Course Hero - We put you ahead of the curve!
You have requested the below document.
Sign up now to view this document for free!
- Title: larson51
- Type: Notes
- School: UCSD
- Course: RFIC 51
- Term: Fall
Coursehero >> California >> UCSD >> RFIC 51
Path: UCSD >> RFIC >> 43 Fall, 2008
Path: UCSD >> RFIC >> 34 Fall, 2008
Path: UCSD >> RFIC >> 39 Fall, 2008
Path: UCSD >> RFIC >> 40 Fall, 2008
Path: UCSD >> RFIC >> 41 Fall, 2008
Path: UCSD >> RFIC >> 42 Fall, 2008
Path: UCSD >> RFIC >> 38 Fall, 2008
Path: UCSD >> RFIC >> 37 Fall, 2008
Path: UCSD >> RFIC >> 19 Fall, 2008
Path: UCSD >> RFIC >> 20 Fall, 2008
Path: UCSD >> RFIC >> 16 Fall, 2008
Path: UCSD >> RFIC >> 17 Fall, 2008
Path: UCSD >> RFIC >> 5 Fall, 2008
Path: UCSD >> RFIC >> 1 Fall, 2008
Path: UCSD >> RFIC >> 2 Fall, 2008
Path: UCSD >> RFIC >> 23 Fall, 2008
Path: UCSD >> RFIC >> 22 Fall, 2008
Path: UCSD >> RFIC >> 18 Fall, 2008
Path: UCSD >> RFIC >> 21 Fall, 2008
Path: UCSD >> RFIC >> 6 Fall, 2008
Path: UCSD >> RFIC >> 7 Fall, 2008
Path: UCSD >> RFIC >> 8 Fall, 2008
Path: UCSD >> RFIC >> 9 Fall, 2008
Path: UCSD >> RFIC >> 12 Fall, 2008
Path: UCSD >> RFIC >> 14 Fall, 2008
Path: UCSD >> RFIC >> 3 Fall, 2008
Path: UCSD >> RFIC >> 13 Fall, 2008
Path: UCSD >> RFIC >> 10 Fall, 2008
Path: UCSD >> RFIC >> 11 Fall, 2008
Path: UCSD >> RFIC >> 4 Fall, 2008
Path: UCSD >> RFIC >> 15 Fall, 2008
Path: UCSD >> RFIC >> 36 Fall, 2008
Path: UCSD >> RFIC >> 35 Fall, 2008
Path: UCSD >> PRINT >> 9 Fall, 2008
Path: UCSD >> CS >> 07 Fall, 2008
Path: UCSD >> CS >> 06 Fall, 2008
Path: UCSD >> CS >> 06 Fall, 2008
Path: UCSD >> CS >> 06 Fall, 2008
Path: UCSD >> CS >> 05 Fall, 2008
Path: UCSD >> CS >> 05 Fall, 2008
Path: UCSD >> CS >> 04 Fall, 2008
Path: UCSD >> CS >> 04 Fall, 2008
Path: UCSD >> CS >> 03 Fall, 2008
Path: UCSD >> CS >> 03 Fall, 2008
Path: UCSD >> SUPPLEMENT >> 01 Fall, 2008
Path: UCSD >> D >> 1 Fall, 2008
Path: UCSD >> D >> 1 Fall, 2008
Path: UCSD >> PCDNA >> 3 Fall, 2008
Path: UCSD >> PCDNA >> 3 Fall, 2008
Path: UCSD >> PCDNA >> 3 Fall, 2008
Path: UCSD >> PCDNA >> 3 Fall, 2008
Path: UCSD >> APP >> 2007 Fall, 2008
Path: UCSD >> WEB >> 200809 Fall, 2008
Path: UCSD >> CVRR >> 06 Fall, 2006
Path: UCSD >> CVRR >> 06 Fall, 2006
Path: UCSD >> CVRR >> 05 Fall, 2004
Path: UCSD >> CVRR >> 05 Fall, 2004
Path: UCSD >> CVRR >> 05 Fall, 2004
Path: UCSD >> CVRR >> 04 Fall, 2004
Path: UCSD >> CVRR >> 2004 Fall, 2004
Path: UCSD >> CVRR >> 2004 Fall, 2004
Path: UCSD >> CVRR >> 2004 Fall, 2004
Path: UCSD >> ICPR >> 04 Fall, 2004
Path: UCSD >> ICPR >> 2004 Fall, 2004
Path: UCSD >> ICPR >> 2004 Fall, 2004
Path: UCSD >> CVRR >> 2004 Fall, 2004
Path: UCSD >> CVRR >> 2004 Fall, 2004
Path: UCSD >> CVRR >> 04 Fall, 2004
Path: UCSD >> CVRR >> 2003 Fall, 2003
Course Hero has millions of student submitted documents similar to the one below including study guides, homework solutions, papers, and exam answer keys.
