Coursehero >> California >> UC Davis >> R 0303

Course Hero has millions of student submitted documents similar to the one below including study guides, homework solutions, papers, exam answer keys and textbook solutions.

Gen Mol Genomics (2003) 269: 280 289 DOI 10.1007/s00438-003-0834-2 O R I GI N A L P A P E R J.-S. Jeon D. Chen G.-H. Yi G. L. Wang P. C. Ronald Genetic and physical mapping of Pi5(t), a locus associated with broad-spectrum resistance to rice blast Received: 8 October 2002 / Accepted: 12 February 2003 / Published online: 19 March 2003 Springer-Verlag 2003 Abstract To gain an understanding of the molecular basis for resistance to rice blast (Magnaporthe grisea), we have initiated a project to clone Pi5(t), a locus associated with broad-spectrum resistance to diverse blast isolates. AFLP-derived markers linked to Pi5(t)-mediated resistance were isolated using bulked segregant analysis of F2 populations generated by crossing three recombinant inbred lines (RILs), RIL125, RIL249, and RIL260 with the susceptible line CO39. The most tightly linked AFLP marker, S04G03, was positioned on chromosome 9 of the ngerprint-based physical map of Nipponbare, a well-characterized rice genotype. Flanking BAC-based Nipponbare markers were generated for saturation mapping using four populations, the three initial RILs and an additional one derived from a cross between M202 and RIL260. A BIBAC (binary BAC) library was constructed from RIL260. Using these resources Pi5(t) was mapped to a 170-kb interval, and a contiguous set of BIBAC clones spanning this region was constructed. It had previously been suggested that Pi3(t) and Pi5(t) might be allelic, due to their identical resistance spectrum and tight linkage. We therefore compared genomic regions for lines containing Pi3(t) using the Pi5(t)-linked markers. DNA gel-blot analyses indicated that the region around Pi3(t) is identical to that of Pi5(t), suggesting that Pi3(t) and Pi5(t) are the same resistance gene. Keywords Magnaporthe grisea Blast resistance Pi3(t) Pi5(t) Genetic and physical mapping Introduction Rice blast, which is caused by the fungus Magnaporthe grisea, is one of the most destructive diseases of rice, costing farmers $5 billion a year (Mo at 1994). The management of rice blast relies heavily upon the incorporation of single disease resistance genes. However, blast resistance in many cultivars is short-lived in environments that are conducive to the disease (Lee and Cho 1990), due to the high degree of pathogenic variability of the causative organism M. grisea (Ou 1979; Bonman et al. 1986). Therefore breeding for cultivars that display broad-spectrum resistance has become a priority for crop improvement. The genetic basis of broad-spectrum resistance is still not well understood. It may be controlled by single genes or multiple genes with cumulative e ects (Johnson 1981). Relatively broad spectrum or durable resistance has been observed in some rice cultivars. For example, the traditional African cultivar Moroberekan has been cultivated for many years in large areas of West Africa without high losses from blast (Bonman and Mackill 1988). ROK16, LAC23, IRAT13, OS6 and some Brazilian upland rice cultivars show durable resistance to blast in upland conditions (Bidaux 1978; Bonman and Mackill 1988; Lee et al. 1989; Ahn 1994; Fomba and Taylor 1994). Tetep, an indica rice cultivar, and Communicated by M.-A. Grandbastien J.-S. Jeon D. Chen G.-H. Yi P. C. Ronald (&) Department of Plant Pathology, University of California, One Shields Avenue, Davis, CA 95616, USA E-mail: pcronald@ucdavis.edu Tel.: +1-530-7521654 Fax: +1-530-7525674 G. L. Wang Department of Plant Pathology, The Ohio State University, 201 Kottman Hall, 2021 Co ey Road, Columbus, OH 43210, USA Present address: J.-S. Jeon Plant Metabolism Research Center and Graduate School of Biotechnology, Kyung Hee University, Yongin 449-701, Korea Present address: D. Chen DNA LandMarks, Saint-Jean-sur-Richelieu, Quebec, J3B 6Z1, Canada Present address: G.-H. Yi National Youngnam Agricultural Experiment Station, Rural Development Administration, Milyang 627-130, Korea 281 Pai-Kan-Tao (PKT), a temperate japonica cultivar, both exhibit broad-spectrum resistance to rice blast (Yu et al. 1987; Mackill and Bonman 1992; Ahn 1994,2000). Many of these rice lines have been used as resistance donors in breeding programs (Mackill and Bonman 1992; Inukai et al. 1994). Phenotypic evaluation of nearisogenic lines (NILs) suggested that as many as four major resistance genes could be identi ed in Tetep, three in PKT including Pi3(t), two in Moroberekan and two in LAC23 (Mackill and Bonman 1992; Inukai et al. 1994; Wang et al. 1994). Isolation and characterization of the genes conferring resistance in these cultivars should provide insight into the genetic basis of broadspectrum resistance and may be useful in developing new genotypes. For this purpose, a recombinant inbred (RI) population consisting of 281 F7 lines was produced by singleseed descent from a Moroberekan CO39 cross (Wang et al. 1994). These lines were evaluated for resistance in the greenhouse and eld, and analyzed with 127 restriction fragment length polymorphism (RFLP) markers. Two dominant loci, Pi5(t) and Pi7(t), that segregated with complete resistance to ve blast isolates were identi ed, while ten quantitative trait loci (QTLs) segregated with partial resistance. Greenhouse inoculation tests showed that the RI lines (RILs) RIL125, RIL249 and RIL260, which carry Pi5(t), were resistant to at least six races belonging to four lineages in the Philippines (Wang et al. 1994; Chen et al. 2000). These lines were then evaluated for eld performance in the Philippines and Indonesia, in locations where the blast fungal populations have been shown to be diverse and broadly virulent (Wang et al. 1994; Chen et al. 1995; Zeigler et al. 1995). The eld tests indicated that the Pi5(t)-containing RILs displayed resistance to diverse isolates. In a separate study, the recombinant inbred line RIL249 exhibited resistance to 26 of 29 Korean isolates tested (S.