Documents Found!
As seen in
Less Work, Better Grades
Join
Course Hero
Access
best resources
Ace
your classes
Ace your courses with Course Hero!

Submit your homework question or assignment here:
352 Tutors are online
 
We are so confident that you will love our service, we will answer your first homework question for FREE!
*  Attach Assignment (optional):
 
Our current time in (CST) is
 
Study Smarter, Score Higher
View This Document For FREE!
 
Document Content (unformatted)
Course Hero has millions of student submitted documents similar to the one below including study guides, homework solutions, papers, exam answer keys and textbook solutions.
Find millions of documents here - Study Guides, Homework Solutions, Papers, Exam Answer Keys and more. Course Hero has millions of course related materials that will enable you to learn better, faster and get an A in all your courses.
Below is a small sample set of documents:

UCSD >> RFIC >> 41 (Fall, 2008)
...
UCSD >> RFIC >> 42 (Fall, 2008)
1986 IEEE TRANSACTIONS ON VEHICULAR TECHNOLOGY, VOL. 49, NO. 5, SEPTEMBER 2000 Gain and Phase Error-Free LINC Transmitter Xuejun Zhang and Lawrence E. Larson, Fellow, IEEE AbstractThis paper presents a new correction technique for linear amplificat...
UCSD >> RFIC >> 38 (Fall, 2008)
...
UCSD >> RFIC >> 37 (Fall, 2008)
...
UCSD >> RFIC >> 19 (Fall, 2008)
...
UCSD >> RFIC >> 20 (Fall, 2008)
...
UCSD >> RFIC >> 16 (Fall, 2008)
...
UCSD >> RFIC >> 17 (Fall, 2008)
...
UCSD >> RFIC >> 5 (Fall, 2008)
IEEE JOURNAL OF SOLID-STATE CIRCUITS, VOL. 34, NO. 9, SEPTEMBER 1999 1331 Bipolar Transistor Epilayer Design Using the MAIDS Mixed-Level Simulator Leo C. N. de Vreede, Henk C. de Graaff, Joost A. Willemen, Wibo van Noort, Rik Jos, Lawrence E. Larso...
UCSD >> RFIC >> 1 (Fall, 2008)
IEEE TRANSACTIONS ON MICROWAVE THEORY AND TECHNIQUES, VOL. 47, NO. 8, AUGUST 1999 1467 A Power Re-Use Technique for Improved Efciency of Outphasing Microwave Power Ampliers Robert Langridge, Member, IEEE, Todd Thornton, Peter M. Asbeck, Senior Memb...
UCSD >> RFIC >> 2 (Fall, 2008)
IEEE TRANSACTIONS ON MICROWAVE THEORY AND TECHNIQUES, VOL. 47, NO. 8, AUGUST 1999 1471 High-Efciency Power Amplier Using Dynamic Power-Supply Voltage for CDMA Applications Gary Hanington, Student Member, IEEE, Pin-Fan Chen, Student Member, IEEE, Pe...
UCSD >> RFIC >> 23 (Fall, 2008)
...
UCSD >> RFIC >> 22 (Fall, 2008)
...
UCSD >> RFIC >> 18 (Fall, 2008)
...
UCSD >> RFIC >> 21 (Fall, 2008)
...
UCSD >> RFIC >> 6 (Fall, 2008)
...
UCSD >> RFIC >> 7 (Fall, 2008)
...
UCSD >> RFIC >> 8 (Fall, 2008)
...
UCSD >> RFIC >> 9 (Fall, 2008)
...
UCSD >> RFIC >> 12 (Fall, 2008)
...
UCSD >> RFIC >> 14 (Fall, 2008)
...
UCSD >> RFIC >> 3 (Fall, 2008)
...
UCSD >> RFIC >> 13 (Fall, 2008)
...
UCSD >> RFIC >> 10 (Fall, 2008)
IEEE JOURNAL OF SOLID-STATE CIRCUITS, VOL. 33, NO. 3, MARCH 1998 387 Integrated Circuit Technology Options for RFICsPresent Status and Future Directions Lawrence E. Larson, Senior Member, IEEE AbstractThis paper will summarize the technology tradeo...
UCSD >> RFIC >> 11 (Fall, 2008)
...
UCSD >> RFIC >> 4 (Fall, 2008)
IEEE MICROWAVE AND GUIDED WAVE LETTERS, VOL. 8, NO. 3, MARCH 1998 121 Linear High-Efciency Microwave Power Ampliers Using Bandpass Delta-Sigma Modulators Arun Jayaraman, P. F. Chen, G. Hanington, L. Larson, and P. Asbeck Abstract A novel amplier co...
UCSD >> RFIC >> 15 (Fall, 2008)
...