Find millions of documents here - Study Guides, Homework Solutions, Papers, Exam Answer Keys and more.
Course Hero has millions of course related materials that will enable you to learn better, faster and get an A in all your courses.
Below is a small sample set of documents:
larson29.pdf
Path: UCSD >> RFIC >> 29 Fall, 2008
Description: ...
larson43.pdfPath: UCSD >> RFIC >> 43 Fall, 2008
Description: SYNERGISTIC DESIGN OF DSP AND POWER AMPLIFIERS FOR WIRELESS COMMUNICATIONS P.M.ASBECK AND L.E.LARSON Electrical and Computer Engineering Department University of California, San Diego La Jolla, CA, USA 92093-0407 E-mail: asbeck@ece.ucsd.edu Co-desig...
larson34.pdfPath: UCSD >> RFIC >> 34 Fall, 2008
Description: IEEE TRANSACTIONS ON ELECTRON DEVICES, VOL. 47, NO. 11, NOVEMBER 2000 2037 Noise Modeling and SiGe Profile Design Tradeoffs for RF Applications Guofu Niu, Member, IEEE, Shiming Zhang, Student Member, IEEE, John D. Cressler, Senior Member, IEEE, Alv...
larson39.pdfPath: UCSD >> RFIC >> 39 Fall, 2008
Description: IEEE JOURNAL OF SOLID-STATE CIRCUITS, VOL. 35, NO. 9, SEPTEMBER 2000 1329 A Wide-Bandwidth Si/SiGe HBT Direct Conversion Sub-Harmonic Mixer/Downconverter Liwei Sheng, Jonathan C. Jensen, Student Member, IEEE, and Lawrence E. Larson, Fellow, IEEE Ab...
larson40.pdfPath: UCSD >> RFIC >> 40 Fall, 2008
Description: ...
larson41.pdfPath: UCSD >> RFIC >> 41 Fall, 2008
Description: ...
larson42.pdfPath: UCSD >> RFIC >> 42 Fall, 2008
Description: 1986 IEEE TRANSACTIONS ON VEHICULAR TECHNOLOGY, VOL. 49, NO. 5, SEPTEMBER 2000 Gain and Phase Error-Free LINC Transmitter Xuejun Zhang and Lawrence E. Larson, Fellow, IEEE AbstractThis paper presents a new correction technique for linear amplificat...
larson38.pdfPath: UCSD >> RFIC >> 38 Fall, 2008
Description: ...
larson37.pdfPath: UCSD >> RFIC >> 37 Fall, 2008
Description: ...
larson19.pdfPath: UCSD >> RFIC >> 19 Fall, 2008
Description: ...
larson20.pdfPath: UCSD >> RFIC >> 20 Fall, 2008
Description: ...
larson16.pdfPath: UCSD >> RFIC >> 16 Fall, 2008
Description: ...
larson17.pdfPath: UCSD >> RFIC >> 17 Fall, 2008
Description: ...
larson5.pdfPath: UCSD >> RFIC >> 5 Fall, 2008
Description: IEEE JOURNAL OF SOLID-STATE CIRCUITS, VOL. 34, NO. 9, SEPTEMBER 1999 1331 Bipolar Transistor Epilayer Design Using the MAIDS Mixed-Level Simulator Leo C. N. de Vreede, Henk C. de Graaff, Joost A. Willemen, Wibo van Noort, Rik Jos, Lawrence E. Larso...