-S. Han, personal communication). Together, these studies suggest that the Pi5(t) locus itself confers broad-spectrum resistance to rice blast. When the resistance pro les of the RILs carrying Pi5(t) were compared with those of the CO39 NIL lines carrying Pi3(t) (C104PKT), the reaction pattern was similar. Genetic and phenotypic analysis of an F2 population derived from the cross between RIL249 and C104PKT indicated that the Pi5(t) resistance gene in RIL249 is allelic, or else closely linked, to Pi3(t) (Inukai et al. 1996). We have initiated a positional cloning approach to clone the Pi5(t) locus. Major advances in rice genomics over the last few years have made positional cloning in rice much more e cient. A high-density genetic linkage map and a YAC- and BAC-based contig map have been constructed for the rice cultivar Nipponbare (Harushima et al. 1998; Chen et al. 2002; Wu et al. 2002). Over 110,000 sequence-tagged connectors (STCs) have been generated by sequencing both ends of every BAC clone (Mao et al. 2000). A ngerprint-based contig (FPC) of BAC clones has been anchored with RFLP markers onto the genetic map (Yuan et al. 2000). Using these resources and four mapping populations, we have set up an e cient procedure to construct a genetic and physical map for the Pi5(t) locus. We have assembled a 170-kb Binary BAC (BIBAC) contig containing Pi5(t), and shown that the Pi5(t) locus is identical to the Pi3(t) locus, and that PKT and Moroberekan are not the donors of Pi3(t) and Pi5(t), respectively. Materials and methods Plant materials and mapping populations Three Pi5(t) RI lines, RIL125, RIL249 and RIL260, derived from a cross between Moroberekan and CO39 (Wang et al. 1994) were selected for this study. These lines were completely resistant to the blast isolate PO6-6. RIL260 was used as the resistance control in all analyses, and for the construction of the genomic DNA library. Crosses of each of these lines with CO39, the susceptible parent of the RIL population, were performed to develop segregating F2 populations for DNA marker and resistance segregation analysis. Each of the three F2 populations consisted of 50 to 70 individual plants. F3 families were developed from the F2 populations for further DNA marker and resistance analysis. The segregating F3 families derived from the cross between RIL260 and CO39 were advanced to develop an F4 segregating population consisting of 2000 individuals. An additional cross of RIL260 to M202, a susceptible parent, was performed to develop an F3 family consisting of over 1000 individuals for high-resolution mapping. The cultivars C104PKT and PKT were provided by the National Small Grains Research Facility, USDA-ARS, Aberdeen, Idaho. Inoculation and disease evaluation The M. grisea isolate PO6-6 was used for all phenotypic analyses. PO6-6 is a pathogenically stable isolate from the Philippines, and was used to detect the Pi5(t)locus in the RIL population (Wang et al. 1994). All inoculations and disease evaluations were conducted in greenhouses at the International Rice Research Institute (Los Banos, Philippines) and at Ohio State University, as described in Chen et al. (1996). BSA and AFLP analysis Four pooled DNAs representing homozygous resistance (RR) and homozygous susceptible (rr) lines were made for bulk segregant analysis (BSA) (Michelmore et al. 1991) using ampli ed fragment length polymorphism (AFLP) screening. Each bulk DNA pool contained equivalent amounts of DNA from ten DNA samples extracted from the bulked leaves of the F3 homozygous families. Total DNA was extracted from young leaves following the protocol described by McCouch et al. (1988). Polymorphic AFLP markers associated with resistance in the bulks were con rmed in the F2 individuals from which the bulks were constructed. The segregation data for both AFLP loci and resistance phenotypes obtained from the F2 population and F3 families were used to estimate the genetic distance between the molecular marker loci and the resistance locus. AFLP markers were used to screen DNA markers linked with the resistance according to the following procedure (Chen et al. 1999). Rice genomic DNAs digested with EcoRI and MseI were ligated with double-stranded adapters. The EcoRI adapter was a 1:1 mixture of the primers 92A18 (5 -GACGATGAGTCCTGAG3 ) and 92A19 (3 -TACTCAGGACTCAT-5 ). The MseI adapter was an equal mixture of the primers 91M35 (5 -bio- 282 CTCGTAGACTGCGTACC-3 ) and 91M36 (3 -CTGACGCATGGTTAA-5 ). Signal detection was carried out by end-labeling the primer speci c for the EcoRI adapter with [c-33P]ATP. The linked AFLP markers were converted into RFLP probes by cloning the DNA fragment into pCRII (Invitrogen), a TA cloning vector, and then analyzed by DNA sequencing. below). In the second round of PCR, the 11 or 12 minipools making up the super pool showing a positive hit were then screened individually. Over 2000 individual clones of the identi ed mini-pool were further screened by colony blot hybridization (Sambrook et al. 1989) using the products ampli ed in the second PCR as probes. RFLP analysis For RFLP analysis, samples of over 3 lg of rice genomic DNA were digested with restriction enzymes and fractionated by electrophoresis in a 0.8% agarose gel. DNA gel-blot analyses were carried out according to standard procedures under high-stringency hybridization conditions (Sambrook et al. 1989). The lters were then scanned with a Phosphoimager (Molecular Dynamics). DraI-digested genomic DNA was used for RFLP analysis of the markers 17I18-12, 39B24-1, 4D13-2-2, G103, and C1454. EcoRI and HindIII were used for the markers 34E14-10 and 47J03f, respectively. Sequence analysis of BIBAC ends The isolated plasmids were sequenced using T3 and T7 primers to obtain both end sequences of the cloned insert. The BIBAC-end sequences of each clone were ampli ed by PCR using speci c primers and were subsequently used for chromosome walking. Sublibrary construction of BAC or BIBAC clones Size-fractionated DNAs ($2 kb) were obtained after partial digestion with Sau 3AI, ligated to the BamHI site of pBluescriptII SK+, and transformed into E. coli DH10B. The inserts were used for RFLP and CAPS analysis. CAPS analysis For CAPS (cleaved ampli ed polymorphic sequence) analysis, rice genomic DNA was isolated from young leaves using a simple miniprep method (Chen and Ronald 1999). CAPS analysis was performed in a volume of 30 