UCSD >> RFIC >> 36 (Fall, 2008)
...
UCSD >> RFIC >> 35 (Fall, 2008)
...
UCSD >> PRINT >> 9 (Fall, 2008)
University of California, San Diego Graphic Identity Guidelines and Policies WEB IDENTITY 9 University of California, San Diego Graphic Elements WEB IDENTITY WEB IDENTITY GUIDELINES UCSD communicates its image to audiences in a myriad of ways. O...
UCSD >> CS >> 07 (Fall, 2008)
Logic Level Fault Tolerance Approaches Targeting Nanoelectronics PLAs UC San Diego CSE Department Wenjing Rao wrao@cs.ucsd.edu ABSTRACT alex@cs.ucsd.edu UC San Diego CSE Department Alex Orailoglu Polytechnic University ECE Department Ramesh Ka...
UCSD >> CS >> 06 (Fall, 2008)
Topology Aware Mapping of Logic Functions onto Nanowire-based Crossbar Architectures wrao@cs.ucsd.edu ABSTRACT UC San Diego CSE Department Wenjing Rao alex@cs.ucsd.edu UC San Diego CSE Department Alex Orailoglu Polytechnic University ECE Depa...
UCSD >> CS >> 06 (Fall, 2008)
Fault Identication in Recongurable Carry Lookahead Adders Targeting Nanoelectronic Fabrics UC San Diego CSE Department Wenjing Rao UC San Diego CSE Department Alex Orailoglu Polytechnic Univ ECE Department Ramesh Karri wrao@cs.ucsd.edu alex@cs...
UCSD >> CS >> 06 (Fall, 2008)
Nanofabric Topologies and Reconguration Algorithms to Support Dynamically Adaptive Fault Tolerance UC San Diego CSE Department Wenjing Rao UC San Diego CSE Department Alex Orailoglu Polytechnic University ECE Department Ramesh Karri wrao@cs.ucs...
UCSD >> CS >> 05 (Fall, 2008)
Architectural-Level Fault Tolerant Computation in Nanoelectronic Processors UC San Diego CSE Department Wenjing Rao UC San Diego CSE Department Alex Orailoglu Polytechnic University ECE Department Ramesh Karri wrao@cs.ucsd.edu alex@cs.ucsd.edu...
UCSD >> CS >> 05 (Fall, 2008)
UC San Diego CSE Department Wenjing Rao UC San Diego CSE Department Alex Orailoglu Polytechnic University ECE Department Ramesh Karri wrao@cs.ucsd.edu alex@cs.ucsd.edu ramesh@india.poly.edu ABSTRACT In this paper we propose a fault-tolerant ...
UCSD >> CS >> 04 (Fall, 2008)
Frugal Linear Network-Based Test Decompression for Drastic Test Cost Reductions Wenjing Rao, Alex Orailoglu, and George Su Computer Science & Engineering Department University of California, San Diego wrao@cs.ucsd.edu alex@cs.ucsd.edu gpsu@ucsd.edu A...
UCSD >> CS >> 04 (Fall, 2008)
Fault Tolerant Arithmetic with Applications in Nanotechnology based Systems Wenjing Rao UC San Diego CSE Department Alex Orailoglu UC San Diego CSE Department Ramesh Karri Polytechnic University ECE Department wrao@cs.ucsd.edu alex@cs.ucsd.edu r...
UCSD >> CS >> 03 (Fall, 2008)
Test Application Time and Volume Compression through Seed Overlapping UC San Diego CSE Department Wenjing Rao wrao@cs.ucsd.edu ABSTRACT We propose in this paper an extension on the Scan Chain Concealment technique to further reduce test time and v...
UCSD >> CS >> 03 (Fall, 2008)
Virtual Compression through Test Vector Stitching for Scan Based Designs Wenjing Rao CSE Department University of California, San Diego La Jolla, CA 92093 wrao@cs.ucsd.edu ABSTRACT We propose a technique for compressing test vectors. The technique re...
UCSD >> SUPPLEMENT >> 01 (Fall, 2008)
Fig. 7. Contour plots of the highest occupied and lowest unoccupied molecular orbitals (HOMO and LUMO, respectively), of the optimized 6-31+G(d,p) molecular geometry. The plots were generated by using the program 3D-PLTORB, and depicted using QMVIEW,...
UCSD >> D >> 1 (Fall, 2008)
HindIII NotI SphI SacI Calreticulin signal sequence EcoRI AAGCTTGCGGCCGCCACatgctgctgcccgtccccctgctgctgggcctgctgggcgccgccgccgac ECFP(D11) D1 citrine TAAGAATTC Hind III Kpn I BamH I BstX I EcoR I EcoR V BstX I Not I Xho I Xba I* Apa I* T7 NdeI Nr...