larson1.pdfPath: UCSD >> RFIC >> 1 Fall, 2008
Description: IEEE TRANSACTIONS ON MICROWAVE THEORY AND TECHNIQUES, VOL. 47, NO. 8, AUGUST 1999 1467 A Power Re-Use Technique for Improved Efciency of Outphasing Microwave Power Ampliers Robert Langridge, Member, IEEE, Todd Thornton, Peter M. Asbeck, Senior Memb...
larson2.pdfPath: UCSD >> RFIC >> 2 Fall, 2008
Description: IEEE TRANSACTIONS ON MICROWAVE THEORY AND TECHNIQUES, VOL. 47, NO. 8, AUGUST 1999 1471 High-Efciency Power Amplier Using Dynamic Power-Supply Voltage for CDMA Applications Gary Hanington, Student Member, IEEE, Pin-Fan Chen, Student Member, IEEE, Pe...
larson23.pdfPath: UCSD >> RFIC >> 23 Fall, 2008
Description: ...
larson22.pdfPath: UCSD >> RFIC >> 22 Fall, 2008
Description: ...
larson18.pdfPath: UCSD >> RFIC >> 18 Fall, 2008
Description: ...
larson21.pdfPath: UCSD >> RFIC >> 21 Fall, 2008
Description: ...
larson6.pdfPath: UCSD >> RFIC >> 6 Fall, 2008
Description: ...
larson7.pdfPath: UCSD >> RFIC >> 7 Fall, 2008
Description: ...
larson8.pdfPath: UCSD >> RFIC >> 8 Fall, 2008
Description: ...
larson9.pdfPath: UCSD >> RFIC >> 9 Fall, 2008
Description: ...
larson12.pdfPath: UCSD >> RFIC >> 12 Fall, 2008
Description: ...
larson14.pdfPath: UCSD >> RFIC >> 14 Fall, 2008
Description: ...
larson3.pdfPath: UCSD >> RFIC >> 3 Fall, 2008
Description: ...
larson13.pdfPath: UCSD >> RFIC >> 13 Fall, 2008
Description: ...
larson10.pdfPath: UCSD >> RFIC >> 10 Fall, 2008
Description: IEEE JOURNAL OF SOLID-STATE CIRCUITS, VOL. 33, NO. 3, MARCH 1998 387 Integrated Circuit Technology Options for RFICsPresent Status and Future Directions Lawrence E. Larson, Senior Member, IEEE AbstractThis paper will summarize the technology tradeo...
larson11.pdfPath: UCSD >> RFIC >> 11 Fall, 2008
Description: ...
larson4.pdfPath: UCSD >> RFIC >> 4 Fall, 2008
Description: IEEE MICROWAVE AND GUIDED WAVE LETTERS, VOL. 8, NO. 3, MARCH 1998 121 Linear High-Efciency Microwave Power Ampliers Using Bandpass Delta-Sigma Modulators Arun Jayaraman, P. F. Chen, G. Hanington, L. Larson, and P. Asbeck Abstract A novel amplier co...
larson15.pdfPath: UCSD >> RFIC >> 15 Fall, 2008
Description: ...
larson36.pdfPath: UCSD >> RFIC >> 36 Fall, 2008
Description: ...
larson35.pdfPath: UCSD >> RFIC >> 35 Fall, 2008
Description: ...
UCSDGIGP9.pdfPath: UCSD >> PRINT >> 9 Fall, 2008
Description: University of California, San Diego Graphic Identity Guidelines and Policies WEB IDENTITY 9 University of California, San Diego Graphic Elements WEB IDENTITY WEB IDENTITY GUIDELINES UCSD communicates its image to audiences in a myriad of ways. O...
DATE07.pdfPath: UCSD >> CS >> 07 Fall, 2008
Description: Logic Level Fault Tolerance Approaches Targeting Nanoelectronics PLAs UC San Diego CSE Department Wenjing Rao wrao@cs.ucsd.edu ABSTRACT alex@cs.ucsd.edu UC San Diego CSE Department Alex Orailoglu Polytechnic University ECE Department Ramesh Ka...
DAC06.pdfPath: UCSD >> CS >> 06 Fall, 2008
Description: Topology Aware Mapping of Logic Functions onto Nanowire-based Crossbar Architectures wrao@cs.ucsd.edu ABSTRACT UC San Diego CSE Department Wenjing Rao alex@cs.ucsd.edu UC San Diego CSE Department Alex Orailoglu Polytechnic University ECE Depa...