ll (100 pmol of each primer, 200 lM each of dNTPs, 10 mM TRIS-HCl pH 9.0, 2 mM MgCl2, 50 mM KCl, 0.1% Triton X-100, and 0.5 U of Taq polymerase) using 50 ng of genomic DNA as template. The digested PCR products were subsequently size-fractionated on 2% agarose gels. Linkage analysis Linkage analysis was performed using Mapmaker software (Lander et al. 1987) on a Macintosh computer. The segregation dataset generated from the 204-member F2 population of Black Gora/Labelle (Redona and Mackill 1996) and the 186 Nipponbare/ Kasalath plants (Harushima et al. 1998) were combined with the established AFLP data set for the analysis. Map distances presented in cM between markers were derived using the Kosambi function (Kosambi 1944). BIBAC library construction High-molecular-weight (HMW) DNA was prepared from young leaves of RIL260 by the CTAB method (Murray and Thompson 1980). The isolated HMW DNA was partially digested with HindIII and then size-fractionated using a pulsed- eld gel electrophoresis device (CHEF DR II system, Bio-Rad) as described previously (Wang et al. 1995). The puri ed DNA from the low-melting point agarose slice containing fragments of 30 50 kb was ligated to the HindIII-digested and dephosphorylated pBIGRZ vector provided by Dr S. Kawasaki (Tsunoda et al. 2000). The ligation mix was transformed by electroporation using a Cell-Porator (GibcoBRL) into Escherichia coli DH10B. About 500 clones were resuspended in 4 ml of the freezing bu er (Peterson et al. 2000) to form a BIBAC minipool. Results Genetic and phenotypic analysis of RI lines Based on the molecular and phenotypic dataset from a previous study, three resistant parents, RIL125, RIL249 and RIL260, were selected for ne-scale mapping of Pi5(t). All three lines showed complete resistance to the blast isolate PO6-6, giving scores of 0 to 1 on a scale of 0 5 with 5 being the most susceptible. CO39 and M202, the susceptible parents used in the study, were compatible with PO6-6, displaying a score of 4 5 in repeated inoculations. The resistance and susceptibility phenotypes of the three F2 populations developed from crosses of RIL125, RIL249, RIL260 with CO39 were determined by monitoring the e ects of inoculating the F2 plants and the corresponding F3 families. The distribution of resistance in the F2 population was compatible with a 3:1 segreC2 0.55 0.31 0.24 0.05 Pa 0.46 0.58 0.62 0.82 BIBAC library screening Aliquots (50 lL) of E. coli cells from each of 186 BIBAC minipools were used for preparation of total BIBAC plasmids. Total BIBAC DNAs were isolated by standard alkaline lysis procedures (Sambrook et al. 1989). Equivalent amounts of DNAs puri ed from 11 or 12 minipools were mixed to make a super pool, producing 16 super pools. The rst round of PCR was performed using 16 super pools and Pi5(t) marker-speci c primers (see Table 1 Chi square test for the segregation of resistance and susceptibility in F2 populations inoculated with the rice blast isolate PO6-6 a The goodness of t to a 3:1 ratio is indicated Cross RIL125/CO39 RIL249/CO39 RIL260/CO39 RIL260/M202 Total number of F2 plants observed 49 68 50 59 Resistant 39 53 39 45 Susceptible 10 15 11 14 283 gation ratio for all three populations (Table 1). The three genotypes in the F3 families (RR, Rr and rr) t a 1:2:1 segregation ratio (data not shown). In each of the heterozygous F3 families, the resistance/susceptibility phenotypes followed a 3:1 segregation pattern. The resistance in the additional F2 population derived from a cross between RIL260 and M202 also segregated in a 3:1 ratio (Table 1). These results indicate that in each of the selected lines a single dominant locus confers resistance to PO6-6. Identi cation of AFLP markers linked with the resistance An AFLP experiment was employed to identify markers linked to the resistance, using two pooled DNAs for each homozygous resistance and for homozygous susceptibility. Of the 579 AFLP primer combinations screened, one primer pair, S04G03, identi ed a polymorphic marker associated with resistance in RIL125. Out of 350 primer pairs surveyed, 11 AFLP markers were associated with resistance in the RIL249-derived F2 population. Out of 750 primers surveyed, 12 markers were associated with resistance in the RIL260-derived F2 population. These AFLP markers were converted into RFLP markers by cloning the bands into a TA cloning vector. For S04G03 it was di cult to obtain a hybridization signal in DNA gel-blot analyses with the 48-bp AFLP fragment. To obtain a larger fragment including this marker, we isolated a BIBAC clone, JJ5, by screening a Moroberekan library (J.-S. Jeon, D. Chen and P. C. Ronald, unpublished data) with SO4GO3 as a probe. Sequence analysis of JJ7, a 1.9-kb subclone of JJ5, revealed that the clone contains not only SO4G03 but also S10F07, which was isolated from the RIL260derived F2 population, another AFLP marker linked to Pi5(t). Thereafter, the subclone JJ7 was used as a probe to represent the S04G03 and S10F07 markers in the present study. Fig. 1A, B Co-segregation of two markers, S04G03 (A) and 47J03f (B), with Pi5(t)resistance. Genomic DNA was digested with HindIII and fractionated in a 0.8% agarose gel. R1 to R9, and S1 to S6 are homozygous resistant and homozygous susceptible lines from the RIL260/CO39 F2 population, respectively. DNA from Moroberekan, CO39, RIL125, RIL249, RIL260 and RIL29 [lacking Pi5(t)] were included as controls To verify that the AFLP markers co-segregate with the resistance phenotype in Pi5(t) lines, we carried out DNA gel-blot analysis using F2 homozygous susceptible and resistant lines. The result showed that S04G03, identi ed in all three populations, co-segregated with resistance in 15 individuals (Fig. 1A). DNA gel-blot analysis with the co-dominant 47J03f marker (see below) also co-segregated with S04G03 (Fig. 1B). Of all AFLPderived markers from the three populations, S04G03 was the most tightly linked to Pi5(t) in 48 RIL249derived F2 lines. The other markers gave one to four recombination events between Pi5(t) and each marker (data not shown). Pi5(t) is located on chromosome 9 Primer pairs generating the linked markers were used to analyze the parents of the Black Gora/Labell mapping population (Redona and Mackill 1996). Nine primer pairs (S04G03, S10F07, S08G24, S10M04a, S10M04b, B11G19, R01G23a, R01G23b, P03G07) detected polymorphism between Black Gora and Labell at the loci associated with the resistance to PO6-6. Linkage analysis with Mapmaker showed that all the markers from the RIL125-, RIL 249- and RIL260derived populations were located on chromosome 9 (Fig. 2). These results suggested that the loci that conferred resistance to PO6-6 in the three RILs were probably the same as, or tightly linked to, Pi5(t) on chromosome 9. The Pi5(t) locus was previously reported to be linked to the DNA marker RG788 on chromosome 4 (Wang et al. 1994). However, DNA gel-blot analysis using RG788 in the F2 population derived from the RIL249 cross indicated that Pi5(t) was not linked to RG788 (data not shown). Our data thus con rmed the results of another study that also showed that the resistance gene in RIL249 was unlinked to RG788 (Inukai et al. 1996). 