UCSD >> D >> 1 (Fall, 2008)
aagcttgcggccgccacatgctgctgcccgtccccctgctgctgggcctgctgggcgccgccgccgacgtgagcaagggcg aggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaggttcagcgtgtccggcga gggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccacc ct...
UCSD >> PCDNA >> 3 (Fall, 2008)
GACGGATCGGGAGATCTCCCGATCCCCTATGGTCGACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCT GCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAAT TGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTAT T...
UCSD >> PCDNA >> 3 (Fall, 2008)
BglII (12) MfeI (161) Bpu10I (180) 1 GACGGATCGGGAGATCTCCCGATCCCCTATGGTCGACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCG CTGCCTAGCCCT...
UCSD >> PCDNA >> 3 (Fall, 2008)
GACGGATCGGGAGATCTCCCGATCCCCTATGGTCGACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCT GCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAAT TGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTAT T...
UCSD >> PCDNA >> 3 (Fall, 2008)
BglII (12) MfeI (161) Bpu10I (180) 1 GACGGATCGGGAGATCTCCCGATCCCCTATGGTCGACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCG CTGCCTAGCCCT...
UCSD >> APP >> 2007 (Fall, 2008)
DivisionofPulmonaryandCriticalCareMedicine FellowshipProgram Applicationprocessforthisprogramwillbehandledthrough ERAS. ApplicationswillbegintobeacceptedinDecemberforthisprogramandinterviews arescheduledtobeginin February,2007. TheProgramrecognizesth...
UCSD >> WEB >> 200809 (Fall, 2008)
9/3/2008 TheKidneyinHypertension:GuytonRedux TomCoffman,MD JamesR.ClappProfessorofMedicine ProfessorofCellBiologyandImmunology Chief,DivisionofNephrology DukeUniversity PresidentElect,AmericanSocietyofNephrology ChristianMendeM.D.FellowshipLecturerin...
UCSD >> CVRR >> 06 (Fall, 2006)
Tracking of Individuals in Very Long Video Sequences P. Fihl1 , R. Corlin1 , S. Park2 , T.B. Moeslund1, and M.M. Trivedi2 1 Laboratory of Computer Vision and Media Technology Aalborg University, Denmark pfa@cvmt.dk, tbm@cvmt.dk 2 Computer Vision and...
UCSD >> CVRR >> 06 (Fall, 2006)
MOBILE AND UBIQUITOUS SYSTEMS www.computer.org/pervasive Turn-Intent Analysis Using Body Pose for Intelligent Driver Assistance Shinko Yuanhsien Cheng and Mohan Manubhai Trivedi Vol. 5, No. 4 OctoberDecember 2006 This material is presented to ens...
UCSD >> CVRR >> 05 (Fall, 2004)
International Workshop on Analysis and Modeling of Faces and Gestures, October 2005 An Integrated Two-stage Framework for Robust Head Pose Estimation Junwen Wu and Mohan M. Trivedi Computer Vision and Robotics Research Laboratory University of Calif...
UCSD >> CVRR >> 05 (Fall, 2004)
International Workshop on Analysis and Modeling of Faces and Gestures, October 2005 Robust Facial Landmark Detection for Intelligent Vehicle System Junwen Wu and Mohan M. Trivedi Computer Vision and Robotics Research Laboratory University of Califor...
UCSD >> CVRR >> 05 (Fall, 2004)
IEEE TRANSACTIONS ON SYSTEMS, MAN, AND CYBERNETICSPART A: SYSTEMS AND HUMANS, VOL. 35, NO. 1, JANUARY 2005 145 Dynamic Context Capture and Distributed Video Arrays for Intelligent Spaces Mohan Manubhai Trivedi, Senior Member, IEEE, Kohsia Samuel Hu...
UCSD >> CVRR >> 04 (Fall, 2004)
Machine Vision and Applications, Accepted for publication, November 2004 Parametric Ego-Motion Estimation for Vehicle Surround Analysis Using Omni-Directional Camera Tarak Gandhi and Mohan Trivedi Computer Vision and Robotics Research Laboratory Uni...
UCSD >> CVRR >> 2004 (Fall, 2004)
7th IEEE Conference on Intelligent Transportation Systems, Oct. 2004 (to appear) A Collaborative Approach for Human-Centered Driver Assistance Systems Joel C. McCall, Ofer Achler, Mohan M. Trivedi Computer Vision and Robotics Research Laboratory Jea...
UCSD >> CVRR >> 2004 (Fall, 2004)
Submitted to IEEE Conference on Intelligent Transportation Systems on April 1, 2004 Face Detection and Head Tracking using Stereo and Thermal Infrared Cameras for Smart Airbags: A Comparative Analysis Stephen J. Krotosky, Shinko Y. Cheng, Student Me...
UCSD >> CVRR >> 2004 (Fall, 2004)
IEEE International Transportation Systems Conference, October 2004 Computer Vision for Multi-Sensory Structural Health Monitoring System* Remy Chang, Tarak Gandhi, and Mohan M. Trivedi Computer Vision and Robotics Research Laboratory University of C...
UCSD >> ICPR >> 04 (Fall, 2004)
Accepted for publication in the 17th International Conference on Pattern Recognition (ICPR 2004) Cambridge, United Kingdom, Aug. 23-26, 2004 Robust Real-Time Detection, Tracking, and Pose Estimation of Faces in Video Streams Kohsia S. Huang and Moha...
UCSD >> ICPR >> 2004 (Fall, 2004)
To appear Int. Conference on Pattern Recognition, Cambridge, UK, August 2004. High Frequency Component Compensation based Super-resolution Algorithm for Face Video Enhancement Abstract This paper proposes a video-based super-resolution algorithm by...
UCSD >> ICPR >> 2004 (Fall, 2004)
To appear Int. Conference on Pattern Recognition, Cambridge, UK, August 2004. Resolution Enhancement by AdaBoost Abstract This paper proposes a learning scheme based still image super-resolution reconstruction algorithm. Superresolution reconstruct...
UCSD >> CVRR >> 2004 (Fall, 2004)
Proc. IEEE Intelligent Vehicles Symposium, June 2004, Accepted. Design of an Instrumented Vehicle Test Bed for Developing a Human Centered Driver Support System Joel C. McCall, Ofer Achler, Mohan M. Trivedi jmccall@ucsd.edu, oachler@ucsd.edu, mtrive...
UCSD >> CVRR >> 2004 (Fall, 2004)
Proc. IEEE Intelligent Vehicles Symposium, June 2004, Accepted. An Integrated, Robust Approach to Lane Marking Detection and Lane Tracking Joel C. McCall and Mohan M. Trivedi jmccall@ucsd.edu, mtrivedi@ucsd.edu Computer Vision and Robotics Research ...
UCSD >> CVRR >> 04 (Fall, 2004)
To appear in the Proceedings of International Conference on Information Technology (ITCC 2004), Special Session on Networked Physical Security and Surveillance Las Vegas, NV, USA, April 5 -7, 2004 Distributed Omni-Video Arrays and Digital Tele-Viewe...
UCSD >> CVRR >> 2003 (Fall, 2003)
IEEE TRANSACTIONS ON SPEECH AND AUDIO PROCESSING, VOL. 11, NO. 6, NOVEMBER 2003 791 Source Localization in Reverberant Environments: Modeling and Statistical Analysis Tony Gustafsson, Member, IEEE, Bhaskar D. Rao, Fellow, IEEE, and Mohan Trivedi, S...
UCSD >> CVRR >> 2003 (Fall, 2003)
Appearing in ACM SIGMM Multimedia Biometrics Methods and Application Workshop, Novermber 8, 2003 Manifold analysis of facial gestures for face recognition Douglas Fidaleo Computer Vision and Robotics Research Laboratory University of California, San...
UCSD >> CVRR >> 2003 (Fall, 2003)
Appeared in the Proceedings of the 4th IEEE International Conference on Multimedia and Expo, Baltimore, MD, vol. 2, pp. 9-12, July 6-9, 2003. DISTRIBUTED VIDEO ARRAYS FOR TRACKING, HUMAN IDENTIFICATION, AND ACTIVITY ANALYSIS Kohsia S. Huang and Moha...
UCSD >> CVRR >> 2003 (Fall, 2003)
918 IEEE TRANSACTIONS ON PATTERN ANALYSIS AND MACHINE INTELLIGENCE, VOL. 25, NO. 7, JULY 2003 Detecting Moving Shadows: Algorithms and Evaluation Andrea Prati, Member, IEEE, Ivana Mikic, Member, IEEE, Mohan M. Trivedi, Member, IEEE, and Rita Cucc...
UCSD >> CVRR >> 03 (Fall, 2003)
Machine Vision and Applications (2003) 14: 103111 Digital Object Identier (DOI) 10.1007/s00138-003-0106-5 Machine Vision and Applications Springer-Verlag 2003 Video arrays for real-time tracking of person, head, and face in an intelligent room Koh...
UCSD >> CVRR >> 2001 (Fall, 2008)
B. Hall, K. Huang, and M. Trivedi, \"A Televiewing System for Multiple Simultaneous Customized Perspectives and Resolutions,\" Submitted to IEEE Intl Conf. on Intelligent Transportation Systems, Aug 2001. A Televiewing System for Multiple Simultaneous...
What are you waiting for?
View This Document For FREE!