Ac/Ds) elements in maize TSD transposase inverted terminal repeats Example: Tc1-mariner (1.4 kb) inverted terminal repeats TSD Miniature inverted transposable elements (MITEs) Found in plants, insects, nematodes, and humans Nonautonomous class II transposons Small (< 500 bp), less disruptive, size possibly responsible for high copy number Retrotransposon discovery Compare a sequence with itself! Pattern of an LTR retroelement Pattern of a small MITE Inverted repeat MITE2.txt vs MITE2.txt LTR WIS.txt vs WIS.txt 2 nested LTRs hwk4repeat.txt vs hwk4repeat.txt Repetitive elements databases REPBASE: http://www.girinst.org/repbase/index.html (animals, little from plants) REPEATMASKER: http://www.repeatmasker.org/ (animals, little from plants) TIGR: rice and grasses http://tigrblast.tigr.org/euk-blast/index.cgi?project=osa1 (rice) Thomas Wicker, Curator Last update 31 August 2005 TREP, the Triticeae Repeat Sequence Database http://wheat.pw.usda.gov/ITMI/Repeats/index.shtml Choose program and database to search Program Database Browse TREP -- summary tables Nonredundant Complete TREP annotations Nonredundant Complete FASTA files Nonredundant Complete Complete, by species Triticum, Aegilops Hordeum Secale Other Enter sequence below in FASTA format BLAST against TREP Search This database was created by the initiative of Dave Matthews, Thomas Wicker and Jorge Dubcovsky Summary Genes Translate in all 6 frames and look for protein sequence databases (BLASTX) BLASTN to EST database Use gene prediction programs to locate gene Retest the predicted protein against protein database Transposons Class I RNA intermediate Frequent replication Class II DNA intermediate Rare replication MITEs DNA intermediate High copy number in plants
Find millions of documents here - Study Guides, Homework Solutions, Papers, Exam Answer Keys and more. Course Hero has millions of course related materials that will enable you to learn better, faster and get an A in all your courses.
Below is a small sample set of documents:

UC Davis >> COM >> 98 (Fall, 2008)
EUDQFKLQJ WLPH ORJLF/ SHUIHFW LQIRUPDWLRQ JDPHV DQG EDFNZDUG LQGXFWLRQ Jldfrpr Erqdqqr Ghsduwphqw ri Hfrqrplfv/ Xqlyhuvlw| ri Fdoliruqld/ Gdylv/ FD <89490;8:; XVD h0pdlo= jierqdqqrCxfgdylv1hgx zzz1hfrq1xfgdylv1hgx2erqdqqr Iluvw gudiw= Qryhpehu 4<;1 F...
UC Davis >> COM >> 98 (Fall, 2008)
Providing Fine-Grained Access Control For Mobile Programs Through Binary Editing Raju Pandey Brant Hashii Parallel and Distributed Computing Laboratory Computer Science Department University of California, Davis, CA 95616 fpandey, hashiig@cs.ucdavis....
UC Davis >> COM >> 98 (Fall, 2008)
Sept/Oct. 1998 Time to Renew Pollen Transfer Devices Pollination Information Book Three Types of Varroa Second Hive Ventilator 4-H Essay Nutraceuticals Better French Fries CSBA Conventation Free Management Time to Renew As the beekeeping season b...
UC Davis >> NEU >> 290 (Fall, 2008)
...
UC Davis >> NEU >> 451 (Fall, 2008)
...
UC Davis >> CRD >> 1 (Fall, 2008)
JONATHAN K. LONDON DEPARTMENT OF HUMAN AND COMMUNITY DEVELOPMENT UNIVERSITY OF CALIFORNIA, DAVIS EDUCATION Ph.D. University of California at Berkeley. 1995-2001 Environmental Science, Policy, and Management. Specialization in rural social science an...
UC Davis >> CRD >> 1 (Fall, 2008)
Department of Human and Community Development Community Studies and Development Position available for: LECTURER IN COMMUNITY DEVELOPMENT SPRING QUARTER 2009 COURSE: CRD 2 Ethnicity and American Communities Tuesdays and Thursdays, 9:00-10:20 a.m. Qu...