284 Fig. 2 Genetic and physical maps of the Pi5(t)locus on rice chromosome 9. The nine AFLP markers identi ed (S10M04a, S10M04b, R01G23a, R01G23b, P03G07, S04G03, S10F07, S08G24, B11G19) were localized on the genetic linkage map of Black Gora/Labell (top). The numbers below this map are relative genetic distances in cM. S04G03, which co-segregates with Pi5(t) resistance, was also mapped on the high-density genetic map of Nipponbare/Kasalath (upper middle). These data were used to identify BAC subclones from the CUGI database that spanned the region (bottom). Markers were developed from these BAC subclones and used to localize Pi5(t)on the RIL249/CO39 map (lower middle). The key markers used in this study were mapped on the Nipponbare BAC contig as shown in the bottom panel High-resolution mapping of Pi5(t): use of Nipponbare BAC clones Saturation mapping of a small genomic region is an essential tool for positional cloning (Monna et al. 1997). To pinpoint the Pi5(t)genomic region, we mapped the co-segregating marker S04G03 onto the linkage map of Table 2 PCR-based markers linked to the Pi5 locus Markera 94A20r 34E14-10 17I18-12 2P10r 76B14f 40N23r C1454 S04G03 a Nipponbare/Kasalath to identify RFLP markers linked to Pi5(t) (Harushima et al. 1998) (Fig. 2). These results indicated that the marker C1454 is tightly linked to S04G03, only 0.8 cM away. We then used C1454 as a probe in colony hybridization experiments with two BAC libraries of Nipponbare provided by the Clemson University Genome Institute (CUGI). These experiments enabled us to identify a large physical region of more than 1000 kb consisting of Nipponbare BAC clones carrying the C1454/SO4G03 genomic region (Chen et al. 2002) (Fig. 2). Six of these Pi5(t)-linked Nipponbare BAC clones were used to develop additional markers that ank Pi5(t). The BAC clones were selected using information based on the primary genetic map of Pi5(t), the location of RFLP markers, and the FPC map consisting of Nipponbare BAC contigs (Fig. 2). They were digested partially with Sau 3AI for subcloning. Out of 150 subclones tested, 25 showed clear polymorphisms between the three RILs and CO39 as determined by DNA gel-blot analysis. The remaining clones included those that were monomorphic between the parents, those that gave comparatively weak hybridization signals or those with multiple bands, which were considered inappropriate for further analysis (data not shown). Eight polymorphic markers, 34E14-10, 4D13-2-2, 2P10r, C1454, 76B14f, 40N23r, 47J03f, and 17I18-12, were used because they were evenly distributed or homologous to known resistance genes (Fig. 2). Thus, the amino acid sequences deduced from the DNA sequences of 76B14f and 40N23r showed similarity to a nucleotide binding site plus leucine-rich repeat (NBS-LRR) motif. To use the markers most e ciently in the analysis of a large population, they were converted to CAPS markers using marker-speci c primers (Table 2). Because C1454 and S04G03 could not be converted to CAPS markers, we instead ampli ed the corresponding regions of both markers from RIL260 and M202, and directly compared the sequences of the PCR products. Both markers showed a few nucleotide di erences between RIL260 and M202 (Table 2; data not shown). Forward primer (5 3 ) AATTCCATTCGCCACCGAGTGCTC CCTACCACCACAGGACATAACA TACACGAACAACCAAATCGACC ATTGTCAAGCTCTTCTGCTGTC GTCTTGGACTTAAAGCACTACC TGTGAGGCAACAATGCCTATTGCG CACCTGAAGGCTGAAAATCTGAAT CTTAACAATCAATGTTTAATGAAA Reverse primer (5 3 ) TCTCAGTATAGAACACTAACTCTA GTTTCTTCTCTTATCCCCTCTC AGGCGTTTGGTTTTGGTGGAGA TGAACTGATCATCAAATCAATC TGAGAAACTGGTTCAAATTGGC CTATGAGTTCACTATGTGGAGGCT CCGTTGATAGCGCTTAATGTTCTT GTTATATTATACTAATTGTTTATC Enzyme AvaII AseI HindIIIb, HinPIIc DpnII DraI EcoRI Mapping population RIL/CO39 RIL/CO39 RIL/CO39, RIL260/M202 RIL/CO39, RIL260/M202 RIL260/M202 RIL260/M202 RIL260/M202 RIL260/M202 With the exception of C1454 and S04G03, all markers are CAPS markers. For these two markers, sequence analysis of PCR products was used to survey polymorphisms b RIL/CO39 c RIL260/M202 285 We used the anking markers 94A20r and G103 to narrow down the region carrying Pi5(t) on the genetic map of RIL249/CO39. This was easily accomplished because the parents of the RIL249/CO39 F2 population were polymorphic for these markers. The marker 94A20r was developed from a Nipponbare BAC clone that contains the previously mapped marker R1687. R1687 was monomorphic between the parents. The result revealed that Pi5(t)mapped to an 11.5-cM interval (11 recombinations in 96 meiotic events) between the markers 94A20r [5.2 cM proximal to Pi5(t)] and G103 [6.3 cM distal to Pi5(t)] in the RIL249/CO39 F2 population (Fig. 2). To identify more recombination events at the Pi5(t) locus, two markers anking Pi5(t) (34E14-10 and 17I18-12) within the 11.5-cM region de ned by the above analysis, were screened in 731 susceptible individuals and 515 resistant and segregating individuals of BC2F4 RIL260/CO39 using CAPS analysis. Since the susceptibility score is more reliable than the resistance estimate (due to escapes from the inoculum), we rst analyzed all susceptible plants to make an accurate map, and the remaining plants were analyzed later. In the primary screen, 22 and 8 recombination events were identi ed between 34E14-10 and Pi5(t) and between 17I18-12 and