11 Pages

aemj_02

Course: WWW 1, Fall 2008
School: Loyola Chicago
Rating:
 
 
 
 
 

Word Count: 7966

Document Preview

AND APPLIED ENVIRONMENTAL MICROBIOLOGY, July 2002, p. 32153225 0099-2240/02/$04.00 0 DOI: 10.1128/AEM.68.7.32153225.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Vol. 68, No. 7 Parallel Characterization of Anaerobic Toluene- and Ethylbenzene-Degrading Microbial Consortia by PCR-Denaturing Gradient Gel Electrophoresis, RNA-DNA Membrane Hybridization, and DNA Microarray Technology...

Register Now

Unformatted Document Excerpt

Coursehero >> Illinois >> Loyola Chicago >> WWW 1

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
AND APPLIED ENVIRONMENTAL MICROBIOLOGY, July 2002, p. 32153225 0099-2240/02/$04.00 0 DOI: 10.1128/AEM.68.7.32153225.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Vol. 68, No. 7 Parallel Characterization of Anaerobic Toluene- and Ethylbenzene-Degrading Microbial Consortia by PCR-Denaturing Gradient Gel Electrophoresis, RNA-DNA Membrane Hybridization, and DNA Microarray Technology Yoshikazu Koizumi,1 John J. Kelly,2 Tatsunori Nakagawa,1 Hidetoshi Urakawa,3 Sad El-Fantroussi,3 Saleh Al-Muzaini,4 Manabu Fukui,1* Yoshikuni Urushigawa,5 and David A. Stahl3 Department of Biological Sciences, Graduate School of Science, Tokyo Metropolitan University, 1-1 Minami-Ohsawa, Hachioji, Tokyo 192-0397, Japan1; Department of Civil Engineering, Northwestern University, Evanston, Illinois 60208-31092; Department of Civil and Environmental Engineering, University of Washington, Seattle, Washington 98195-27003; Environmental Sciences Department, Kuwait Institute for Scientic Research, 13109 Safat, Kuwait4; and Faculty of System Science and Technology, Akita Prefectural University, 84-4 Tsuchiya-Ebinokuchi, Honjyo, Akita 015-0055, Japan5 Received 24 January 2002/Accepted 4 April 2002 A mesophilic toluene-degrading consortium (TDC) and an ethylbenzene-degrading consortium (EDC) were established under sulfate-reducing conditions. These consortia were rst characterized by denaturing gradient gel electrophoresis (DGGE) ngerprinting of PCR-amplied 16S rRNA gene fragments, followed by sequencing. The sequences of the major bands (T-1 and E-2) belonging to TDC and EDC, respectively, were afliated with the family Desulfobacteriaceae. Another major band from EDC (E-1) was related to an uncultured non-sulfate-reducing soil bacterium. Oligonucleotide probes specic for the 16S rRNAs of target organisms corresponding to T-1, E-1, and E-2 were designed, and hybridization conditions were optimized for two analytical formats, membrane and DNA microarray hybridization. Both formats were used to characterize the TDC and EDC, and the results of both were consistent with DGGE analysis. In order to assess the utility of the microarray format for analysis of environmental samples, oil-contaminated sediments from the coast of Kuwait were analyzed. The DNA microarray successfully detected bacterial nucleic acids from these samples, but probes targeting specic groups of sulfate-reducing bacteria did not give positive signals. The results of this study demonstrate the limitations and the potential utility of DNA microarrays for microbial community analysis. Although hydrocarbons such as benzene, toluene, ethylbenzene, and the xylene isomers are among the most tractable of environmental contaminants to eliminate by natural or stimulated activities of native microbiota, their degradation is constrained by the natural system. For example, aerobic degradation of hydrocarbons is generally much faster than anoxic processes (13, 25). However, most polluted environments (e.g., soils, sediments, and groundwater) are oxygen limited or anoxic. Although many pathways of aerobic degradation of hydrocarbons are well known, their degradation under anaerobic conditions has been little studied. Thus, the fate of hydrocarbons in anoxic settings is much less predictable. Since pollutant fate is largely controlled by the native microbiota, a more complete understanding of community structure and activity should provide for better prediction and process control. Since most environmental bacteria cannot be cultured by conventional culture methods (6, 29), molecular methods (often based on 16S rRNA) have served to provide a more explicit accounting of the genetic diversity (6). * Corresponding author. Mailing address: Department of Biological Sciences, Graduate School of Science, Tokyo Metropolitan University, Minami-ohsawa 1-1, Hachioji, Tokyo 192-0397, Japan. Phone: 81-42677-2581. Fax: 81-426-77-2559. E-mail: fukui-manabu@c.metro-u.ac.jp. 3215 A variety of genetic ngerprinting and hybridization formats have been developed to resolve sequence diversity and abundance. Fingerprinting methods are often a prelude to more quantitative methods. For example, denaturing gradient gel electrophoresis (DGGE) of PCR-amplied fragments provides for the evaluation of genetic diversity and the monitoring of succession in microbial communities (21, 39). However, it is well recognized that PCR biases compromise quantitative interpretation of amplied products (8, 50) and that variable rRNA gene copy number further complicates this assessment (22). Thus, more direct methods such as quantitative membrane hybridization of total 16S rRNA extracted from environmental samples provide a better estimate of relative abundance with good sensitivity (45, 48, 49, 55). However, available formats cannot provide for intensive monitoring. Recently, DNA microarrays have been developed for medical and diagnostic applications (e.g., detection of single-nucleotide polymorphism, sequencing by hybridization with oligonucleotide in a matrix, and evaluation of gene expression) (14, 53, 59, 63). With this format, thousands of genes can be simultaneously assessed by using a large set of probes miniaturized on one glass slide. This is also an ideal format to assess the sequence diversity of 16S rRNA in natural environmental samples (27). 3216 KOIZUMI ET AL. APPL. ENVIRON. MICROBIOL. 0.8 ml of 50 mM sodium phosphate (pH 6.8) for each wash. Following successive passages of 0.4 ml of 140 mM potassium phosphate (pH 6.8) and 0.8 ml of 300 mM potassium phosphate (pH 6.8), total nucleic acid was recovered in two 1.5-ml microtubes by eluting twice with 0.8 ml of 300 mM potassium phosphate, pH 6.8. Salts and humic contaminants were removed from the elution with a 2.5-ml Sephadex G-75 spin column (38), and the nucleic acid was collected by isopropyl alcohol precipitation. DGGE analysis. PCR for DGGE analysis was performed as described by Muyzer et al. (40) but with the complement of probe EUB338 (4) as a forward primer with GC-clamp (338f, 5 -CGCCCGCCGCGCCCCGCGCCCGTCCCG CCGCCCCCGCCCG-3 ). As a reverse primer, 907r (5) was used. PCR-amplied 16S rDNA fragments were analyzed by DGGE, followed by sequencing. DGGE was performed with a D-gene or D-code system (Bio-Rad Laboratories, Hercules, Calif.), as described previously (39, 40). The denaturing gradient ranged from 20 to 60%. Approximately 500 ng of PCR products and 100 ng of reamplied DNA fragments were electrophoretically fractionated for 4 h at a constant voltage of 200 V and a temperature of 60C. After electrophoresis, the gels were incubated for 10 min in Milli-Q water containing ethidium bromide (1.0 mg liter 1), rinsed for 10 min in Milli-Q water, and photographed with a UV (302 nm) transillumination system equipped with an Atto Printgraph (Atto, Tokyo, Japan). DGGE bands excised from the gel were reamplied, and their purity was veried by DGGE. After purication of PCR products with the