ETS06.pdfPath: UCSD >> CS >> 06 Fall, 2008
Description: Fault Identication in Recongurable Carry Lookahead Adders Targeting Nanoelectronic Fabrics UC San Diego CSE Department Wenjing Rao UC San Diego CSE Department Alex Orailoglu Polytechnic Univ ECE Department Ramesh Karri wrao@cs.ucsd.edu alex@cs...
VTS06.pdfPath: UCSD >> CS >> 06 Fall, 2008
Description: Nanofabric Topologies and Reconguration Algorithms to Support Dynamically Adaptive Fault Tolerance UC San Diego CSE Department Wenjing Rao UC San Diego CSE Department Alex Orailoglu Polytechnic University ECE Department Ramesh Karri wrao@cs.ucs...
ICCD05.pdfPath: UCSD >> CS >> 05 Fall, 2008
Description: Architectural-Level Fault Tolerant Computation in Nanoelectronic Processors UC San Diego CSE Department Wenjing Rao UC San Diego CSE Department Alex Orailoglu Polytechnic University ECE Department Ramesh Karri wrao@cs.ucsd.edu alex@cs.ucsd.edu...
ASPDAC05.pdfPath: UCSD >> CS >> 05 Fall, 2008
Description: UC San Diego CSE Department Wenjing Rao UC San Diego CSE Department Alex Orailoglu Polytechnic University ECE Department Ramesh Karri wrao@cs.ucsd.edu alex@cs.ucsd.edu ramesh@india.poly.edu ABSTRACT In this paper we propose a fault-tolerant ...
ICCAD04.pdfPath: UCSD >> CS >> 04 Fall, 2008
Description: Frugal Linear Network-Based Test Decompression for Drastic Test Cost Reductions Wenjing Rao, Alex Orailoglu, and George Su Computer Science & Engineering Department University of California, San Diego wrao@cs.ucsd.edu alex@cs.ucsd.edu gpsu@ucsd.edu A...
ITC04.pdfPath: UCSD >> CS >> 04 Fall, 2008
Description: Fault Tolerant Arithmetic with Applications in Nanotechnology based Systems Wenjing Rao UC San Diego CSE Department Alex Orailoglu UC San Diego CSE Department Ramesh Karri Polytechnic University ECE Department wrao@cs.ucsd.edu alex@cs.ucsd.edu r...
DAC03.pdfPath: UCSD >> CS >> 03 Fall, 2008
Description: Test Application Time and Volume Compression through Seed Overlapping UC San Diego CSE Department Wenjing Rao wrao@cs.ucsd.edu ABSTRACT We propose in this paper an extension on the Scan Chain Concealment technique to further reduce test time and v...
DATE03.pdfPath: UCSD >> CS >> 03 Fall, 2008
Description: Virtual Compression through Test Vector Stitching for Scan Based Designs Wenjing Rao CSE Department University of California, San Diego La Jolla, CA 92093 wrao@cs.ucsd.edu ABSTRACT We propose a technique for compressing test vectors. The technique re...
Supplement01.docPath: UCSD >> SUPPLEMENT >> 01 Fall, 2008
Description: Fig. 7. Contour plots of the highest occupied and lowest unoccupied molecular orbitals (HOMO and LUMO, respectively), of the optimized 6-31+G(d,p) molecular geometry. The plots were generated by using the program 3D-PLTORB, and depicted using QMVIEW,...
D1ER in pcDNA3 plasmid map.pdfPath: UCSD >> D >> 1 Fall, 2008
Description: HindIII NotI SphI SacI Calreticulin signal sequence EcoRI AAGCTTGCGGCCGCCACatgctgctgcccgtccccctgctgctgggcctgctgggcgccgccgccgac ECFP(D11) D1 citrine TAAGAATTC Hind III Kpn I BamH I BstX I EcoR I EcoR V BstX I Not I Xho I Xba I* Apa I* T7 NdeI Nr...