Pi5(t), (Fig. respectively 3). The recombinant lines were further analyzed using internal PCR markers. The analysis identi ed a recombination event between 4D13-2-2 and 2P10r. The other six markers, 2P10r, C1454, 76B14f, 40N23r, S04G03 and 47J03, co-segregated with Pi5(t). To identify rare recombination events at the Pi5(t) locus, F2 segregating populations of RIL125/CO39 and RIL249/CO39 were analyzed further (Fig. 3). This identi ed a recombination event between 4D13-2-2 and 2P10r and two between 47J03f and 17I18-12 from the RIL125/CO39 population, and one between 34E14-10 and 4D13-2-2 and two between 47J03f and 17I18-12 from the RIL249/CO39 population (Fig. 3). Phenotypic analyses of all recombinant lines identi ed demonstrated that the resistance locus is most likely to be same in all three RILs, RIL125, RIL249 and RIL260 (Fig. 3). On the basis of the Nipponbare contig (Chen et al. 2002) it is estimated that the genomic region between 17I18-12 and 4D13-2-2 is approximately 300 kb long. We were not able to localize the gene to a smaller physical region even when the mapping population was enlarged, because skewed recombination events were observed at the Pi5(t) locus. Thus, we developed another F2 segregating population derived from a cross between RIL260, a resistant cultivar, and M202, a susceptible cultivar, and analyzed 871 F3 individuals to further delimit Pi5(t) to a small physical region. Since we have limited quarantine facilities for blast inoculations, we employed a prescreening strategy to identify plants with rare recombination events around the Pi5(t) region using the anking CAPS markers 2P10r and 17I18-12. These experiments identi ed 23 recombinants between 2P10r and 17I18-12: 17 recombination events between 2P10r and Pi5(t), and six recombination events between 17I18-12 and Pi5(t) (Fig. 3). Phenotypes of all the identi ed lines displaying these rare recombination events were con rmed in the progeny from each line. Through further analyses of these recombinants with the internal markers, one recombinant between C1454 and Pi5(t) and two recombinants between S04G03 and Pi5(t) were identi ed. This high-resolution mapping experiment thus revealed that Pi5(t) is located in a $170-kb interval between the markers S04G03 and C1454. The markers 76B14f and 40N23r co-segregated with Pi5(t) (Fig. 3). Construction of a BIBAC contig spanning the Pi5(t) locus Nipponbare does not carry Pi5(t). Therefore we constructed a BIBAC library from RIL260 using the pBIGRZ vector (Tsunoda et al. 2000) to clone the region carrying Pi5(t). The library comprised approximately 93,000 clones with an average DNA insert size of 25 kb, corresponding to ve genome equivalents (data not shown). To identify positive clones from the library, we adapted a pooling system for a PCR-based procedure (see the Materials and methods for the details). This strategy is e cient for screening a large library with Fig. 3 Genetic and physical mapping of the Pi5(t) locus. Highresolution genetic map of the Pi5(t) locus ( top). The four populations used for this analysis are indicated on the left. The numbers in parentheses indicate the numbers of plants analyzed for recombination events at the Pi5(t) locus. The numbers of recombinants obtained are indicated between the relevant markers. The physical region containing the Pi5(t) resistance locus is shown by the double lines for each population. The black bar indicates the minimal genomic region carrying Pi5(t) delimited by this analysis of all four mapping populations. This region was physically covered by a contiguous set of RIL260 BIBAC clones (bottom). The asterisks indicate the positions of the BIBAC-end markers JJ80-T3, JJ81-T3 and JJ113-T3, which were used in the DNA gel-blot hybridization experiment shown in Fig. 5 286 small insert sizes. The alternative strategy of picking over 90,000 individual clones would have been much more time-consuming and laborious. To span the physical region containing Pi5(t), four markers, S04G03, C1454, 76B14f, and 40N23r, were initially used for the library screening, yielding the BIBACs JJ96, JJ93, JJ80, and JJ81, respectively (Fig. 3). We sequenced each end of the four isolated BIBAC clones and used this information to generate PCR products to screen the library again in order to extend the region. Using this approach we identi ed three more clones (JJ98, JJ106, and JJ115) in the region. We repeated this step and identi ed an additional three clones (JJ110, JJ113, and JJ120) from the region (Fig. 3). Some BIBAC-end sequences were homologous to transposable elements and therefore could not be used as probes for BIBAC library screening due to their repetitive nature. This was the case for the BIBAC-end sequences obtained from JJ106 and JJ120. To close the gap between JJ106 and JJ120, a subclone, JS624-T7, isolated from the Sau3AI shotgun library of JJ106, was utilized to nd the linking clone JJ123. In another case, a small region (183 bp) between JJ81 and JJ96 was ampli ed, cloned (JJ121), and its position con rmed by sequence analysis (data not shown). PCR analysis con rmed that both JJ113 and JJ120 are consecutively linked at the HindIII site used for cloning. All 12 clones could be arranged into a single contig spanning the 170-kb region between C1454 and S04G03 (Fig. 3). Fig. 4A, B DNA gel-blot analysis of the Moroberekan (M), CO39 (C), RIL260 (51), RIL249 (52), and C104PKT (3) genomes. Genomic DNAs were digested with six restriction enzymes, BamHI, BglII, DraI, HindIII, EcoRI and EcoRV. The Pi5(t) anking markers, 17I18-12 ( A) and 34E14-10 ( B) were used to probe for polymorphisms The Pi5(t) resistance locus in the RI lines does not correspond to the Moroberekan allele As noted above, all loci in the Pi5(t) genomic region di ered from their counterparts in Moroberekan, which had been assumed to be the donor of Pi5(t). It has been reported that PKT is susceptible to the rice blast strain PO6-6 (Mackill and Bonman 1992). These data further support our hypothesis that PKT is not the source of Pi3(t). It is not likely that the Pi5(t) resistance gene was created by a recombination event in the Moroberekan/CO39 cross because the identical non-parental alleles were observed in RIL125, RIL249, RIL260, and