UC Davis >> CRD >> 2 (Fall, 2008)
INTERNATIONAL RELATIONS COURSES OFFERED WINTER 2009 Track 1: WORLD TRADE AND DEVELOPMENT REQUIRED Focus 1A: Focus 1B: Advanced Industrialized Countries ECN 100 Intermediate Micro Theory ECN 101 Intermediate Macro Theory ECN 160A International Microec...
UC Davis >> NPB >> 101l (Winter, 2008)
UC Davis Summer Sessions Special Program 2008 Program/Course(s): Program Dates: Office Use Only NPB 101L-061 (3 units) June 23 August 29, 2008 Application Deadline: TBA Fee Payment Deadline: TBA Term: Rate: Course: CRN: Units: 200806 None NPB 1...
UC Davis >> NPB >> 101l (Winter, 2008)
UC Davis Summer Sessions Special Program 2008 Program/Course(s): Program Dates: Application Deadline: Fee Payment Deadline: Office Use Only NPB 101L-063 (3 units) June 23 August 29, 2008 TBA TBA Term: Rate: Course: CRN: Units: 200806 None NPB 10...
UC Davis >> NPB >> 14 (Fall, 2008)
UC DAVIS: ACADEMIC SENATE GRADUATE COUNCIL AGENDA Wednesday November 14, 2001 2:10 4:00 p.m. 356A Mrak AGENDA ITEM Minutes from October 22, 2001 meeting ANNOUNCEMENTS Announcements from the Chair (Labavitch) Announcements from the Dean (Gonzlez) An...
UC Davis >> NSC >> 223 (Fall, 2008)
Graduate School of Management University of California, Davis Fall 2007 Professor Palmer POWER AND INFLUENCE (MGT/MGP 223) The course examines the bases of power in organizations and the ways in which power can be built and used effectively. It als...
UC Davis >> NSC >> 223 (Fall, 2008)
DIURNAL CHANGES IN FORAGE QUALITY AND THEIR EFFECTS ON ANIMAL PREFERENCE, INTAKE, AND PERFORMANCE Hank Mayland1 , David Mertens 1 , Bret Taylor1 , Joe Burns 1 , Dwight Fisher1 , Pablo Gregorini2 , Tony Ciavarella3 , Kevin Smith3 , Glenn Shewmaker4 an...
UC Davis >> NUT >> 10 (Fall, 2008)
September/October 1996 Help Save the Honeybees Fund Pollination Under Covers Phasing In or Out? WSBA Tidbits Help Save the Honeybees Fund On Wednesday, October 23rd, General Mills kicked off its campaign to Help Save the Honeybees. It was an auspici...
UC Davis >> NUT >> 10 (Fall, 2008)
Sept/Oct 2003 _ Don Strachan 1925-2003 AFB - Recently Harry Laidlaw 1907-2003 AHBs According to Paula CSBA 2003 Convention Have Unique Honey? Hand-mated Queens Web Link Exchange __ Don Strachan 1925-2003 The California beekeeping industry recently ...
UC Davis >> NUT >> 10 (Fall, 2008)
Nutrition 10 Fall 08 Id 003318 006917 011591 013285 013544 014349 018374 021604 022302 022510 022853 023864 025480 025561 026997 028173 028307 029416 030954 031542 032884 034769 037834 038011 038493 039272 041833 044047 044092 044542 050361 053614 06...
UC Davis >> NUT >> 10 (Fall, 2008)
Nutrition 10 Fall 08 MT1 SA 38.50 21.50 32.00 36.50 37.50 38.00 31.50 39.50 30.00 40.00 33.50 31.50 39.50 38.50 34.00 36.00 38.50 35.00 34.00 37.00 35.50 26.50 38.00 38.50 38.50 33.50 31.00 40.50 40.00 MT1 MC 58.00 56.00 56.00 52.00 58.00 62.00 58.00...
UC Davis >> NUT >> 105 (Fall, 2008)
November 2000 Perishables Handling Quarterly Issue No. 104 Page 8 Advances in CA/MA Applications Adel A. Kader, Department of Pomology, UC Davis As supplements to keeping fresh horticultural perishables within their optimum ranges of temperature ...