D1ER (in pcDNA3) sequence.pdfPath: UCSD >> D >> 1 Fall, 2008
Description: aagcttgcggccgccacatgctgctgcccgtccccctgctgctgggcctgctgggcgccgccgccgacgtgagcaagggcg aggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaggttcagcgtgtccggcga gggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccacc ct...
pcDNA3-mOrange2 sequence.txtPath: UCSD >> PCDNA >> 3 Fall, 2008
Description: GACGGATCGGGAGATCTCCCGATCCCCTATGGTCGACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCT GCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAAT TGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTAT T...
pcDNA3-mOrange2 features.pdfPath: UCSD >> PCDNA >> 3 Fall, 2008
Description: BglII (12) MfeI (161) Bpu10I (180) 1 GACGGATCGGGAGATCTCCCGATCCCCTATGGTCGACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCG CTGCCTAGCCCT...
pcDNA3-TagRFP-T sequence.txtPath: UCSD >> PCDNA >> 3 Fall, 2008
Description: GACGGATCGGGAGATCTCCCGATCCCCTATGGTCGACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCT GCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAAT TGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTAT T...
pcDNA3-TagRFP-T features.pdfPath: UCSD >> PCDNA >> 3 Fall, 2008
Description: BglII (12) MfeI (161) Bpu10I (180) 1 GACGGATCGGGAGATCTCCCGATCCCCTATGGTCGACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCG CTGCCTAGCCCT...
app2007.pdfPath: UCSD >> APP >> 2007 Fall, 2008
Description: DivisionofPulmonaryandCriticalCareMedicine FellowshipProgram Applicationprocessforthisprogramwillbehandledthrough ERAS. ApplicationswillbegintobeacceptedinDecemberforthisprogramandinterviews arescheduledtobeginin February,2007. TheProgramrecognizesth...
web200809-MGRFlyer.pdfPath: UCSD >> WEB >> 200809 Fall, 2008
Description: 9/3/2008 TheKidneyinHypertension:GuytonRedux TomCoffman,MD JamesR.ClappProfessorofMedicine ProfessorofCellBiologyandImmunology Chief,DivisionofNephrology DukeUniversity PresidentElect,AmericanSocietyofNephrology ChristianMendeM.D.FellowshipLecturerin...
Park06_Springer.pdfPath: UCSD >> CVRR >> 06 Fall, 2006
Description: Tracking of Individuals in Very Long Video Sequences P. Fihl1 , R. Corlin1 , S. Park2 , T.B. Moeslund1, and M.M. Trivedi2 1 Laboratory of Computer Vision and Media Technology Aalborg University, Denmark pfa@cvmt.dk, tbm@cvmt.dk 2 Computer Vision and...
PervComp06_028-037 (final).pdfPath: UCSD >> CVRR >> 06 Fall, 2006
Description: MOBILE AND UBIQUITOUS SYSTEMS www.computer.org/pervasive Turn-Intent Analysis Using Body Pose for Intelligent Driver Assistance Shinko Yuanhsien Cheng and Mohan Manubhai Trivedi Vol. 5, No. 4 OctoberDecember 2006 This material is presented to ens...
JWuICCV05_HeadPoseEst_CamReady.pdfPath: UCSD >> CVRR >> 05 Fall, 2004
Description: International Workshop on Analysis and Modeling of Faces and Gestures, October 2005 An Integrated Two-stage Framework for Robust Head Pose Estimation Junwen Wu and Mohan M. Trivedi Computer Vision and Robotics Research Laboratory University of Calif...
JWuICCV05_FacialLandmark_CamReady.pdfPath: UCSD >> CVRR >> 05 Fall, 2004
Description: International Workshop on Analysis and Modeling of Faces and Gestures, October 2005 Robust Facial Landmark Detection for Intelligent Vehicle System Junwen Wu and Mohan M. Trivedi Computer Vision and Robotics Research Laboratory University of Califor...
TransSMC05_Trivedi.pdfPath: UCSD >> CVRR >> 05 Fall, 2004
Description: IEEE TRANSACTIONS ON SYSTEMS, MAN, AND CYBERNETICSPART A: SYSTEMS AND HUMANS, VOL. 35, NO. 1, JANUARY 2005 145 Dynamic Context Capture and Distributed Video Arrays for Intelligent Spaces Mohan Manubhai Trivedi, Senior Member, IEEE, Kohsia Samuel Hu...