QIAquick PCR purication kit (Qiagen, Hiden, Germany), sequences were determined by cycle sequencing with a dye-labeled primer. RNA sample preparation. For native RNA from microorganisms, total RNA was extracted from cell pellets by the low-pH bead-beating method (37, 55). For recovery of native RNA from sediments, extraction and purication of nucleic acids were performed by using the HTP spin-column method described above. DNA was degraded by using DNase I as previously described (38). RNA was recovered by PCI extraction followed by ethanol precipitation. In vitro transcription was used to produce 16S rRNA from the major DGGE bands and from genomic DNA of individual isolates. PCR amplication was carried out with the primer pair of T7 promoter-conjugated 338f (5 -TGAATT GTAATACGACTCACTATAGGGCGAATTC-3 ) and 907r or T7 promoterconjugated BACT11F (32) and S-D-Bact-1512-a-A-16 (23) in a thermal cycler (Thermo Hybaid US, Franklin, Mass.) in 100- l aliquots under the following conditions. Each tube contained 1 PCR buffer, deoxynucleoside triphosphate mixture (2.5 mM each), 25 M each primer, 5 U of Taq DNA polymerase (Amersham Pharmacia Biotech Inc., Piscataway, N.J.) l 1, and 100 ng of template DNA. An initial denaturation step of 3 min at 95C was followed by 30 cycles of 30 s at 95C, 30 s at 55C, and 1 min at 72C, then 5 min at 72C. RNA was transcribed from these PCR-generated templates by using a commercial RNA transcription kit (New England Bio Labs Inc., Beverly, Mass.) in 150- l aliquots according to the manufacturers protocol. Oligonucleotide probe design and determination of washing temperature. Four oligonucleotide probes were designed for the major DGGE bands by using the Probe_Design tool of the ARB software package (O. Strunk, O. Gross, B. Reichel, M. May, S. Hermann, N. Stuckman, B. Nonhoff, M. Lenke, A. Ginhart, A. Vilbig, T. Ludwig, A. Bode, K.-H. Schleifer, and W. Ludwig, 1998, http:// www.mikro.biologie.tu-muenchen.de/pub/ARB). Since probe S- -Tsrda-0641-aA-20 had self-complementarity near the termini, an alternative probe (probe S- -Tsrda-0644-a-A-19) was designed (Table 1). The Probe_Check program provided by the Ribosomal Database Project II (35) and BLAST search (3) were both used to evaluate probe specicity. The Td (temperature of dissociation) values and the specicities of the oligonucleotide probes were assessed by the general method described by Zheng et al. (64). All oligonucleotide probes were synthesized with an amino linker at the 3 end by Operon Inc. (Alameda, Calif.). The amino linker is used for immobilization of the oligonucleotide probes within the DNA microarrays. Quantitative membrane hybridization. For quantitative membrane hybridization, denatured RNA samples and a dilution series of pure culture RNA were applied in triplicate to nylon membranes (Magna Charge nylon membrane; Micron Separation Inc., Westboro, Mass.), and hybridization was performed as described previously (48, 55, 64). The concentrations of all samples and reference RNAs were normalized by using the probe S- -Univ-907-a-A-22. A known concentration of Escherichia coli native RNA determined spectrophotometrically was used for normalization. The hybridization signals were measured by using a PhosphorImager (Storm 860; Molecular Dynamics, Sunnyvale, Calif.) and analyzed with the ImageQuant software package (Molecular Dynamics). The results were expressed as the fraction of target 16S rRNA relative to total eubacterial rRNA quantied by using probe S-D-Bact-0338-a-A-18. Sulfate-reducing bacteria are thought to play an important role in degrading hydrocarbons in marine environments because the concentration of sulfate in seawater is very high (28 mM) (31). This is supported by the enrichment and isolation of hydrocarbon-degrading organisms under sulfate-reducing conditions (9, 10, 11, 24, 28, 42, 46, 47, 51). However, their isolation from anaerobic consortia is usually difcult, presumably because they often depend on syntrophic associations (42). Therefore, studies of their natural diversity and abundance in relationship to hydrocarbon degradation should be greatly facilitated by application of microarray technology. The aim of this study is the parallel detection of specic 16S rRNAs in microbial consortia by using the novel microarray technique. MATERIALS AND METHODS Microorganisms. Desulfobacter latus (DSM 3381), Desulfosarcina variabilis (DSM 2060), Desulfobacterium anilini (ATCC 49792), and Desulfovibrio africanus (ATCC 19996) were used as reference strains in this study. They were cultured with the sulde-reduced bicarbonate-buffered dened medium described by Widdel and Bak (61). The medium for seawater and freshwater contained 20 and 1 g of NaCl liter 1, respectively. The substrate for each microorganism was added according to the recipe on the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH web site. Bacterial enrichment and sample collection. The mesophilic toluene- and ethylbenzene-degrading consortia were established from sediment obtained from the Tokyo Bay estuary, Japan, in 1993. The enrichment of these consortia was established by Nakagawa et al. (41). An aliquot (5 to 10 ml) of sediment was inoculated into 115 ml of medium in 150-ml serum bottles, which were then sealed with butyl rubber stoppers under a headspace of N2-CO2 (80:20, vol/vol). Sulfate-reducing enrichment cultures were established with crude oil as the sole source of carbon and energy. Incubations were carried out at 28C in the dark. An aliquot (3 ml) of enrichment culture was transferred to freshly prepared medium every 4 months until the sediment was removed. From this enrichment, toluene (TDC)- and ethylbenzene (EDC)-degrading consortia were established. To avoid toxicity, toluene and ethylbenzene were diluted with 2,2,4,4,6,8,8-heptamethylnonane as the carrier phase containing 2% (vol/vol) toluene or ethylbenzene (28, 47). An aliquot (5 ml) of carrier phase was added to the medium. To conrm sulfate-reducing bacterial growth, sulde production was occasionally monitored by mixing 0.2 ml of the culture and 1 ml of sulde detection reagent (5 mM CuCl2, 50 mM HCl) (17), producing a dark brown color in the presence of sulde. The dissolved sulde concentration in the aqueous phase of the enrichment cultures was also colorimetrically measured by using the methylene blue reaction (16), as modied by Aeckersberg et al. (1). The sulde concentration data were obtained from a single experiment and measurement. A crude oil-contaminated sediment sample was obtained at Shuaiba in the coastal area of Kuwait in June 1995 by using a van Veen-type grab sampler. The composition of the oil recovered from the sediment was 7% asphaltene, 43% polar moltene, 29% saturate neutral, 6% monoaromatics, 11% diaromatics, and 4% triaromatics (52). The sample was transferred to the laboratory in an icebox for analysis. DNA extraction. DNA extraction from cell pellets was carried out as described previously (62). Cells were disrupted by sodium dodecyl sulfate (SDS) and proteinase K treatment. Polysaccharides and other contaminating macromolecules derived from bacterial cells were removed by using hexadecyltrimethyl ammonium bromide (CTAB). After chloroform-isoamyl alcohol (24:1) and phenol-chloroform-isoamyl alcohol (PCI; 25:24:1, pH 8.0) extractions, total nucleic acid was recovered by ethanol precipitation. Extraction and purication of DNA from 2 g of washed sediment were performed by the hydroxylapatite (HTP) (Bio-Gel HTP Gel, Bio-Rad Laboratories, United Kingdom) spin-column method (44). The samples were freeze-thawed in 0.9 ml of lysing