UC Davis >> NUT >> 105 (Fall, 2008)
Master Gardener Newspaper Articles Volunteer Program Tulare/Kings Counties Maybe Nematodes are Nibbling at Your Roots? by Michelle Le Strange, UC Master Gardener Advisor If plants in your garden just don\'t seem to grow as big or as robust as they sh...
UC Davis >> NUT >> 11 (Fall, 2008)
Recent Acquisitions of the Agricultural and Resource Economics Library University of California, Davis NOVEMBER 2008, vol. 19, no. 10 Editor: Donna McIlvaine Librarian: Barbara Hegenbart The Agricultural and Resource Economics Library welcomes commen...
UC Davis >> NUT >> 11 (Fall, 2008)
China After Accession to WTO: Californias Customer or Cutthroat Competitor? May 6, 2004 China After Accession to WTO: Californias Customer or Cutthroat Competitor? Scott Rozelle Professor and Chancellors Fellow Department of Agricultural and Reso...
UC Davis >> NUT >> 11 (Fall, 2008)
November/December 1996 Renewal Time Almonds Without Bees? Never Predict! Renewal Time I have strategically located a subscription renewal form on the bottom half of page 7. If you cut it off and send it back, your address is already on it (your mail...
UC Davis >> NUT >> 11 (Fall, 2008)
Department of Animal Science Advising Center Fall Newsletter #10 Enjoy the break everyone! In this weeks Newsletter: A. Upcoming Events/Announcements B. Jobs/Internships C. Scholarships A. Upcoming Events/Announcements 1. Animal Behavior Seminar Ser...
UC Davis >> NUT >> 114 (Winter, 2008)
Date:5/4/07 Class: 8thphysicalsci Topic:planetrelativesizeanddistance Unit:Astronomy PurposeorGoal:conceptualizeplanetsrelativesizesanddistances MajorConcepts:smallplanets,hugeamountsofspaceinbetween StudentPerformanceObjectives:Asaresultofthisless...
UC Davis >> NUT >> 115 (Winter, 2008)
...
UC Davis >> NUT >> 122 (Fall, 2008)
SITUATION AND OUTLOOK FOR ALFALFA IN 1991 r L.J. (Bees) Butlerl Abstract: Continuing drought conditions and water resttictions in California appears to have had little effect on acreage, yield and total production of alfalfa in the west in 1990....
UC Davis >> NUT >> 123 (Fall, 2008)
Crop Profile for Avocados in California Prepared: July 13, 1999 General Production Information California\'s Ranking. California produces 95% of the avocados grown in the United States and 10% of the world\'s production (1,2). Acrea...
UC Davis >> NUT >> 199 (Fall, 2008)
Early Care Ensures Fruitful Trees February 2, 2004 Ed Perry, Farm Advisor University of California, Cooperative Extension When planting a new fruit tree in your garden, remember the importance of developing the tree for the long run. While you may pl...
UC Davis >> NUT >> 201 (Fall, 2008)
SMA 50 Ohm Straight Jack Receptacle INCHES (MILLIMETERS) CUSTOMER DRAWINGS AVAILABLE UPON REQUEST VSWR A\" .155 (3.94) Mounting hole layout Johnson Components...
UC Davis >> NUT >> 204 (Winter, 2008)
Fruit and Nut Review BLUEBERRIES There are two general types of cultivated blueberries: highbush and rabbiteye. The native range of the high bush blueberry extends from Wisconsin eastward to Maine and southward to North Carolina. The rabbiteye is na...
UC Davis >> NUT >> 99 (Fall, 2008)
Progress Report Grant Award: $28,268 Funding Period: FY 19972000 A Grower-Managed Biorational Pest Management Program for Artichokes on the Northern Central California Coast Objectives 1. Design and demonstrate a grower-managed biorational articho...
UC Davis >> DES >> 116 (Fall, 2008)
...
UC Davis >> DES >> 117 (Winter, 2008)
MATCH It; AlFAlFA PLANT Vern SYK\'TOMS L. Marble WITH AlFAlFA Pf)BlEMS Ke~worrl~: Alfalfa, Symptoms, Pest, DIagnosIs. GENETIC DIVERSITY PROVIDES RESISTANCE FIELD DIAGNOSIS OF ALFALFA PROBLEMS 1ExTensIon AgronomIsT, UniversiTy of ...