MVA04_Gandhi_EgoMotion.pdfPath: UCSD >> CVRR >> 04 Fall, 2004
Description: Machine Vision and Applications, Accepted for publication, November 2004 Parametric Ego-Motion Estimation for Vehicle Surround Analysis Using Omni-Directional Camera Tarak Gandhi and Mohan Trivedi Computer Vision and Robotics Research Laboratory Uni...
ITSC2004-CVRR-HCI.pdfPath: UCSD >> CVRR >> 2004 Fall, 2004
Description: 7th IEEE Conference on Intelligent Transportation Systems, Oct. 2004 (to appear) A Collaborative Approach for Human-Centered Driver Assistance Systems Joel C. McCall, Ofer Achler, Mohan M. Trivedi Computer Vision and Robotics Research Laboratory Jea...
ITSC2004_Krotosky.pdfPath: UCSD >> CVRR >> 2004 Fall, 2004
Description: Submitted to IEEE Conference on Intelligent Transportation Systems on April 1, 2004 Face Detection and Head Tracking using Stereo and Thermal Infrared Cameras for Smart Airbags: A Comparative Analysis Stephen J. Krotosky, Shinko Y. Cheng, Student Me...
ITSC2004_RChang_TGandhi_MMTrivedi.pdfPath: UCSD >> CVRR >> 2004 Fall, 2004
Description: IEEE International Transportation Systems Conference, October 2004 Computer Vision for Multi-Sensory Structural Health Monitoring System* Remy Chang, Tarak Gandhi, and Mohan M. Trivedi Computer Vision and Robotics Research Laboratory University of C...
ICPR04_Huang_Title.pdfPath: UCSD >> ICPR >> 04 Fall, 2004
Description: Accepted for publication in the 17th International Conference on Pattern Recognition (ICPR 2004) Cambridge, United Kingdom, Aug. 23-26, 2004 Robust Real-Time Detection, Tracking, and Pose Estimation of Faces in Video Streams Kohsia S. Huang and Moha...
ICPR2004_Junwen_Video.pdfPath: UCSD >> ICPR >> 2004 Fall, 2004
Description: To appear Int. Conference on Pattern Recognition, Cambridge, UK, August 2004. High Frequency Component Compensation based Super-resolution Algorithm for Face Video Enhancement Abstract This paper proposes a video-based super-resolution algorithm by...
ICPR2004_Junwen_AdaBoost.pdfPath: UCSD >> ICPR >> 2004 Fall, 2004
Description: To appear Int. Conference on Pattern Recognition, Cambridge, UK, August 2004. Resolution Enhancement by AdaBoost Abstract This paper proposes a learning scheme based still image super-resolution reconstruction algorithm. Superresolution reconstruct...
IV2004-175.pdfPath: UCSD >> CVRR >> 2004 Fall, 2004
Description: Proc. IEEE Intelligent Vehicles Symposium, June 2004, Accepted. Design of an Instrumented Vehicle Test Bed for Developing a Human Centered Driver Support System Joel C. McCall, Ofer Achler, Mohan M. Trivedi jmccall@ucsd.edu, oachler@ucsd.edu, mtrive...
IV2004-171.pdfPath: UCSD >> CVRR >> 2004 Fall, 2004
Description: Proc. IEEE Intelligent Vehicles Symposium, June 2004, Accepted. An Integrated, Robust Approach to Lane Marking Detection and Lane Tracking Joel C. McCall and Mohan M. Trivedi jmccall@ucsd.edu, mtrivedi@ucsd.edu Computer Vision and Robotics Research ...
ITCC04_Final_Header.pdfPath: UCSD >> CVRR >> 04 Fall, 2004
Description: To appear in the Proceedings of International Conference on Information Technology (ITCC 2004), Special Session on Networked Physical Security and Surveillance Las Vegas, NV, USA, April 5 -7, 2004 Distributed Omni-Video Arrays and Digital Tele-Viewe...
IEEETransSAP2003Nov_Gustafsson.pdfPath: UCSD >> CVRR >> 2003 Fall, 2003
Description: IEEE TRANSACTIONS ON SPEECH AND AUDIO PROCESSING, VOL. 11, NO. 6, NOVEMBER 2003 791 Source Localization in Reverberant Environments: Modeling and Statistical Analysis Tony Gustafsson, Member, IEEE, Bhaskar D. Rao, Fellow, IEEE, and Mohan Trivedi, S...