C104PKT, and many dominant sequences were missing in Moroberekan and PKT. To estimate the frequency of non-parental alleles in the whole population of RILs derived from the Moroberekan/CO39 cross, we analyzed 30 RILs from the 281 F7 recombinant inbred lines. CAPS analysis using the anking markers 17I18-12 and 34E14-10 revealed that three (RIL8, RIL14 and RIL27) of 30 lines tested contain the Pi5(t)-speci c non-parental allele (data not shown). DNA gel-blot analysis with the co-segregating marker 40N23r showed that the non-parental alleles in these three lines are identical to that of Pi5(t) (Fig. 5). Furthermore, in an inoculation experiment, RIL13 and RIL30, two of three lines containing Moroberekan alleles at the Pi5(t) locus showed a segregating phenotype upon inoculation with PO6-6 (Fig. 5), suggesting that the resistance to PO6-6 in the RI lines containing the Pi5(t)-speci c nonparental allele is not conferred by the Moroberekan allele. The Pi3(t) and Pi5(t) genomic regions are identical It has been proposed that Pi3(t) is allelic to Pi5(t), as both confer similar resistance spectra to a variety of blast lineages (Inukai et al. 1996). To determine if the genomic regions of Pi3(t) and Pi5(t) are indeed similar, DNA gel-blot analyses were carried out using the Pi5(t) anking RFLP markers 34E14-10 and 17I18-12. The hybridization patterns indicated that the region in C104PKT, the Pi3(t)-containing line, is identical to that in RIL260 and RIL249 harboring Pi5(t) (Fig. 4), but markedly di erent from those in Moroberekan the putative donor of Pi5(t) and CO39, the susceptible parent. Additional DNA gel-blot analyses with 2P10r, 76B14f, C1454, 40N23r, S04G03, and 47J03f indicated that C104PKT, RIL260 and RIL249 are all monomorphic for these markers (data not shown). This suggests that the lines containing the Pi3(t) and Pi5(t) loci share a common origin. In agreement with this hypothesis, the nucleotide sequences of the Pi5(t)-linked marker 40N23r from C104PKT and RIL260 were completely identical (data not shown). The sequence of the 40N23r region di ered signi cantly from that in the presumptive donors of resistance, PKT and Moroberekan. This further con rmed that the Pi3(t) and Pi5(t) regions are identical, and are not derived from PKT or Moroberekan. 287 Fig. 5 Genomic DNA gel-blot analysis of RI lines using the Pi5(t) marker 40N23r. Moroberekan (Mo), CO39, RIL260, and ten preselected RILs (see text for details) were surveyed for polymorphism at the Pi5(t) locus. The arrowhead indicates a hybridizing band not present in CO39 or Moroberekan. R and S signify resistance and susceptibility to M. grisea PO6-6, and R/S denotes a segregating phenotype. RIL9, RIL35 and RIL29 were not used for phenotype analysis Discussion We have developed an e cient method for positional cloning in rice using genetic resources that have been developed recently. In the present study, we utilized the genetic resources of Nipponbare, a line lacking Pi5(t), to develop markers required for saturation mapping of the Pi5(t) locus. First, an initial marker linked to Pi5(t) was mapped on the high-density genetic map of Nipponbare/Kasalath (Harushima et al. 1998). Secondly, Nipponbare BAC clones physically spanning the region were identi ed using the CUGI database. Third, additional genetic markers for saturation mapping were produced using subclones of the identi ed BACs. Fourth, a small interval of Nipponbare corresponding to Pi5(t) was delimited by determining recombination breakpoints. Finally, a physical map of the Pi5(t) genomic region was constructed using anking markers and a BIBAC library generated from a Pi5(t)-containing line. Our data indicate that the Pi5(t) genomic region in RIL260 is identical to the Pi3(t) genomic region in C104PKT. This region is markedly di erent from that in the putative parents, PKT and Moroberekan. Furthermore our data indicate that PKT and Moroberekan do not have a resistance allele at the Pi3(t)/Pi5(t) locus. It is not likely that Pi5(t) was generated through a genetic event such as a deletion, inversion, duplication, etc., because the same non-parental alleles exist in many of the RIL populations, with a frequency of about 10%, as well as in C104PKT carrying Pi3(t). Our data suggest that a rice cultivar carrying Pi3(t) was outcrossed to CO39 and then backcrossed to CO39 ve more times to produce C104PKT. It is possible that the same outcross was performed to generate the RI lines carrying Pi5(t), because the genomic region of interest in these three Pi5(t)-containing RI lines was identical to that in C104PKT for all markers tested. It is also possible that C104PKT contaminated the cross between Moroberekan and CO39, and that C104PKT carrying Pi3(t) is the donor for the three Pi5(t) RILs. The present study demonstrates the usefulness of genetic markers for discovering the source of a particular resistance gene. We were not able to identify recombination events in the 170-kb interval encompassing Pi5(t) among over 2000 individuals from four di erent mapping populations. In the RIL260/M202 population, the marker C1454 mapped 0.06 cM away from Pi5(t) (1 recombination/1742 meiotic events) and the other anking marker, S04G03, mapped 0.11 cM away from Pi5(t) (2/1742), giving a ratio of over 1000 kb/cM. This is much higher than the average physical/genetic ratio of 260 280 kb/cM estimated for the rice genome as a whole (Wu and Tanksley 1993). This result could be due to lack of pairing and subsequent strand exchange between homologous regions in the RIL260 and M202 parents used for the cross. This is supported by the fact that many of the RIL260 BIBAC-end sequences were not present in M202. Suppression of recombination has been observed in other introgressed regions associated with disease resistance, such as the Mi (van Daelen et al. 1993), Mla (Wei et al. 1999), and Pita 2 (Nakamura et al. 1997) loci. Thus, the Pi5(t) locus is highly diverged in disease-resistant and susceptible genotypes. Over the past decade, a number of dominant R genes have been characterized from diverse plant species and their encoded proteins can be grouped into six classes based on structure (Wang et al. 1998; Dangl and Jones 2001). The largest class of R genes encodes an NBSLRR