UC Davis >> DES >> 14 (Fall, 2008)
Factors Associated with Bicycle Ownership and Use: A Study of 6 Small U.S. Cities Yan Xing Institute of Transportation Studies University of California Davis Davis, CA 95616 Phone: 530-754-6947 yxing@ucdavis.edu Susan L. Handy Department of Environm...
UC Davis >> DES >> 14 (Fall, 2008)
UC DAVIS: ACADEMIC SENATE GRADUATE COUNCIL AGENDA Wednesday, May 14, 2003 2:00 4:00 p.m. 396 Voorhies Hall AGENDA ITEM ACTION ITEMS Designated Emphasis in Native American Studies PRC Report (Guest: Dr. Kathleen Ward) German PRC Report (Guest: Pro...
UC Davis >> DES >> 14 (Fall, 2008)
Chapter 14: Identity What is identity Multiple names for one thing Different contexts, environments Pseudonymity and anonymity July 1, 2004 Computer Security: Art and Science Slide #15-1 Overview Files and objects Users, groups, and rol...
UC Davis >> DES >> 14 (Fall, 2008)
OUTLINE FOR FEBRUARY 14, 2003 ECS 153 WINTER 2003 Outline for February 14, 2003 Reading: text, 6.2, 9.19.3 Discussion Problem All computer security experts seem to like puns. So, if you want to talk like a computer security expert, here are 14 pu...
UC Davis >> DES >> 144 (Fall, 2008)
...
UC Davis >> DES >> 15 (Fall, 2008)
Agenda Revised 3/12/02 GRADUATE COUNCIL AGENDA Friday March 15, 2002 9:00 - 11:00 a.m., 356A Mrak AGENDA ITEM UC DAVIS: ACADEMIC SENATE ATTACHMENTS DISCUSSION ITEM Recommendations to Improve Postdoctoral Scholar Affairs. Guest: Jeffery Gibeling (9...
UC Davis >> DES >> 15 (Fall, 2008)
SPONSORED BY Programme Monday, 10 july, 8.00 p.m. (Sydney) Monday, 17 july, 8.00 p.m. (Canberra) Hymne des Marseillais Saturday, 15 july, 8.00 p.m. Marche pour la presentation des drapeaux Berlioz Rouget de Lisle, arr. Berlioz Hymne des Marseillais...
UC Davis >> DES >> 15 (Fall, 2008)
An extended abstract of this paper appears in Advances in Cryptology { Crypto 94 Proceedings, Lecture Notes in Computer Science Vol. 839, Y. Desmedt ed., Springer-Verlag, 1994. This is the full version, to appear in Journal of Computer and System Sci...
UC Davis >> DES >> 16 (Fall, 2008)
Appears in the proceedings of the First ACM Conference on Computer and Communications Security, ACM, November 1993. Random Oracles are Practical: A Paradigm for Designing E cient Protocols Mihir Bellare Phillip Rogawayy October 20, 1995 We argue t...
UC Davis >> DES >> 16 (Fall, 2008)
Yanyan Yang June 2006 Computer Science IPSEC/VPN SECURITY POLICY ENGINEERING: AUTOMATIC GENERATION AND CONFLICT DETECTION Abstract IPsec is a useful IP layer security protocol which can provide authentication and encryption for end-to-end traffic f...
UC Davis >> DES >> 16 (Fall, 2008)
1 110TH CONGRESS \" 1st Session COMMITTEE PRINT ! S. PRT. 11033 EMBASSIES GRAPPLE TO GUIDE FOREIGN AID A Report to Members OF THE COMMITTEE ON FOREIGN RELATIONS UNITED STATES SENATE Richard G. Lugar, Ranking Minority Member ONE HUNDRED TENTH CO...
UC Davis >> DES >> 16 (Fall, 2008)
Influence of Method of Supplementation on the Utilization of Supplemental Fat by Feedlot Steers R. A. Zinn, A. Plascencia*, and Y. Shen ABSTRACT: Seventy-two Holstein steers (273 kg) were used in a 151-d feeding trial to evaluate the influence of met...
UC Davis >> DES >> 160 (Winter, 2008)
VOTING FOR C O N S E R VAT I O N WHAT IS THE AMERICAN ELECTORATE REVEALING? SPENCER BANZHAF, WALLACE OATES, JAMES N. SANCHIRICO, DAVID SIMPSON, AND RANDALL WALSH You know, if one person, just one person [walks in and sings Alices Restaurant] they...
UC Davis >> DES >> 171 (Fall, 2008)
...
UC Davis >> DES >> 171 (Fall, 2008)
Biometrics 60, 165171 March 2003 Sample Size Calculations for Surveys to Substantiate Freedom of Populations from Infectious Agents Wesley O. Johnson,1 Chun-Lung Su,2 Ian A. Gardner,2 and Ronald Christensen3 1 Department of Statistics, University o...
UC Davis >> DES >> 22 (Fall, 2008)
UC DAVIS: ACADEMIC SENATE GRADUATE COUNCIL AGENDA Wednesday, September 22, 2004 1:00 3:00 p.m. 3201 Hart Hall AGENDA ITEM ATTACHMENT 1.1 1.2 1.3 Welcome and Introductions from the Chair (Berger) Graduate Council 2004-2005 Membership List, Draft C...
UC Davis >> DES >> 22 (Fall, 2008)
ENERGY,EFFICIENCY,TECHNOLOGY,BUSINESSINNOVATION,ANDDESIGN RecommendedCourseList Note:Coursesnormallyappearonlyunderonecategoryeventhoughtheymayoverlapmultiple categories.CoursesinboldaretaughtorespeciallyrecommendedbytheEEC.Additionalcoursesmay be...
UC Davis >> DES >> 22 (Fall, 2008)
ESP 178 Applied Research Methods 2/22 Class Exercise: Quantitative Analysis Introduction: In summer 2006, my student Ted Buehler and I conducted a survey of residents in Davis and five other cities. The purpose of the survey was to test the effect of...
UC Davis >> DES >> 22 (Fall, 2008)
Outline for February 22, 2001 ECS 251 Winter 2001 Page 1 Outline for February 22, 2001 1. Greetings and felicitations! a. Friday Feb 23 1:10-2:30 (if not in this room, look in 1062 Banier); go to 1101 Hart Hall to view b. No class Tuesday (anothe...
UC Davis >> DES >> 290 (Fall, 2008)
GENETIX A. General Information Download it on the web at http:/www.univ-montp2.fr/%7Egenetix/genetix/genetix.htm An english translation of the Genetix help page can be accessed via google translate this page function at: http:/translate.google.com/...
UC Davis >> DES >> 290 (Fall, 2008)
Factorial Correspondence Analysis (FCA) Or Analyse Factorielle des Correspondences (AFC) FCA Presentation Outline 1. Introduction What FCA is When to use FCA 2. How FCA works Basic definitions and principlesnot all the math! 3. How to troublesho...
UC Davis >> DES >> 99 (Fall, 2008)
A REVIEW AND DISCUSSION OF THE LITERATURE ON TRAVEL TIME AND MONEY EXPENDITURES UCD-ITS-RR-99-25 November 1999 by Cynthia Chen Institute of Transportation Studies And Civil and Environmental Engineering University of California, Davis 95616, USA Fax ...
UC Davis >> DES >> 99 (Fall, 2008)
...
UC Davis >> DES >> 99 (Fall, 2008)
Diversity and the Geometry of Similarity Klaus Nehring Department of Economics, University of California at Davis Davis, CA 95616, U.S.A. This Version: July 16, 1999 1 Introduction In the companion paper A Theory of Diversity I (Nehring and Pupp...
UC Davis >> DRA >> 1 (Fall, 2008)
Review TRENDS in Genetics Vol.21 No.10 October 2005 Comparative genomics of nematodes Makedonka Mitreva1, Mark L. Blaxter2, David M. Bird3 and James P. McCarter1,4 1 2 Genome Sequencing Center, Department of Genetics, Washington University School ...
UC Davis >> DRA >> 1 (Fall, 2008)
REVIEWS REVIEWS REVIEWS Managing microevolution: restoration in the face of global change Kevin J Rice1,2 and Nancy C Emery2 Evidence is mounting that evolutionary change can occur rapidly and may be an important means by which species escape extinc...
UC Davis >> DRA >> 10 (Fall, 2008)
Downloaded from www.genesdev.org on January 2, 2008 - Published by Cold Spring Harbor Laboratory Press Fertility versus disease resistance, a hard choice Rebecca Bart, Pamela Ronald and Sarah Hake Genes & Dev. 2006 20: 1215-1217 Access the most rece...
UC Davis >> DRA >> 10 (Fall, 2008)
...
UC Davis >> EAD >> 1 (Fall, 2008)
MINUTES OF THE UNDERGRADUATE EDUCATIONAL POLICY COMMITTEE DECEMBER 1, 2004 Faculty Members Present: F. Fathallah, M. Savageau, R. Phillips, J. Bolander, J.P. Colinge, Y. Yeh, G. Ford and B. Shaw, Chairman Faculty Members Absent: N. Matloff Staff Memb...
UC Davis >> EAD >> 1 (Fall, 2008)
BIM 289B/EAD 289F : Special Topics in Biophotonics Dennis L Matthews, PhD Director, Center for Biophotonics Science and Technology Assoc Director of Cancer Center and Professor, UCDavis Director, Center for Biotechnology, Biophysical Science and Bioe...
UC Davis >> EAD >> 1 (Fall, 2008)
1 Minutes Undergraduate Educational Policy Committee Meeting Wednesday, March 1, 2006 1:102:00 1003 Kemper Hall Members Present: D. Krol, A. Louie, J. Bolander, J.P. Colinge, B. Shaw, G.Ford (ex officio) Members Absent: B. Higgins, R. Piedrahita, N. ...
UC Davis >> EAD >> 1 (Fall, 2008)
Review of the Integrated Groundwater and Surface-Water Model (IGSM) Eric M. LaBolle1, Ayman A. Ahmed2, and Graham E. Fogg3 1 Hydrologic Sciences, University of California, Davis, emlabolle@ucdavis.edu, Davis, CA, USA 2 Visiting scholar from Facult...
UC Davis >> EAD >> 115 (Fall, 2008)
University of California, Davis Department of Applied Science Spring 2008 David M. Rocke Numerical Methods EAD 115 May 22, 2008 Homework Assignment 7 Due May 29, 2008 1. Do problem 25.125.5 from the text. 2. Do problem 25.11 and 25.12 from the te...
UC Davis >> EAD >> 2 (Fall, 2008)
UNIVERSITY OF CALIFO RNIA, DAVIS COLLEGE OF ENGINEE RING TRANSF ER CREDIT AGR EEMENT WITH 1050 KEMPER H ALL OF ENGINEE RING MRAK HALL, DAVIS, C A. 95616 2006- 2007 ACADEMIC YEA R UNIVERSITY OF CALIFO RNIA, DAVIS ARTICULATION OFFIC E COLLEGE (S em es...
UC Davis >> EAD >> 2 (Fall, 2008)
COLLEGE OF ENGINEE RING (530) 752- 1979 http:/ / engineering.ucdavis.edu TRANSF ER CREDIT AGR EEMENT WITH 1050 KEMPER HALL OF ENGINEE RING MRAK HALL, DAVIS, C A. 95616 2008- 2009 ACADEMIC YEA R ARTICULATION OFFIC E (S em ester) (530) 752- 6302 LO...
UC Davis >> EAD >> 2 (Fall, 2008)
\" Flanders Eastin Moorehea d Worthington Netherton # Jensen Bambauer Andersen Eastin Prince State Highway 140 Elholm East Mil Pete ler Linden Laurel West Grove \" k Schmidt Diablo Grande Parkway Kniebes Hunt # Fentem North 1st Ca...
UC Davis >> EAD >> 99 (Fall, 2008)
Security Lab Seminar Adage by Rich Simon, Mary Ellen Zurko, et. al. The Open Group Research Institute http:/www.camb.opengroup.org/www/adage/ presented by James Hoagland hoagland@cs.ucdavis.edu Security Lab Seminar, 99-01-20 Computer Security R...
What are you waiting for?