buffer (50 mM Tris-HCl [pH 8.0], 0.1 mM EDTA [pH 8.0], 25% sucrose, and 10 mM sodium pyruvate). After centrifugation, the supernatants were removed, and the following solutions added to each tube: 0.7 ml of 120 mM sodium phosphate (pH 8.0), 0.5 ml of PCI, and 50 l of 20% SDS. The cells were then mechanically disrupted by bead beating (FastPrep FP120; Bio 101, Inc., Vista, Calif.) for 2 min at the max speed (37). For removal of humic substances, we used an HTP spin-column constructed from a 2.5-ml plastic syringe (Terumo Corp., Tokyo, Japan). After loading extracts, the column was washed four times by spinning at 100 g for 4 min with VOL. 68, 2002 ANAEROBIC TOLUENE AND ETHYLBENZENE DEGRADERS TABLE 1. Probe used in this study Membrane DNA microarray Td (C) Tw (C) % Washed off at TW 3217 Probe and microorganisms a Target sequence e GC% Td (C) Tw (C) % Washed off at Tw Reference S-*-Tsrda-0641-a-A-20 T1 Desulfosarcina variabilis S-*-Tsrda-0644-a-A-19 T1 Desulfosarcina variabilis S-*-Edn-0656-a-A-18 E1 Lactobacillus catenaforme S-*-Edsrb-0656-a-A-19 E2 T1 Desulfobacterium anilini S-*-Univ-1390-a-A-18b S-*-Univ-0907-a-A-22 T1 E1 E2 Escherichia coli Desulfobotulus sapovorans Methanococcus thermolithotrophicus S-D-Bact-0338-a-A-18 T1 E1 E2 S-D-Bact-0927-a-A-17b S-F-Dsv-0687-a-A-16 Desulfovibrio africanus Geobacter metallireducens S-*-Dsb-0804-a-A-18 Desulfobacter latus T1 a b c 5 CATACTCAAGCCTGGCAGTA3 3 GUAUGAGUUCGGUCCGUCAU5 U 5 CCCATACTCAAGCCTGGCA3 3 GGGUAUGAGUUCGGACCGU5 U 5 CGTCTTCCCCCACCTTAC3 3 GCAGAAGGGGGUGGAAUG5 GAG 5 CGAATCTCCTCTCCCATAC3 3 GGUUAGAGGAGAGGGUAUG5 GAG G- 5 GACGGGCGGTGTGTACAA3 5 CCCCGTCAATTCCTTTGAGTTT3 3 GGGGCAGUUAAGGAAACUCAAA5 T- GU 5 GCTGCCTCCCGTAGGAGT3 3 CGACGGAGGGCAUCCTCA5 5 ACCGCTTGTGCGGGCCC3 5 TACGGATTTCACTCCT3 3 AUGCCUAAAGUGAGGA5 5 CAACGTTTACTGCGTGGA3 3 GUUGCAAAUGACGCACCU5 50.0 54 52 51.5 51.5 66 58 70 96 77 100 50 42 36 44 38.5 40.5 46 46 46 46 46 46 46 46 46 46 70 88 60 79 68 This study 57.9 60 This study 61.1 66 This study 52.6 62.5 54.5 63 44 53 100 40.5 39.5 33 68 98 77 This study 64 61.1 45.5 53 51 61 51 66.7 6 42 6 4 6 47 45.6 45 46 46 46 46 36 54 55 5 54 76.5 43.8 44 44.5 43 c 46 46 46 46 46 57 62 4 26 NSd NS 46 NS NS 19 50.0 46 46 39.5 46 85 19 Probes are named according to the Oligonucleotide Probe Database (2). These probes were not used in slot-blot hybridization. , Td was not determined because the melting prole obtained was straight line and did not show a sigmoid curve. d NS, no signal. e Underlined positions are positions that may cause self-complementality. DNA microarray fabrication. The DNA microarrays used in this study consisted of miniaturized oligonucleotide arrays in which oligonucleotide probes were individually immobilized within small polyacrylamide gel pads afxed to a glass slide. A matrix of glass-immobilized gel elements (100 by 100 by 20 m each) spaced 100 m apart was manufactured with photopolymerization (63) and activated as described previously (33). We have incorporated four new oligonucleotide probes and six previously published probes into the DNA microarray used in this study (Table 1). Approximately 6 nl of individual 1 mM aminooligonucleotide solutions was applied to each gel pad containing aldehyde groups according to the procedure described previously (63). RNA fragmentation and labeling. About 10 to 20 g of either native or transcribed rRNA was heated at 95C for 5 min and fragmented by addition of 60 mM MgCl2 (total volume, 20 l) and incubation at 95C for 40 min. Phosphatase treatment was performed by addition of 3 l of 10 alkaline phosphatase buffer (Promega, Madison, Wis.) and 0.2 l of shrimp alkaline phosphatase (1 U l 1) (Promega) and heating at 37C for 30 min. Oxidation of the 3 -end ribosyl moiety was conducted by addition of 6.5 l of 100 mM sodium periodate and incubation at room temperature for 20 min. Labeling was carried out by addition of 3.5 l of 100 mM lissamine rhodamine B ethylenediamine (Molecular Probes, Eugene, Oreg.) and 1.65 l of 1 M HEPES (pH 7.5) and heating at 37C for 1 h. Reduction of the Schiff base was conducted by addition of 6.7 l of 200 mM sodium cyanoborohydride and incubation at room temperature for 30 min. Labeled RNA was precipitated by addition of 15 volumes of 2% lithium perchlorate in acetone and chilling at 20C for 20 min. After centrifugation at 14,000 rpm for 5 min, RNA pellets were washed twice with acetone, dried at 55C for 10 min, and suspended in 20 l of nuclease-free water (43). Microarray and image analysis. An aliquot (40 l) of hybridization solution containing labeled RNA [10 g of native RNA, 5 g of transcribed (111512)RNA, or 3 g of transcribed (338-927)RNA], 60% formamide, 0.9 M NaCl, and 20 mM Tris-HCl buffer (pH 8.0) was passed through a 0.22- m lter (Ultra-MC; Millipore) to remove particulates, then heated at 95C for 3 min, and held on ice. An aliquot (35 l) of the hybridization solution was added to a hybridization chamber (Grace Biolabs, Bend, Oreg.), and the hybridization chamber was afxed to the microarray. The microarray was allowed to hybridize at room temperature for at least 16 h in the dark. After the microchamber and 3218 KOIZUMI ET AL. APPL. ENVIRON. MICROBIOL. FIG. 1. DGGE analysis of PCR-amplied 16S rDNA fragments obtained from TDC and EDC, microbial populations in an oil-contaminated sediment at the coastal area of Kuwait, and the major DGGE bands. Inverted image of the DGGE gel stained by ethidium bromide. Lane 1, reamplied band T-1; lane 2, TDC (30 days); lane 3, reamplied band E-1; lane 4, reamplied band E-2; lane 5, EDC (30 days); lane 6, EDC (60 days); lane 7, Kuwaiti sediment. 16S rDNA fragments of TDC, EDC, and oil-contaminated sediment were obtained by PCR amplication of genomic DNA (lanes 2, 5, 6, and 7). Reproducibility of DGGE analysis was conrmed by three replications of PCR. hybridization solution were removed, the microarray was soaked in warm washing buffer (20 mM Tris-HCl buffer [pH 8.0], 10 mM NaCl, and 5 mM EDTA [pH 8.0]) at 46C for 5 min. The microarray was then immediately covered with a chamber lled with 100 l of washing buffer. The signal of each probe hybridized with fragmented and labeled rRNA was detected by using a custom-made epiuorescence microscope equipped with a charge-coupled device camera (Princeton Instruments, Princeton, N.J.), and the intensity of each signal was measured at room temperature with WinView software (Princeton Instruments). Exposure times were in the range of 0.1 to 1 s, depending on the signal intensity. When melting curves were determined, the microarray was washed at room temperature for 1 min two times and then covered with the chamber lled with 100 l of washing buffer. The temperature of the microscope slide was controlled by a thermotable mounted on a stage of the epiuorescence microscope and connected with a thermoelectric temperature controller (LFI-3751; Wavelength Electronics, Inc., Bozeman, Mont.) and a waterbath (Cole Parmer Instruments Co., Chicago, Ill.). Melting proles for all probes were monitored and recorded at 2C intervals from 10 to 70C by increasing the temperature at 1C per min. Nucleotide sequence accession numbers. The partial rRNA gene sequences have been deposited in the GenBank, EMBL, and DDBJ nucleotide sequence databases under accession nos. AB062689, AB062688, and AB062924. RESULTS AND DISCUSSION Sulde production and hydrocarbon degradation in enrichments. We enriched the marine sediment, which was obtained from Tokyo Bay, by adding toluene (2% [vol/vol] in the carrier phase) or ethylbenzene (2% [vol/vol] in the carrier phase) as a sole electron donor and carbon source under sulfate-reducing, anaerobic conditions. The sulde production of these enrichment cultures was monitored with respect to growth on hydrocarbon. In the toluene-degrading consortium (TDC), the amount of toluene decreased from 1.53 to 0.72 mmol, associated with 2.92 mmol of sulde production after 90 days of incubation. In the ethylbenzene-degrading consortium (EDC), the concentration of sulde increased from 0.39 mmol on day 15 to 1.63 mmol on day 49, then reached 2.14 mmol after 82 days. The amount of ethylbenzene decreased from 0.95 mmol on day 5 to 0.38 mmol on day 82. Attempts to isolate pure cultures from TDC and EDC have so far been unsuccessful. DGGE analysis and sequencing. DGGE patterns of TDC at 30 days, EDC at 30 and 60 days, and oil-contaminated sediment are shown in Fig. 1 (lanes 2, 5, 6, and 7, respectively). A few conspicuous bands (T-1 in TDC and E-1 and E-2 in EDC) were observed on the DGGE gel. This result indicated that specic microorganisms were selectively enriched. The DGGE pattern of the DNA amplicon from the oil-contaminated sediment was faint, and no conspicuous bands were detected. The bands corresponding to T-1, E-1, and E-2 were not visible in the sediment sample. DNA fragments were excised from the major bands on the DGGE gel (T-1, E-1, and E-2) and reamplied (Fig. 1, lanes 1, 3, and 4, respectively). The sequences of these 16S rRNA fragments (338 to 927, based on E. coli numbering) were determined. The sequence of T-1 was VOL. 68, 2002 ANAEROBIC TOLUENE AND ETHYLBENZENE DEGRADERS 3219 FIG. 2. Normalized Td (temperature of dissociation) curves determined by using transcribed RNA (338 to 927, E. coli numbering) of target 16S rDNA fragments and native RNA of nontarget microorganisms. Numbers in parentheses indicate the number of mismatches between probe and target sequences. All curves shown are the result of duplicate experiments. Only target RNA was used for probe S- -Edn-0656-a-A-18. most similar to that of strain oXyS1 (99.8%), which originated from the water phase of an oil tank (28). Strain oXyS1 is afliated with a relatively deep-branching lineage within the family Desulfobacteriaceae. Growth on toluene was also observed for strain oXyS1. Even though utilization of ethylbenzene has not previously been detected under mesophilic sulfate-reducing conditions (47, 51), we successfully enriched for sulfate-reducing bacteria by using ethylbenzene as a sole energy and carbon source. DGGE analysis followed by sequencing revealed that the sequence of E-2 was most similar to that of mXyS1 (98.0%), afliated with the family Desulfobacteriaceae. mXyS1 is a novel type of marine sulfate-reducing bacterium capable of complete anaerobic degradation of m-xylene (28). The sequence of E-1 showed highest similarity (84.6%) to an uncultured soil bacterium, PBS-21, loosely afliated with a deep-branching lineage within the order Spirochaetales. These results are consistent with the nding that all known sulfate-reducing bacteria enriched on aromatic compounds are afliated with the family Desulfobacteriaceae (47). Moreover, Phelps et al. (42) reported that 4 of 12 clones isolated from a sulfate-reducing consortium enriched with benzene belonged to the family Desulfobacteriaceae. Quantitative membrane hybridization. In order to determine the abundance of the putative hydrocarbon-degrading bacteria revealed by the DGGE analysis, we designed four oligonucleotide probes based on the sequences of the major DGGE bands (Table 1). In addition, probes S-D-Bact-0338-aA-18, S-F-Dsv-0687-a-A-16, and S- -Dsb-0804-a-A-18 were also used. Probe S- -Univ-0907-a-A-22 was used for normalization. The nal washing temperature (Tw) for each probe (Table 1) was empirically determined by a temperature of dissociation (Td) study and specicity study as previously described by Zheng et al. (63). Normalized Td curves of these probes were obtained with high reproducibility (Fig. 2). Table 1 lists the targets, the sequence alignments, and the amount of 32 P-labeled probes dissociated at each specic wash condition (Tw). Tw for probe S- -Univ-0907-a-A-22 corresponded to the temperature at which an almost equal percentage of the duplex between any 16S rRNA target and probe remained intact, but was higher than the temperature causing nonspecic binding. Probes S- -Tsrda-0641-a-A-20 and S- -Tsrda-0644-a-A-19, which target the same region of the 16S rRNA, showed different melting curves. Also, the initial signal intensity of probe S- -Tsrda-0641-a-A-20 was 100 times lower than that of probe S- -Tsrda-0644-a-A-19. This difference was attributed to selfcomplementarity (Table 1). For probe S- -Tsrda-0641-a-A-20, the Td value for the nontarget organism containing one mismatch was only 2C lower than that for the target organism (Fig. 2A). Since a Tw achieving complete discrimination between the target and the nontarget containing one mismatch would reduce signal intensity by 90%, 58C was selected as the Tw. Therefore, the signal of single-mismatch nontargets would be slightly above background (96% washed off) (Table 1). 3220 KOIZUMI ET AL. APPL. ENVIRON. MICROBIOL. FIG. 3. Results of quantitative membrane hybridization signals obtained with specic probes were normalized to the hybridization signal of probe S-D-Bact-0338-a-A-18. The results are expressed as a percentage of the total eubacterial 16S rRNA and represent the mean values of triplicate applications from a single sample. Vertical bars indicate maximum and minimum ratios of specic probes to eubacterial probe (S-D-Bact-0338-a-A-18) calculated by all combinations as follows: aA 1, aB 1, aC 1, bA 1, bB 1, bC 1, cA 1, cB 1, and cC 1, where the lowercase letters represent the signal intensities of each specic probe in triplicate (a, b, and c), and the capital letters represent the signal intensities of eubacterial probe in triplicate (A, B, and C). RNA samples were obtained from TDC, EDC, and oil-contaminated sediment in the coastal of area Kuwait. For probe S- -Tsrda-0644-a-A-19, the Td values of the target organism and the nontarget organism with one mismatch were not different. However, the melting curve of the duplex between S- -Tsrda-0644-a-A-19 and the target (T-1) had a shoulder at around 53C (Fig. 2B). Due to this shoulder, it was possible to determine a Tw that would result in reasonable hybridization signals. Probes S- -Edn-0656-a-A-18 and S- Edsrb-0656-a-A-19 showed ideal melting curves (Fig. 2C and D). Their Td values were 66 and 63C, respectively (Table 1). These probes could distinguish between the target organisms and the nontarget reference organisms with one or more mismatches by washing at their respective Td values. Figure 3 displays the relative fraction of 16S rRNA extracted directly from microbial populations comprising the toluene (TDC)- and ethylbenzene (EDC)-degrading consortia and the oil-contaminated sediment determined by quantitative membrane hybridization. This analysis revealed that T-1 and E-1 and E-2 were members of the TDC and EDC, respectively. This was consistent with the results of DGGE analysis. The signals of the probes for T-1 were negligible in EDC and those for T-1, E-1, and E-2 were negligible in the oil-contaminated sediment. Since the dissimilatory, gram-negative sulfate-reducing bacteria can be roughly divided into the families Desulfovibrionaceae and Desulfobacteriaceae (18), we used general probes for these groups to encompass most of the gram-negative sulfatereducing bacteria mesophilic group. The signals of probe S-F- Dsv-0687-a-A-16 accounted for 11.1 to 14.4% of total eubacterial 16S rRNA in all samples. However, this probe hybridizes to some species of Geobacteriaceae (20), and the contribution of these types in the samples is unknown. The group hybridizing with probe S- -Dsb-0804-a-A-18 was abundant in all samples, consistent with the previously reported nding that most aromatic compound-degrading bacteria belong to the family Desulfobacteriaceae (42, 47). In TDC, probes S- -Tsrda-0641-a-A-20 and S- -Tsrda-0644a-A-19 (targeting T-1) gave positive signals and accounted for 16.3 and 19.2% of total 16S rRNA, respectively. There were no signicant differences between the results with probes S- Tsrda-0641-a-A-20 and S- -Tsrda-0644-a-A-19 in any of the samples. In EDC, the signal intensity of probe S- -Edn-0656a-A-18 increased markedly from 7.2% on day 30 to 19.0% on day 60. The signal with probe S- -Edsrb-0656-a-A-19 did not change signicantly, from 41.4% to 39.1%, during this period. The Desulfobacter group was not more abundant in EDC than in TDC. McMahon et al. (36) demonstrated the difference caused by the use of in vitro-transcribed and native RNAs for membrane hybridization. They concluded that transcribed RNA could be used to determine Td values because differences were relatively small. They also mentioned that when in vitrotranscribed rRNA was used as a standard for quantitative hybridization, the population was consistently underestimated. The ratio of T-1, E-1, and E-2 to total bacteria might be underestimated because we used transcribed RNA as a stan- VOL. 68, 2002 ANAEROBIC TOLUENE AND ETHYLBENZENE DEGRADERS 3221 TABLE 2. Probe names, number of mismatches, and locations on DNA microarray Probe No. of mismatches T1 E1 E2 Location Column Row S-*-Tsrda-0644-a-A-19 S-*-Tsrda-0641-a-A-20 S-*-Edn-0656-a-A-18 S-*-Edsrb-0656-a-A-19 S-*-Dsb-0804-a-A-18 S-F-Dsv-0687-a-A-16 S-D-Bact-0338-a-A-18 S-D-Bact-0927-a-A-17 S-*-Univ-0907-a-A-22 S-*-Univ-1390-a-A-18 0 0 6 3 0 3 0 0 a 7 6 0 7 3 5 0 0 4 5 6 0 2 3 0 0 1 2 3 4 3 4 3 4 3 4 A A A A B B C C D D a , transcribed rRNA (338 to 927, E. coli numbering) T-1, E-1, and E-2 do not contain the target sites. dard of the populations corresponding to the major DGGE bands. Nevertheless, we demonstrated that the combination of DGGE and quantitative membrane hybridization without isolation could be applied more generally to the quantication of slow-growing environmental populations such as hydrocarbondegrading sulfate-reducing bacteria. It has been estimated that 6 to 10 million barrels of crude oil were released into the coastal area of Kuwait during the 1991 Gulf War (56). Oil-contaminated sediment from the coast of Kuwait was studied as an example of a bioremediating system inhabited by complex microbial communities. Application of membrane hybridization with the above probes to characterize oil-contaminated marine sediments from the coast of Kuwait revealed the presence of hydrocarbon-degrading sulfate-reducing bacteria. This sediment contained more than 1 mg of oil g 1 (wet weight). Forty percent of total bacteria (total 16S rRNA) were detected with the probes used in this study. The E-2 target population, which may degrade ethylbenzene, comprised 4.3% of rRNA extracted from this sediment. The family Desulfobacteriaceae (probe S- -Dsb-0804-a-A-18) accounted for 21.1%. Members of this family are known to degrade the aromatic compounds present in the contaminated sediment. Times series analysis from November 1993 to June 1995 revealed that the asphaltene content decreased from 12 to 2% and the monoaromatic component (containing toluene and ethylbenzene) remained almost constant at 10% during this period (52). These results indicate that the asphaltene component was degraded without accumulation of monoaromatic compounds, suggesting that biodegradation of aromatic compounds was occurring simultaneously. Application of DNA microarrays. Optimal washing conditions for the microarray used in this study were established by rst determining the melting proles of all probe-target duplexes. The design of the DNA microarray and the numbers of mismatches are listed in Table 2. Nontarget RNAs having three or more mismatches were completely dissociated following two washings at room temperature for 1 min. However, the duplex between probes S- -Edsrb-0656-a-A-19 and T-1 was not dissociated under this condition. A single washing temperature of 46C was established based on the melting prole (Fig. 4 and Table 1). The optimal washing time was determined by evaluating dissociation kinetics for a series of washing times (data not shown). In summary, these studies showed that washing for 5 min was sufcient to eliminate nontargets containing three or more mismatches. However, washing for longer than 5 min reduced signal intensities without improvement in specicity. Thus, a washing protocol of 46C for 5 min was used for further experiments. The RNAs transcribed from DGGE fragments hybridized with the complementary probes under the washing condition dened above (Fig. 5). Universal and eubacterial probes gave positive signals for all samples. Since the RNAs of DGGE bands were transcribed from the DNA fragments amplied with the 338f-907r primer pair, probes S- -Univ-1390-a-A-18 and S-D-Bact-0927-a-A-17 did not hybridize for lack of target sequences. In contrast, the failure of probe S-F-Dsv-0687-aA-16 to hybridize is attributed to the lower stability of this short probe under the conditions used in this study (43). The effect of probe length and sequence composition on DNA microarray hybridization is under investigation. This microarray was then used to characterize enrichment and environmental samples (Fig. 6). The in vitro-transcribed RNA was used to increase the sensitivity of analysis for some samples. The hybridization of the TDC sample with native and in vitro-transcribed RNAs showed comparable patterns, although the native RNA (including 23S and 5S rRNA) generated a higher background than in vitro-transcribed RNA (Fig. 6A and B). Since EDC and the oil-contaminated sediment generally did not yield sufcient native RNA to hybridize to the DNA microarray, transcribed RNA was used to amplify the signal. Each yielded characteristic patterns. The equal variance and signicant differences of signal intensities between specic probes and blank were veried by two-tailed F test [F (3, 19; 0.005)] and t test [t (22, 0.01)], respectively. Probes S- -Tsrda-0641-a-A-20 and S- -Tsrda0644-a-A-19 gave positive signals for the TDC sample (P 0.01) (Fig. 6A and B) and probes S- -Edn-0656-a-A-18 and S- -Edsrb-0656-a-A-19 gave positive signals for EDC (P 0.01) (Fig. 6C and D). For the Kuwaiti sediment, only the universal and eubacterial probes gave positive signals (P 0.01) (Fig. 6E). Although the Desulfobacter group (hybridized by probe S- -Dsb-0804-a-A-18) accounted for more than 50% of bacterial 16S rRNA as revealed by membrane hybridization (Fig. 3), the signal was not detected (Fig. 6). Possible reasons for this observation include the low Td value of probe S- -Dsb0804-a-A-18 and the length of the transcribed target RNA used in the enrichment and environmental samples. The Td value of probe S- -Dsb-0804-a-A-18 was the lowest of all the probes used in this study (Table 1). This means a lower afnity between the probe and target RNA. In addition, probe specicity on the DNA microarray was checked by using short fragments (338 to 927, E. coli numbering) (Fig. 5), whereas almost full-length transcribed 16S rRNA (11 to 1512, E. coli numbering) was used to compare with native intact 16S rRNA when we applied the DNA microarray to enrichment and environmental samples (Fig. 6). We suggest that the fragmentation of long transcribed 16S rRNA molecules may have been less efcient than for short fragments and that the target site of probe S- -Dsb-0804-a-A-18 may have been more difcult to fragment than other regions due to its three-dimensional structure. We need further optimization to design good probes for DNA microarray hybridization. 3222 KOIZUMI ET AL. APPL. ENVIRON. MICROBIOL. FIG. 4. DNA microarray temperature-of-dissociation study for transcribed RNA fragments derived from DGGE bands on DNA microarrays. Numbers in parentheses indicate the number of mismatches between probe and target sequences. All elution curves represent the means of four replicate experiments on one chip. Hybridization to RNA containing more than three mismatches could not be detected at the beginning of the melting curve except for the duplex of S- -Edsrb-0656-a-A-19 and T-1. A washing temperature of 46C (vertical line) was used to achieve suitable mismatch discrimination. The unambiguous analysis of natural systems requires an understanding of mismatch discrimination. In particular, single-mismatch discrimination is often difcult to achieve (30, 48, 55, 64). Both probes S- -Tsrda-0644-a-A-19 and S- -Tsrda- 0641-a-A-20 contain one U-G mismatch to D. variabilis located 3 and 6 bases from the 5 end of the probes, respectively (Table 1). Although the target with one mismatch could not be completely eliminated, the melting prole of the one-mismatch FIG. 5. Hybridization of lissamine rhodamine-labeled RNA to DNA microarray. RNAs (338 to 927, E. coli numbering) were transcribed from PCR-amplied 16S rDNA fragments from the DGGE gel, fragmented with magnesium, and labeled with lissamine rhodamine. Probes, their locations, and the number of mismatches between each probe and the RNA are shown in Table 2. The DNA microarray was hybridized to in vitro-transcribed 16S rRNA fragments from bands T-1, E-1, and E-2, shown in panels T-1, E-1, and E-2, respectively. VOL. 68, 2002 ANAEROBIC TOLUENE AND ETHYLBENZENE DEGRADERS 3223 FIG. 6. Results of DNA microarray hybridization with samples of TDC, EDC, and oil-contaminated sediment from the coastal area of Kuwait. Probes, their locations, and the number of mismatches between each probe and the RNA are shown in Table 2. RNA was prepared by in vitro transcription of 16S rDNA fragments (11 to 1512, E. coli numbering) PCR amplied from genomic DNA. Native RNA was also used for one TDC sample. (I) Negative images of hybridization with a DNA microarray and (II) uorescent signal intensities for (A) TDC, (B) TDC (native RNA), (C) 30-day EDC, (D) 60-day EDC, and (E) Kuwaiti sediment. Fluorescence intensities were quantied by using WinView and calculated from four replications of each probe on one chip. SSU, small subunit. 3224 KOIZUMI ET AL. APPL. ENVIRON. MICROBIOL. cation and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59:143169. Bavykin, S. G., J. P. Akowski, V. M. Zakhariev, V. E. Barsky, A. N. Perov, and A. D. Mirzabekov. 2001. Portable system for microbial sample preparation and oligonucleotide microarray analysis. Appl. Environ. Microbiol. 67: 922928. Becker, S., P. Boger, R. Oehlmann, and A. Ernst. 2000. PCR bias in ecological analysis: a case study for quantitative Taq nuclease assays in analyses of microbial communities. Appl. Environ. Microbiol. 66:49454953. Beller, H. R., D. Grbic-Galic, and M. Reinhard. 1992. Microbial degradation of toluene under sulfate-reducing conditions and the inuence of iron on the process. Appl. Environ. Microbiol. 58:786793. Beller, H. R., M. Reinhard, and D. Grbic-Galic. 1992. Metabolic by-products of anaerobic toluene degradation by sulfate-reducing enrichment cultures. Appl. Environ. Microbiol. 58:31923195. Beller, H. R., A. M. Spormann, P. K. Sharma, J. R. Cole, and M. Reinhard. 1996. Isolation and characterization of a novel toluene-degrading, sulfatereducing bacterium. Appl. Environ. Microbiol. 62:11881196. Borneman, J., M. Chrobak, G. Della Vedova, A. Figueroa, and T. Jiang. 2001. Probe selection algorithms with applications in the analysis of microbial communities. Bioinformatics 17(Suppl. 1):S3948. Britton, L. N. 1984. Microbial degradation of aliphatic hydrocarbons, p. 89129. In T. D. Gibson (ed.), Microbial degradation of organic compounds. Marcel Dekker, New York, N.Y. Chee, M., R. Yang, E. Hubbell, A. Berno, X. C. Huang, D. Stern, J. Winkler, D. J. Lockhart, M. S. Morris, and S. P. A. Fodor. 1996. Accessing genetic information with high-density DNA arrays. Science 274:610614. Cho, J. C., and J. M. Tiedje. 2001. Bacterial species determination from DNA-DNA hybridization by by using genome fragments and DNA microarrays. Appl. Environ. Microbiol. 67:36773682. Cline, J. D. 1969. Spectrophotometric determination of hydrogen sulde in natural waters. Limnol. Oceanogr. 14:454458. Cord-Ruwisch, R. 1985. A quick method for the determination of dissolved and precipitated suldes in cultures of sulfate-reducing bacteria. J. Microbiol. Methods 4:3336. Devereux, R., M. Delaney, F. Widdel, and D. A. Stahl. 1989. Natural relationships among sulfate-reducing eubacteria. J. Bacteriol. 171:66896695. Devereux, R., M. D. Kane, J. Winfrey, and D. A. Stahl. 1992. Genus- and group-specic hybridization probes for determinative and environmental studies of sulfate-reducing bacteria. Syst. Appl. Microbiol. 15:601609. Devereux, R., M. R. Winfrey, J. Winfrey, and D. A. Stahl. 1996. Depth prole of sulfate-reducing bacterial ribosomal RNA and mercury methylation in an estuarine sediment. Syst. FEMS Microbiol. Ecol. 20:2331. El-Fantroussi, S. 2000. Enrichment and molecular characterization of a bacterial culture that degrades methoxy-methyl urea herbicides and their aniline derivatives. Appl. Environ. Microbiol. 66:51105115. Farrelly, V., F. A. Rainey, and E. Stackebrandt. 1995. Effect of genome size and rrn gene copy number on PCR amplication of 16S rRNA genes from a mixture of bacterial species. Appl. Environ. Microbiol. 61:27982801. Fry, N. K., J. K. Fredrickson, S. Fishbain, M. Wagner, and D. A. Stahl. 1997. Population structure of microbial communities associated with two deep, anaerobic, alkaline aquifers. Appl. Environ. Microbiol. 63:14981504. Galushko,A., D. Minz, B. Schink, and F. Widdel. 1999. Anaerobic degradation of naphthalene by a pure culture of a novel type of marine sulfatereducing bacterium. Environ. Microbiol. 1:415420. Gibson, D. T., and V. Subramanian. 1984. Microbial degradation of aromatic hydrocarbons, p. 181294. In D. T. Gibson (ed.), Microbial degradation of organic compounds. Marcel Dekker, New York, N.Y. Giovannoni, S. J., T. B. Britschgi, C. L. Moyer, and K. G. Field. 1990. Genetic diversity in Sargasso Sea bacterioplankton. Nature 345:6063. Guschin, D. Y., B. K. Mobarry, D. Proudnikov, D. A. Stahl, B. E. Rittmann, and A. D. Mirzabekov. 1997. Oligonucleotide microchips as genosensors for determinative and environmental studies in microbiology. Appl. Environ. Microbiol. 63:23972402. Harms, G., K. Zengler, R. Rabus, F. Aeckersberg, D. Minz, R. Rossello Mora, and F. Widdel. 1999. Anaerobic oxidation of o-xylene, m-xylene, and homologous alkylbenzenes by new types of sulfate-reducing bacteria. Appl. Environ. Microbiol. 65:9991004. Hobbie, J. E., R. J. Daley, and S. Jasper. 1977. Use of nuclepore lters for counting bacteria by uorescence microscopy. Appl. Environ. Microbiol. 33:12251228. Hristova, K. R., M. Mau, D. Zheng, R. I. Aminov, H. R. Gaskins, and L. Raskin. 2000. Desulfotomaculum genus- and subgenus-specic 16S rRNA hybridization probes for environmental studies. Environ. Microbiol. 2:143 159. Jrgensen, B. B. 198...

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Loyola Chicago - WWW - 1
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, July 2002, p. 32153225 0099-2240/02/$04.00 0 DOI: 10.1128/AEM.68.7.32153225.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved.Vol. 68, No. 7Parallel Characterization of Anaerobic
Loyola Chicago - WWW - 1
Loyola Chicago - WWW - 1
Soil Biology and Biochemistry 31 (1999) 14671470www.elsevier.com/locate/soilbioShort communicationEects of the land application of sewage sludge on soil heavy metal concentrations and soil microbial communitiesJohn J. Kelly a, Max Haggblom b,
Loyola Chicago - WWW - 1
Loyola Chicago - WWW - 1
Academic Program Development: Processes for Review, Approval & Implementation OFFICE OF THE PROVOST September 28, 2004A. Academic Workflow As part of the flow of the academic work of the University, a variety of matters may arise that will require
Loyola Chicago - LAW - 1
NALP Principles & Standards for Law Placement and Recruitment ActivitiesTo promote fair and ethical practices for the interviewing and decision-making process, NALP offers the following standards for the timing of offers and decisions: Full-time Emp
Loyola Chicago - WWW - 1
ALL OF OUR PACKAGES INCLUDE THE FOLLOWING ITEMS:*Personal Wedding Consult Full Service or Day of Depending on Package Four Hours of Open Bar House, Premium, Top Shelf depending on the package Champagne Toast Four or Five Course Dinner Menus Depen
Loyola Chicago - LAW - 1
Loyola University Chicago School of Law Loan Repayment Assistance Program for Law Alumni in Public ServicePROGRAM DESCRIPTION Award Year 2008Loyola University Chicago School of Law is pleased to announce the 2008 Loan Repayment Assistance Program
Loyola Chicago - LAW - 1
Dear Students: You are registered for the Midwest Public Interest Law Career Conference (MPILCC), which will take place on February 7, 2009 at Northwestern University School of Law. Please review the attached spreadsheet to make sure your registratio
Loyola Chicago - LAW - 1
Dear Students: This is a reminder that the deadline to upload a resume and bid on employers for the MPILCC Job Fair is at noon tomorrow, Friday, January 9th. You may go to: https:/law-mpilcccsm.symplicity.com/students to login. Some students have had
Loyola Chicago - LAW - 1
Dear MPILCC Students:This is a reminder that beginning today, Friday, January 23 at noon your interview schedule will be available to view on the MPILCC symplicity website https:/law-mpilcc-csm@symplicity.com under the Profile/Interview/Sche
Loyola Chicago - LAW - 1
The Midwest Public Interest Career Conference will be held at Northwestern Law School on Saturday, February 7, 2009. The conference is a great way to find a public interest job and to find out more about public interest employers. You may participate
Loyola Chicago - LAW - 1
REMINDERS Please make sure to turn in your registration form by April 25th-this is the first step in the process and ensures you receive all emails and updates. Remember to check your email regularly over the summer as that is the primary means of co
Loyola Chicago - LAW - 1
OSCAROnline System for Clerkship Application and Reviewhttp:/oscar.ao.dcn/What Is OSCAR Version 4? Serves as the single, centralized resource for: notice of available federal clerkships clerkship application information (methods of receiptonli
Loyola Chicago - LAW - 1
JUDICIAL CLERKSHIP APPLICATION CALENDAR 2008Date March 25 12-1pm MarchApril Task Attend Overview of Application Process, Rubloff Auditorium Review Judicial Clerkship Handbook (available on website) Select Recommenders (and provide memo to non-facult
Loyola Chicago - LAW - 1
LOYOLA UNIVERSITY CHICAGO SCHOOL OF LAWOffice of Career ServicesReciprocity PolicyThe Office of Career Services has adopted the following reciprocity policy: 1. 2. 3. 4. 5. 6. 7. The Office of Career Services provides reasonable access of resour
Loyola Chicago - LAW - 1
Organization Name American Bar Association (ABA) - Section of Antitrust Law Archdiocese of Chicago - Office of Legal Services Center for Economic Progress Chicago Park District - Law Department City of Chicago Department of Law City of Evanston - Leg
Loyola Chicago - LAW - 1
Careers in Health LawPrepared by the Beazley Institute for Health Law and Policy Loyola University Chicago School of LawFebruary 2007IntroductionCertainly a primary goal of attending law school is to find a rewarding career. By enrolling at Loy
Loyola Chicago - LAW - 1
SECURITIES LAW U.S. & CHICAGO SECURITIES EXCHANGES & REGULATORS Most of these exchanges have a legal department (Office of General Counsel) as well as an Enforcement Department. U.S. Securities & Exchange Commission www.sec.gov Financial Industry Reg
Loyola Chicago - ITS - 1
Backing up your Grade CenterDownloading the Grade Center each time you enter new grades is a good way to maintain a backup of your Grade Center in case Blackboard becomes inaccessible. Excel also offers more complex mathematical functions than Black
Loyola Chicago - ITS - 1
Create Grade Center Items and Manually Enter ScoresAdding an Item to the Gradebook1. Click Control Panel. 2. In the Assessment box, click Grade Center. 3. Click Add Grade Column. Do not choose Add Calculated Column as these types of columns are set
Loyola Chicago - ITS - 1
Unhiding a Grade Center Column1. In the Grade Center, click on Manage.2. Click on the chevron icon from the drop down menu.to the right of Manage and choose Organize Grade Center3. Once in the Organize Grade Center page you will see that the
Loyola Chicago - ITS - 1
Weighting your Grades in the Blackboard 8.0 Grade CenterWeighting grades in Blackboard 8.0 is done through the Weighted Total column using the Modify Column options. In Blackboard 8.0 you can weight by item, by category, or by item and category. Wei
Loyola Chicago - WWW - 1
Zootaxa 1495: 134 (2007) www.mapress.com/zootaxa/ Copyright 2007 Magnolia PressISSN 1175-5326 (print edition)ZOOTAXAISSN 1175-5334 (online edition)Euscelus species of the West Indies (Coleoptera: Attelabidae)ROBERT W. HAMILTONBiology Depar
Loyola Chicago - WWW - 1
Natural Resource ConservationBiology 393 Instructor: Prof. Robert W. Hamilton, LSB 225 Instructor support: Prof. Robert A. Morgan LSB 226 rhamilt@luc.eduProf. MORGAN & HAMILTONGENERAL INFORMATIONThe trip to the tropical rain forest in Costa Ric
Loyola Chicago - WWW - 1
A Step-by-Step Guide to Voting While Abroad If you are a US citizen who will be abroad during the 2008 Presidential Election on Tuesday, November 4, you can and should still vote! Guidelines for voter registration and absentee balloting differ by sta
Loyola Chicago - LAW - 1
NALP General Standards for the Timing of Offers & AcceptancesPART V: GENERAL STANDARDS FOR THE TIMING OF OFFERS AND DECISIONSTo promote fair and ethical practices for the interviewing and decision-making process, NALP offers the following standards
Loyola Chicago - LAW - 1
RESUME COLLECT CHART IN STUDENT DEADLINE ORDER WITH NO RECEIVE BY DATECLASS YEAR/GRAD YEAR2L/2010 2L/2010 2L/2010 & 3L/2009 2L/2010 2L/2010STUDENT DEADLINEEMPLOYERHIRING CRITERIATop 10%, Law Review or Moot Court are required. Spanish speakin
Loyola Chicago - LAW - 1
Letter requesting waiver of criteria for on-campus interview if you are within 5% of the stated criteria.NAMEAddress City, State ZIP Telephone Email address Date Name of contact person Title of contact person Name of firm/organization Street addre
Loyola Chicago - LAW - 1
Letter requesting OCI interview during break/lunch (students who meet employer criteria) YOU MAY USE THIS AFTER INTERVIEW SCHEDULES ARE CREATED AND YOU LEARN YOU DO NOT HAVE AN INTERVIEW WITH A CERTAIN EMPLOYER THIS MAY BE USED TO REQUEST AN INTERVI
Loyola Chicago - LAW - 1
RICHARD A. DEVINE STATE= S ATTORNEY =69 W. Washington, Suite 3200 Chicago, Illinois 60602 (312)603-1880COOK COUNTY STATE=S ATTORNEY=S OFFICE = = THIRD YEAR LAW STUDENT APPLICATION Today=s Date:_ Name:_ School Address :__Permanent Address:__
Loyola Chicago - LAW - 1
NALPJuly 2008Open Letter to Law StudentsAs employer members of NALP, we have developed this letter to give students additional insight into employers perspectives on the recruiting process. We think the following suggestions will help you intervi
Loyola Chicago - LAW - 1
NALP TRAVEL EXPENSE REIMBURSEMENT FORMIt is our policy to reimburse reasonable travel-related expenses which you incur during your interviewing trip. If you have questions about what constitutes a reasonable expense, please call __ for clarification
Loyola Chicago - WWW - 1
2009 CIMA Scholarship ApplicationApplication Deadline: 2/15/09CIMA is Chicago's only interactive-centric professional organization dedicated to the enhancement and acceleration of business opportunities, professional development, and exponential ne
Loyola Chicago - WWW - 1
James Wesley White, Jr. Scholarship Fund Scholarship ApplicationJames Wesley White, Jr. Scholarship Fund Scholarship Application Last Updated 10/2008The James Wesley White, Jr. Scholarship Fund (Fund) was established in 2006 by the family of Jame
Loyola Chicago - ITS - 1
Disabling the Visual Text Box Editor in BlackboardThe Visual Text Box Editor (VTBE) is the WYSIWYG editor that appears when you add a discussion post, an email, or course content. The VTBE gives you access to the editing tools you see in the screen
Loyola Chicago - ITS - 1
Blackboard Discussion BoardThe Discussion Board is a centralized location for all discussion forums. Discussion forums can appear anywhere in the course, but are all listed on the Discussion Board. Groups can have their own private Discussion Boards
Loyola Chicago - LAW - 1
Loyola Chicago - LAW - 1
OFFICE OF THE STATE'S ATTORNEY COOK COUNTY, ILLINOISVOLUNTEER INTERN/CLERK APPLICATIONPlease circle one:LAW STUDENT Fall _UNDERGRAD/GRADUATE STUDENT YEAR: _Date:PARALEGALWhich Semester/year are you applying for:Spring _ Summer __Perso
Loyola Chicago - LAW - 1
ILLINOIS ATTORNEY GENERAL LISA MADIGAN APPLICATION FOR LAW CLERK POSITIONINSTRUCTIONSCurrent law students who would like to serve as law clerks in the office of Illinois Attorney General Lisa Madigan are asked to: 1. 2. 3. 4. Fill out this applica
Loyola Chicago - LAW - 1
LOYOLA UNIVERSITY CHICAGO SCHOOL OF LAW 2008 On-Campus Interviewing InstructionsLoyola University Chicago School of Laws fall interviewing season begins on Monday, August 18, and continues through Friday, October 24, 2008. To participate in on-campu
Loyola Chicago - LAW - 1
NOTICE OF INTENTION TO WITHDRAW Date: Name: Address: Phone: ( ) SS#:When did you begin at Loyola School of Law? (Date) Please list your current courses and faculty: Course Faculty Member* The student named above has notified the Law School of his
Loyola Chicago - LAW - 1
2008 PATENT LAW INTERVIEW PROGRAM PARTICIPATING LAW SCHOOLSAlbany Law School American University Appalachian School of Law Arizona State Univ. School of Law Ave Maria Law School Barry Univ. School of Law Baylor Law School Benjamin Cardozo School of
Loyola Chicago - WWW - 1
History Essay Contest 2006-2007First Prize: Second Prize: Third Prize:Jeffrey E. Kaman, A Wicked Reputation: A Study of Infamous Port Royal Katie D. Vogel, The Glory Days of Garbage Jennifer L. Harned, Moral Exclusion in High School History Textbo
Loyola Chicago - WWW - 1
Dear Graduating Seniors, In honor of your impending graduation, the Faculty of the Department of History invites you to attend a Senior Reception to be held May 4th, 2007 4:00-5:30 p.m. Crown Center Lobby Lake Shore Campus We hope you will be able to
Loyola Chicago - LAW - 1
LOYOLA UNIVERSITY CHICAGO SCHOOL OF LAWOffice of Career ResourcesHow to Write a Resume & Cover LetterThese materials are intended for use by the students of Loyola University Chicago School of Law ONLY. No permission is given or intended for an
Loyola Chicago - LAW - 1
LOYOLA UNIVERSITY CHICAGO SCHOOL OF LAWOffice of Career ServicesInterviewing TipsThese materials are intended for use by the students of Loyola University Chicago School of Law ONLY. No permission is given or intended for any further use of thi
Loyola Chicago - LAW - 1
LOYOLA UNIVERSITY CHICAGO SCHOOL OF LAWOffice of Career ServicesQuestions To Ask During InterviewsThese materials are intended for use by the students of Loyola University Chicago School of Law ONLY. No permission is given or intended for any f
Loyola Chicago - LAW - 1
LOYOLA UNIVERSITY CHICAGO SCHOOL OF LAWOffice of Career ServicesAfter The InterviewThese materials are intended for use by the students of Loyola University Chicago School of Law ONLY. No permission is given or intended for any further use of t
Loyola Chicago - WWW - 1
History Dr. Dennis Study Questions: Orlow 72-94 What were the overall effects of the First World War? What is the Fischer thesis about the origins of the First World War? [Study the diplomatic sequence that led to mobilization.] What was the Schlieff
Loyola Chicago - WWW - 336
History Dr. Dennis Study Questions: Orlow 72-94 What were the overall effects of the First World War? What is the Fischer thesis about the origins of the First World War? [Study the diplomatic sequence that led to mobilization.] What was the Schlieff
Loyola Chicago - WWW - 1
Study Questions: Orlow 95-145To what extent was the German Revolution a result of the war? How great was the threat of "Bolshevik" revolution, so feared by the Extreme Right, in Germany in 1919? After? To what extent did the SPD "sell out" to the "b
Loyola Chicago - WWW - 336
Study Questions: Orlow 95-145To what extent was the German Revolution a result of the war? How great was the threat of "Bolshevik" revolution, so feared by the Extreme Right, in Germany in 1919? After? To what extent did the SPD "sell out" to the "b
Loyola Chicago - LAW - 1
25 East Pearson Street Room 1430 Chicago, IL 60611 Phone: (312) 915-7167SCHOOL OF LAW Office of the RegistrarAPPLICATION FOR VISITING STUDENTS LOYOLA UNIVERSITY CHICAGO SCHOOL OF LAWAPPLICATION FEE: $50.00 Name __ (Last) (First) (Middle) Social
Loyola Chicago - LAW - 1
Hello Judicial Clerkship Applicants: This email confirms that you have turned in your registration form and have been added to the email list serve. I will be sending emails throughout the summer with information on the judicial clerkship application
Loyola Chicago - LAW - 1
Hello Judicial Clerkship Applicants: Please read below for information on: Emails available online for future reference Judiciary Reception at the CBA Excel Spreadsheets and Instructions-new due datesEmails and information available online All h
Loyola Chicago - LAW - 1
Dear Judicial Clerkship Applicants: Our office sent a reminder to all Loyola faculty members that their letters of recommendation are due on July 1st. In order to assist your recommenders in preparing the best letter possible, please remember to prov
Loyola Chicago - LAW - 1
Dear Students: I have received several questions on the following topics: Username and password for Loyola judicial clerkship website: username-student password-loyolaonline Non-Loyola Recommenders If your recommender is an adjunct faculty member or
Loyola Chicago - WWW - 1
Prots.andAmer.FoundingM.Noll,page1TheContingenciesofChristianRepublicanism: AnAlternativeAccountofProtestantismandtheAmericanFounding MarkA.NollMosthistoriansdonotdoaswellwithessentialstatesofaffairsasdoexpertsin politicaltheory.Historiansareus