class of proteins that can be further divided into two groups based on their N terminal domains. Sixty percent of the Arabidopsis NBS-LRR proteins carry a domain with homology to the intracellular signaling domains of the Drosophila Toll and mammalian interleukin (IL)-1 receptors (TIR-NBS-LRR), whereas 40% contain putative coiled-coil domains (CC-NBS-LRR) (Dangl and Jones 2001). Over 100 R gene sequences of the TIR-NBS-LRR class exist in the Arabidopsis genome, but this subclass has not yet been found in cereals and is not present in available rice sequences (Meyers et al. 1999). To date, ve rice R genes have been cloned, including the blast resistance genes Pib and Pita encoding CC-NBS-LRR proteins and the bacterial blight R genes Xa1, Xa21 and Xa21D which encode a CCNBS-LRR, a receptor kinase and receptor-like protein, respectively (Song et al. 1995; Wang et al. 1999; Yoshimura et al. 1998; Bryan et al. 2000). We analyzed $150 BAC end sequences of Nipponbare corresponding to approximately 70 kb in the Pi5(t) locus (Chen et al. 2002). Through similarity searches against sequence data in public databases, we found that the amino acid sequences deduced from two genes in the region show similarity to the conserved NBand/or LRR motifs. BIBAC end sequence analysis of RIL260 identi ed a third NBS-LRR sequence. These 288 data indicate that the Pi3(t)/Pi5(t) locus contains a cluster of NBS-LRR sequences. These three genes are good candidates for Pi3(t)/Pi5(t) and may constitute part of a natural pyramid of resistance genes that confer the broad-spectrum resistance. To test this hypothesis, all the isolated BIBAC clones of RIL260 are currently being used in transgenic complementation studies to identify the Pi3(t)/Pi5(t) coding region(s). These plants will be inoculated with diverse isolates to determine whether a single gene or multiple genes are required for the Pi3(t)/Pi5(t) broad-spectrum resistance. Acknowledgements We thank Deling Ruan, Patrik Canlas, Jin Fang and Erik Pogmore for technical assistance in the preparation of genomic DNAs. Masahiro Yano is specially acknowledged for mapping S04G03 on the Nipponbare/Kasalath genetic map. We are thankful to Matt Campbell, Kangle Zheng, Tsuyoshi Inukai, Kenong Xu, and Dave Mackill for helpful discussions. RFLP markers used in the study were kindly provided by Susan McCouch and Takuji Sasaki. We also thank Sally Leong and Gernot Presting for helpful comments on the use of the Nipponbare BAC clones, Rod Wing for providing Nipponabre BAC lters and clones, Hei Leung for providing RI lines, Shinji Kawasaki for providing the pBIGRZ vector, Dave Mackill for providing DNA lters of the Black Gora/Labell mapping population, and Harold Bockelman for providing C104PKT and Pia-Kan-Tao. We thank Todd Richter and Matt Campbell for critical reading of the manuscript. J.-S. Jeon was in part supported by the Korean Science and Engineering Foundation (KOSEF) and the Plant Metabolism Research Center (PMRC), Kyung Hee University, Korea. This project was supported by a United States of Department of Agriculture grant to P.C. Ronald. References Ahn SW (1994) International collaboration on breeding for resistance to rice blast. In: Zeigler RS, Leong SA, Teng PS (eds) Rice blast disease. CAB International, Wallingford, UK, pp 137 153 Ahn SW (2000) Spatial and temporal stability of genetic resistance to rice blast. In: Tharreau D, Lebrun MH, Talbot NJ, Nottenghem JL (eds) Advances in rice blast research. Kluwer, Dordrecht, pp 162 171 Bidaux JM (1978) Screening for horizontal resistance to rice blast (Pyricularia oryzae). In: Buddenhagen IW, Persley GJ (eds) Rice in Africa. Academic Press, London, pp 159 174 Bonman JM, Mackill DJ (1988) Durable resistance to rice blast. Oryza 25:103 110 Bonman JM, Vergel De Dios TI, Khin MM (1986) Physiological specialization of Pyricularia oryzae in the Philippines. Plant Dis 70:767 769 Bryan GT, Wu K-S, Farrall L, Jia Y, Hershey HP, McAdams SA, Faulk KN, Donaldson GK, Tarchini R, Valent B (2000) A single amino acid di erence distinguishes resistant and susceptible alleles of the rice blast resistance gene Pita. Plant Cell 12:2033 2045 Chen D-H, Ronald PC (1999) A rapid DNA minipreparation method suitable for AFLP and other PCR applications. Plant Mol Biol Rep 17:53 57 Chen D-H, Zeigler RS, Leung H, Nelson RJ (1995) Population structure of Pyricularia grisea at two screening sites in the Philippines. Phytopathology 85:1011 1020 Chen D-H, Zeigler RS, Ahn SW, Nelson RJ (1996) Phenotypic characterization of the rice blast resistance gene Pi2(t). Plant Dis 80:52 56 Chen D-H, dela Vina M, Inukai T, Mackill DJ, Ronald PC, Nelson RJ (1999) Molecular mapping of the rice blast resistance gene, Pi44(t), in a line derived from a durably resistant rice cultivar. Theor Appl Genet 98:1046 1053 Chen D-H, Nelson RJ, Wang G-L, Mackill DJ, Ronald PC (2000) Use of DNA markers in introgression and isolation of genes associated with durable resistance to rice blast. In: Tharreau D, Lebrun MH, Talbot NJ, Notteghem JL (eds) Advances in rice blast research. Kluwer, Dordrecht, pp 17 27 Chen M, et al (2002) An integrated physical and genetic map of the rice genome. Plant Cell 14:537 545 Dangl JL, Jones JD (2001) Plant pathogens and integrated defense responses to infection. Nature 411:826 833 Fomba SN, Taylor DR (1994) Rice blast in West Africa: its nature and control. In: Zeigler RS, Leong SA, Teng PS (eds) Rice blast disease. CAB International and IRRI, Wallingford, UK, pp 343 355 Harushima Y, et al (1998) A high-density rice genetic linkage map with 2275 markers using a single F2 population. Genetics 148:479 494 Inukai T, Nelson RJ, Zeigler RS, Sarkarung S, Mackill DJ, Bonman JM, Takamure I, Kinoshita T (1994) Allelism of blast resistance genes in near-isogenic lines of rice. Phytopathology 84:1278 1283 Inukai T, Zeigler RS, Sarkarung S, Bronson M, Dung LV, Kinoshita T, Nelson RJ (1996) Development of pre-isogenic lines for rice blast-resistance by marker-aided selection from a recombinant inbred population. Theor Appl Genet 93:560 567 Johnson R (1981) Durable resistance: de nition of, genetic control, and attainment in plant breeding. Phytopathology 71:567 568 Kosambi DD (1944) The estimation of map distance from recombination values. Ann Eugen 12:172 175 Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln SE, Newberg L (1987) MAPMAKER: an interactive computer program for constructing primary genetic maps of experimental and natural populations. Genomics 1:174 181 Lee EJ, Cho SY (1990) Variation in races of rice blast disease and varietal resistance in Korea. In: Papers presented at the Focus on Irrigated Rice. Seoul, Korea, pp 27 31 Lee EJ, Zhang Q, Mew TW (1989) Durable resistance to rice disease in irrigated environments. In: Progress in irrigated rice research. International Rice Research Institute, Manila, Philippines, pp 93 110 Mackill DJ, Bonman JM (1992) Inheritance of blast resistance in near-isogenic lines of rice. Phytopathology 82:746 749 Mao L, Wood TC, Yu YS, Budiman MA, Tomkins MA, Woo SS, Sasinowski M, Presting G, Frisch D, Go S, Dean RA, Wing RA (2000) Rice transposable elements: a survey of 73,000 sequence-tagged-connectors. Genome Res 10:982 990 McCouch SR, Kochert G, Yu ZH, Wang ZY, Khush GS, Co man WR, Tanksley SD (1988) Molecular mapping of rice chromosomes. Theor Appl Genet 76:815 829 Meyers BC, Dickerman AW, Michelmore RW, Sivaramakrishnan S, Sobral BW, Young ND (1999) Plant disease resistance genes encode members of an ancient and diverse protein family within the nucleotide-binding superfamily. Plant J 20:317 332 Michelmore RW, Paran I, Kesseli RV (1991) Identi cation of markers linked to disease resistance genes by bulked segregant analysis: a rapid method to detect markers in speci c genomic regions by using segregating populations. Proc Natl Acad Sci USA 88:9828 9832 Mo at AS (1994) Mapping the sequence of disease resistance. Science 265:1804 1805 Monna L, Miyao A, Zhong HS, Yano M, Iwamoto M, Umehara Y, Kurata N, Hayasaka H, Sasaki T (1997) Saturation mapping with subclones of YACs: DNA marker production targeting the rice blast disease resistance gene, Pib. Theor Appl Genet 94:170 176 Murray MG, Thompson WF (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8:4321 4325 289 Nakamura S, Asakawa S, Ohmido N, Fukui K, Shimizu N, Kawasaki S (1997) Construction of an 800-kb contig in the near-centromeric region of the rice blast resistance gene Pi-ta2 using a highly representative rice BAC library. Mol Gen Genet 254:611 620 Ou SH (1979) Breeding rice for resistance to blast, a critical view. In: Proceedings of the Rice Blast Workshop. International Rice Research Institute, Manila, Philippines, pp 79 137 Peterson DG, Tomkins JP, Frisch DA, Wing RA, Paterson AH (2000) Construction of plant bacterial arti cial chromosome (BAC) libraries: an illustrated guide. J Agric Genomics 5 www.ncgr.org/research/jag Redona ED, Mackill DJ (1996) Mapping quantitative trait loci for seedling vigor in rice using RFLPs. Theor Appl Genet 92:395 402 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual (2nd edn). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Song WY, Wang G-L, Chen L, Zhai W, Kim HK, Holsten T, Zhu L, Ronald PC (1995) The rice disease resistance gene, Xa21, encodes a receptor-like protein kinase. Science 270:1804 1806 Tsunoda Y, Jwa N-S, Akiyama K, Nakamura S, Motomura T, Kamihara K, Kodama O, Kawasaki S (2000) Cloning of the rice blast resistance gene PI-B. In: Tharreau D, Lebrun MH, Talbot NJ, Notteghem JL (eds) Advances in rice blast research. Kluwer, Dordrecht, pp 9 16 Van Daelen RA, Gerbens JJF, van Rusissen F, Aarts J, Honteleez J, Zabel P (1993) Long-range physical maps of two loci (Aps1and GP79) anking the root-knot nematode resistance gene (Mi) near the centromere of tomato chromosome 6. Plant Mol Biol 23:185 192 Wang G-L, Mackill DJ, Bonman JM, McCouch SR, Champoux MC, Nelson RJ (1994) RFLP mapping of genes conferring complete and partial resistance to blast in a durably resistance rice cultivar. Genetics 136:421 1434 Wang G-L, Holsten TE, Song W-Y, Wang H-P, Ronald PC (1995) Construction of a rice bacterial arti cial chromosome library and identi cation of clones linked to the Xa-21 disease resistance locus. Plant J 7:525 533 Wang G-L, Ruan DL, Song WY, Sideris S, Chen L, Pi LY, Zhang S, Zhang Z, Fauquet C, Gaut BS, Whalen MC, Ronald PC (1998) Xa21D encodes a receptor-like molecule with a leucinerich repeat domain that determines race-speci c recognition and is subject to adaptive evolution. Plant Cell 10:765 779 Wang Z-X, Yano M, Yamanouchi U, Iwamoto M, Monna L, Hayasaka H, Katayose Y, Sasaki T (1999) The Pib gene for rice blast resistance belongs to the nucleotide binding and leucine-rich repeat class of plant disease resistance genes. Plant J 19:55 64 Wei F, Gobelman-Werner K, Morroll SM, Kurth J, Mao L, Wing R, Leister D, Schulze-Lefert P, Wise RP (1999) The Mla (powdery mildew) resistance cluster is associated with three NBS-LRR gene families and suppressed recombination within a 240-kb DNA interval on chromosome 5S (1HS) of barley. Genetics 153:1929 1948 Wu J, et al (2002) A comprehensive rice transcript map containing 6591 expressed sequence tag sites. Plant Cell 14:525 535 Wu KS, Tanksley SD (1993) PFGE analysis of the rice genome: estimation of the fragment sizes, organization of the repetitive sequences and relationship between genetic and physical distances. Plant Mol Biol 23:243 254 Yoshimura S, Yamanouchi U, Katayose Y, Toki S, Wang ZX, Kono I, Kurata N, Yano M, Iwata N, Sasaki T (1998) Expression of Xa1, a bacterial blight-resistance gene in rice, is induced by bacterial inoculation. Proc Natl Acad Sci USA 95:1663 1668 Yu ZH, Mackill DJ, Bonman JM (1987) Inheritance of resistance to blast in some traditional and improved rice cultivars. Phytopathology 77:323 326 Yuan Q, Liang F, Hsiao J, Zismann V, Benito MI, Quackenbush J, Wing R, Buell R (2000) Anchoring of rice BAC clones to the rice genetic map in silico. Nucleic Acids Res 28:3636 3641 Zeigler RS, Cuoc LX, Scott RP, Bernardo MA, Chen D-H, Valent B, Nelson RJ (1995) The relationship between lineage and virulence in Pyricularia grisea in the Philippines. Phytopathology 85:443 451

Find millions of documents here - Study Guides, Homework Solutions, Papers, Exam Answer Keys and more. Course Hero has millions of course related materials that will enable you to learn better, faster and get an A in all your courses.
Below is a small sample set of documents: