Documents Found!
As seen in
Less Work, Better Grades
Join
Course Hero
Access
best resources
Ace
your classes
Ace your courses with Course Hero!
|
|
|
Study Smarter, Score Higher
Here are the top 5 related documents
...ETD-db: Item Temporarily Restricted
This item has been taken ofine by Virginia Tech Library or Graduate School. This restriction is temporary, and the item will be automatically made available again shortly. For more information, contact Gail McMilla...
...ETD-db: Item Temporarily Restricted
This item has been taken ofine by Virginia Tech Library or Graduate School. This restriction is temporary, and the item will be automatically made available again shortly. For more information, contact Gail McMilla...
...ETD-db: Item Temporarily Restricted
This item has been taken ofine by Virginia Tech Library or Graduate School. This restriction is temporary, and the item will be automatically made available again shortly. For more information, contact Gail McMilla...
...ETD-db: Item Temporarily Restricted
This item has been taken ofine by Virginia Tech Library or Graduate School. This restriction is temporary, and the item will be automatically made available again shortly. For more information, contact Gail McMilla...
Document Content (unformatted)
Course Hero has millions of student submitted documents similar to the one
below including study guides, homework solutions, papers, exam answer keys and textbook solutions.
4: CHAPTER Ligation independent cloning ABSTRACT: We describe a technique to clone kilobase size fragments of double-stranded DNA from any source into plasmid vectors, as long as the sequence of the insert termini are known. The thermostable DNA polymerase purified from Pyrococcus furiosus is used for this technique. Recombinant plasmids are generated and recovered in E. coli in one day. To demonstrate the utility of this method we cloned genomic fragments encoding chalcone synthase (CHS) and stilbene synthase (STS) from Arabidopsis thaliana and Arachis hypogaea, respectively, into the phagemid pBluescript KS+. This method has been termed ligation-independent cloning (LIC). INTRODUCTION: The shuttling of genes between organisms has been a major goal since the determination that DNA is the molecule of heredity (Hershey and Chase, 1952). Since then a flood of new techniques to clone genes from all cell types has revolutionized how scientists study protein function. Obstacles that prevent the study of scarce proteins are overcome by cloning the gene into, and purifying the protein from, bacteria. Conventional methods of gene cloning into bacteria can be costly and time consuming. This process generally involves the isolation of a double-stranded DNA (dsDNA) fragment encoding the desired sequence. The fragment is then covalently joined with an autonomous self-replicating circular plasmid. Restriction enzymes are typically used to digest the DNA molecules to produce compatible ends and DNA ligase is required to join the fragments together. The DNA must be purified between each successive enzymatic manipulation and this can lead to loss of substrate and may involve many days of work. Here we describe an alternative method to clone dsDNA fragments from most any source as long as the sequence of the insert termini is known. The origins of ligation independent cloning (LIC) stem from the development of the polymerase chain reaction (PCR) (Saiki et al., 1988) and difficulties in cloning PCR products during the stilbene synthase (STS) analysis (CHAPTER 3). Yon (1989) showed that PCR could be used to join two fragments of dsDNA together. This led to the idea that a DNA insert could be joined with a plasmid to create recombinant molecules in vitro. Two limitations to this approach are, however, the size of the products that can be made in vitro and the accuracy of the replicated sequence. These limitations can be overcome by using the thermostable DNA polymerase isolated from Pyrococcus furiosus (Pfu) (Lundberg et al., 1991). This polymerase is capable of amplifying products as large as 5 kb and, unlike Taq DNA polymerase, has 3 to 5 proofreading activity (Barnes, 1994; Cline et al., 1996). We demonstrate the utility of this approach by directly cloning fragments (Figure 1) of the genomic loci encoding CHS and STS from Arabidopsis thaliana and Arachis hypogaea, respectively. 50 MATERIALS and METHODS: Plant Material and Growth Conditions. A. thaliana ecotype Columbia and A. hypogaea cultivar NC7 were used in these studies. Approximately 1000 (25 mg) wild-type A. thaliana seeds and 100 A. hypogaea seeds were stratified on Murashige and Skoog-sucrose medium in the dark at 4 C for four days (Kubasek et al., 1992). Seeds were transferred to soil and germination was induced with constant light at 22 C. Mature plants were grown in soil at 22 C under a 16-hr-light / 8-hr-dark cycle. 3-week-old plant tissue was harvested and stored at -70 C. DNA isolation. A. thaliana genomic DNA was isolated according to Watson and Thompson (1986). These samples were further purified through a CsCl equilibrium centrifugation gradient (Maniatis et al., 1982) and stored in 10 mM tris pH 7.2, 1 mM EDTA at 4 C. A. hypogaea genomic DNA was isolated using a modified citrymethylammonium bromide (CTAB) technique. Ten grams of A. hypogaea tissue was homogenized with 35 ml of extraction buffer (0.1M Tris pH 7.5, 0.5 M EDTA, 20 mM Na-bisulfate, 6.4% sorbitol) and filtered through 2 layers of cheesecloth and 1 layer of miracloth. The filtrate was centrifuged at 1200 x g for 15 min at 4 C. The pellet was resuspended in 5 ml of extraction buffer then 5 ml of nuclei lysis buffer (0.2 M Tris pH 7.5, 0.05 EDTA, 2 M NaCl, 2% CTAB, and 1 ml of 10% sarcosyl were added. The sample was mixed gently and incubated at 60 C for 1 hour, then extracted once with 15 ml of chloroform/IAA (24:1). The aqueous phase was isolated and 1 volume of isopropyl alcohol was used to precipitate high molecular weight DNA. DNA was washed with 70% ethanol to remove salt and stored at 4 C. Vector preparation. One microgram of pBluescript KS(+) (Stratagene, La Jolla) was linearized by digestion with EcoRV (Promega, Madison) at 37 C for 4 hours. Linear dsDNA was purified away from proteins and buffer components using Promega Wizard PCR-preps columns (Promega, Madison) according to the manufacture s instructions and eluted in ddH2O to a final concentration of 0.5 g/ml. PCR reactions. Reactions containing 1 M of each primer, 0.2 mM dNTPs, 1.5 mM MgCl2, 1 X buffering salts, and 2.5 units of Pfu DNA polymerase (Stratagene) were used to amplify the CHS or STS locus from 100 ng of A. thaliana or A. hypogaea genomic DNA, respectively. The two CHS primary PCRs contained the following primer combinations: reaction #1, pBSKas13 + a8; reaction #2, s13 + pBSK a8. The two STS primary PCRs contained the following primer combinations: reaction #1, G107a + C98a; reaction #2, G107a + C98a . Samples were initially denatured at 94 C for 90 s, then cycled at 94 C (90 s), 55 C (90 s), 72 C (180 s) for 35 rounds. Ten microliter aliquots of these reactions were examined by agarose gel electrophoresis and ethidium bromide staining. Remaining amounts of primary products were purified from unincorporated primers and nucleotides using the Wizard PCR preps columns and eluted in 50 l distilled water. One microliter of each purified primary product was mixed with 10 ng of EcoRV-digested pBluescript vector (Stratagene) in the presence of 1 M of each appropriate secondary primers, 0.2 mM dNTPs, 1 X buffering salts, and 2.5 units of Pfu DNA polymerase. Template/primer combinations for the secondary CHS PCRs were: reaction A, template #1 and pBSK + a8; reaction B, template #2 and s13 + pBSKa. Template/primer combinations for the secondary STS PCRs are: template #1 and pBSK + C98a; reaction B, template #2 and pBSKa + G107a Samples were denatured at 94 C for 4 min, annealed at 60 C (for CHS reactions) or 52 C (for STS reactions) for 4 min, and extended at 72 C for 4 min. This step was repeated once to ensure the 51 creation of the chimeric fusion template. Samples were cycled at 94 C (75 s), 52 C (120 s), 72 C (5 min) for 33 rounds. Samples were extended with a final incubation at 72 C for 4 min. Secondary products were purified from unincorporated primers and nucleotides using Wizard PCR preps columns and eluted in 50 l distilled water. Twenty microliters of complementary purified chimeric fusions were mixed together and denatured at 94 C for 5 min., allowed to re-anneal at 60 C for 4 hours, then stored at 4 C. Three microliters of this product were used to transform E. coli JM109 by electroporation (Smith et al., 1990). Transformants were selected on 100 g/ml ampicillin and recombinant plasmids were screened with isopropyl-B-Dthiogalactopyranoside (IPTG) and (X-gal) (Maniatis et al., 1982). Sequences of all primers are shown in table I. 52 PCR colony screen. To confirm that transformed plasmids were recombinant, a single E. coli colony was suspended in 10 mM Tris pH 9.8 and 0.1% Triton X-100, boiled for 5 min, allowed to cool to room temperature, then centrifuged at 16,000 X g for 3 min. Three microliters of the supernatant of this sample was used as template in a PCR containing 1 M T3 and T7 primer each, 0.2 mM dNTPs, 1.5 mM MgCl2, 1 X buffering salts, and 2.5 units Taq DNA polymerase (Promega) in a total volume of 30 l. Samples were denatured at 94 C for 45 s, then incubated at 94 C (70 s), 46 C (70 s), 72 C (180 s) for 40 cycles. Samples were stored at 4 C. Ten microliters of these samples were analyzed by agarose gel electrophoresis and ethidium bromide staining (Maniatis et al., 1982). Plasmid analysis: Plasmid DNA for restriction digest and sequence analysis was isolated from E. coli clones using a modification of the alkaline lysis miniprep (Birnboim and Doly, 1979) in which the initial precipitate was pelleted at 50,000 rpm in a TLA-100 ultracentrifuge (Beckman, Palo Alto, CA). One l of plasmid DNA was digested with EcoRI and HindIII at 37 C for 2 hours and then restriction products were analyzed by agarose gel electrophoresis and ethidium bromide staining (Maniatis et al., 1982). Sequencing of recombinant plasmids using T3 and T7 primers was performed as described previously (Shirley et al., 1992). 53 RESULTS: LIC works by using chimeric primers to fuse vector sequences to a desired DNA insert during an initial primary (1 ) PCR reaction (Figure 1). This product then serves as a primer to fuse the insert DNA to the cloning vector in a secondary (2 ) PCR reaction that amplifies the chimeric fusion of insert and plasmid species. These products are denatured and allowed to hybridize together. Combinatorial hybridization between chimeric fusions produces recombinant nicked circular plasmids that can be recovered by transformation of E. coli. The total process requires two PCR reactions, two DNA purifications, and transformation of E. coli. Recombinant plasmids can thus be obtained in one day. Cloning the A. thaliana genomic CHS locus. To demonstrate the feasibility of LIC we initially chose to clone a fragment of the CHS locus from A. thaliana genomic DNA (Figure 2). Amplification of the CHS insert was verified by agarose gel electrophoresis (Figure 3). This product was then used to synthesize the chimeric fusions with pBluescript KS(+) by PCR (Figure 3). The products of this reaction were denatured and allowed to anneal in order to create recombinant nicked circular plasmids capable of being replicated in E. coli. These samples were used to transform E. coli JM109. One thousand transformants were obtained per microliter of renatured chimeric DNA fusion. A transformation efficiency of 108 cfu/ g supercoiled pBluescript was obtained with JM109 under these conditions. Greater than 98% of these ampicillin-resistant colonies displayed a negative phenotype in a blue/white screen for b-galactosidase activity. To determine if recombinant transformants actually contained the desired fragment of the A. thaliana genomic CHS locus, eleven random white clones were screened by PCR using plasmidspecific primers. One blue clone was included as a negative control. All eleven white clones produced the expected 874 bp product consistent with the presence of the CHS fragment (Figure 4). The one blue clone produced a 164 bp product consistent with a non-recombinant pBluescript plasmid. Clones containing multiple inserts were not observed. The clones were further characterized by sequencing plasmid DNA with T3 and T7 primers. No errors in the sequence of the CHS clone or the insert/vector junctions were observed. The insert was in the correct orientation as predicted by primer design. Cloning the A. hypogaea STS genomic locus. The same technique was used to clone a fragment of the STS genomic locus from A. hypogaea. Although the specific primers used were different from those used for A. thaliana CHS, the vector and strategy were identical (Figure Five 5). white transformants were screened by PCR with vector-specific primers (Figure 6). The products amplified from all five clones were consistent with the presence of a recombinant plasmid containing an insert the size of the published A. hypogaea STS fragment. To confirm these results plasmid DNA was isolated from three of these clones and digested with EcoRI and HindIII. Fragments consistent with the published A. hypogaea genomic STS sequence were obtained in these reactions as well (figure 6). Sequencing of the three purified plasmids confirmed the identity of the cloned fragment as the desired A. hypogaea STS fragment containing no detectable errors due to amplification. The orientation of these clones was also as predicted by primer design. 54 DISCUSSION: The results of this study indicate that the LIC method can be used successfully to clone fragments of the A. thaliana CHS and A. hypogaea STS loci into the pBluescript KS(+) phagemid vector. Similar results for both cloning events were obtained, about 2000 total recombinant colonies were recovered of both CHS and STS clones. PCR screening for clones of CHS determined that all nine recombinant clones examined in this experiment contained the CHS insert. Similar results were obtained for five STS clones. This suggests that the LIC technique is extremely efficient. Sequence analysis verified the correct orientation of the clones as originally designed as well as the fidelity of sequence amplification. These results were consistent with previous studies that showed Pfu DNA polymerase amplifies template DNA with minimal misincorporation of nucleotides (Barnes, 1994). Because this method worked with two completely different sets of primers to clone two unrelated genes, this method should be useful for cloning any DNA using genomic DNA as the starting material. Although LIC and conventional cloning methods recover recombinant plasmids in E. coli, the construction of recombinant vectors in vitro is quite different. Only one enzyme is used to manipulate the DNA during LIC. This reduces the opportunity for loss of material due to nuclease contamination. Moreover, minute quantities of DNA may be cloned directly because the method amplifies the target sequences. Importantly, LIC does not rely on the presence of compatible restriction sites in the insert and vector. Therefore, any fragment of DNA that can be amplified using PCR may, in theory, be cloned in this fashion. Introduction of point mutations during the amplification steps could prevent obtaining useful clones. Proteins expressed from cloned genes containing mutations could have undesired and artifactual properties. In this case it is essential to amplify inserts using a polymerase with proofreading ability. The size of the 1 PCR products and the sequence of CHS locus clone were as predicted. These results indicate that Pfu is capable of amplifying templates under 5 kb with high fidelity. 98% of all the clones contained an insert and of those examined all were in the specified orientation. Moreover, no concatemers were detected which indicates that amplification of artifact PCR products by Pfu was minimal. There appears to be a limit, however, to the size of constructs that can be made by Pfu DNA polymerase. When attempting to insert CHS and CHI cDNAs into two yeast two-hybrid vectors, pPC62 and pPC86 (Chevray and Nathans, 1992), the 2 products, which were no less than 7 kb in size, could not be amplified under conditions used to clone CHS and STS (data not shown). This may be simply due to the inherent limit on the ability of Pfu to amplify templates longer than 7 kb, stalling at misincorporated nucleotides (Barnes, 1992; Lawyer et al., 1993). A combination of Pfu and an N-terminally truncated variant of Taq polymerase, however, has been used to amplify products as large as 35 kb from l bacteriophage templates (Barnes, 1994). The more processive form presumably does most of the bulk synthesis while the 3 to 5 exonuclease activity of the native form repairs misincorporated bases. Other methods to use PCR to construct recombinant vectors in vitro have been proposed. One technique exploits the 3 to 5 exonuclease activity of T4 DNA polymerase to create singlestranded termini on both the insert and vector (Charalampos and de Jong, 1990). In this method, insert and vector are annealed via complementary termini and then transformed into E. coli. Although, like LIC, this method does not require DNA ligase, it does require several enzymatic manipulations in order to generate complementary ends. Another technique described by Shuldiner (1990) used chimeric primers to synthesize fusions between vector and insert during PCR in a similar manner to the method outlined here. 55 REFERENCES: Barnes, W.M. (1992) The fidelity of Taq polymerase catalyzing PCR is improved by an Nterminal deletion. Gene, 112, 29-35. Barnes, W.M. (1994) PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates. Proc. Natl. Acad. Sci. USA, 91, 2216-2220. Birnboim, H.C., and Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res., 7, 1513-1523. Charalampos, A., and de Jong, P.J. (1990) Ligation-independent cloning of PCR products (LIC-PCR). Nuc. Acids Res., 18, 6069-6074. Chevray, P.M., and Nathans, D. (1992) Protein interaction cloning in yeast: Identification of mammalian proteins that react with the leuzine zipper of Jun. Proc. Natl. Acad. Sci. USA, 89, 5789-5793. Cline, J., Braman, J.C., and Hogrefe, H.H. (1996) PCR fidelity of Pfu DNA polymerase and other thermostable DNA polymerases. Nucleic Acids Res., 24, 3546-3551. Hershey, A.D., and Chase, M. (1952) Independent functions of viral proteins and nucleic acid in growth of bacteriophage. J. Gen. Physiol., 36, 39-56. Kubasek, W.L., Shirley, B.W., Mckillop, A., Goodman, H.M., Briggs, W., and Ausubel, F.M. (1992) Regulation of flavonoid biosynthetic genes in germinating Arabidopsis seedlings. Plant Cell, 4, 1229-1236. Lawyer, F.C., Stoffel, S., Saiki, R.K., Chang, S.-Y., Landre, P.A., Abramson, R.D., and Gelfand, D.H. (1993) PCR methods and applications, 2, 275-287. Lundberg, K.S., Shoemaker, D.D., Adams, M.W., Short, J.M., Sorge, J.A., and Mathur, E.J. (1991) High-fidelity amplification using a thermostable DNA polymerase isolated from Pyrococcus furiosus. Gene, 108, 1-6. Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor: Cold Spring Harbor Laboratory. Saiki, R.K., Gelfand, G.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B., and Erhlich, H.A. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science, 239, 487-494. Shirley, B.W., Hanley, S., and Goodman, H.M. (1992) Effects of ionizing radiation on a plant genome: analysis of two Arabidopsis transparent testa mutations. Plant Cell, 4, 333-347. Shuldiner, A.R., Scott, L.A., and Roth, J. (1990) PCR-induced (ligase-free) subcloning: a rapid reliable method to subclone polymerase chain reaction (PCR) products. Nuc. Acids Res., 18, 1920. Smith, M., Jessee, J., Landers, T., and Jordan, J. (1990) High efficiency bacterial electroporation: 1 x 1010 E. coli transformants/ g. Focus, 12, 38-40. Watson, J.C., and Thompson, W.F. (1986) Purification and restriction endonuclease analysis of plant nuclear DNA. Methods Enzymol., 118, 57-75. Yon, J., and Fried, M. (1989) Precise gene fusion by PCR. Nucleic Acids Res., 17, 4895. 56 Table I: Primers used for LIC cloning of A. thaliana CHS and A. hypogaea STS. Sequences of primers complementary to pBluescript KS(+) are indicated in bold. s13 a8 pBSKas13 pBSK a8 G107a C98a G107a C98a pBSK pBSKa T7 T3 ccaaatacacctaacttgtt tccgaccccacaatgag ccgggctgcaggaattcgatccaaatacacctaacttgtt cgacggtatcgataagcttgattccgaccccacaatgag ggtggcactgtccttcg gagaccagggccaaaac ggctgcaggaattcgatggtggcactgtccttcg cggtatcgataagcttgatgagaccagggccaaaac atcaagcttatcgataccg atcgaattcctgcagcc taatacgactcactataggg taaccctcactaaaggga 57 Click on figure TITLE to link to figure: Figure 1. Schematic of the ligation independent cloning (LIC) procedure. Two complementary PCRs are performed in parallel. Products that include sequences complementary to the vector are synthesized during a primary PCR amplification. These products serve as primers to form a chimeric fusion between amplified insert and vector. Fusions are amplified using secondary primers during another round of PCR. When chimeric fusions of parallel reactions are mixed, denatured, and annealed, hybridization forms nicked, circular, recombinant plasmids. 58 Figure 2. Diagram of the CHS and STS genomic loci. In each case the fragment to be cloned is indicated by the bar. The entire box represents the transcribed region. The black box indicates the 5' untranslated region. The gray box represents intron sequences. The asterisk indicates the conserved active site cysteine in these enzymes. Arrows indicate the annealing sites for the 1 primers. A. Diagram of the A. thaliana CHS locus. B. Diagram of the A. hypogaea STS locus. 59 Figure 3. Cloning of the CHS genomic fragment. A. Agarose gel analysis of primary CHS PCR products. Ten microliters of each parallel primary PCR (lanes 1 and 2) was fractionated on a 1% agarose gel and DNA visualized with ethidium bromide staining. 100 ng of A. thaliana genomic DNA was used as template with nonchimeric primers as a positive control (G). A negative control, containing no DNA template, is also shown (lane NT). B. Agarose gel analysis of chimeric fusion secondary products. Ten microliters of each parallel secondary PCR (A and B) was fractionated on a 1% agarose gel and DNA visualized with ethidium bromide staining. Specific nonchimeric primers were used to amplify the pBluescript vector as a size control indicated in lane P (plasmid). Notice that the chimeric fusion products are larger in size than the linear plasmid. 60 Figure 4. Colony PCR screen for recombinant CHS clones. Eleven white (lanes 1 - 11) and one blue (lane B) colony were screened for the presence of recombinant plasmids by PCR using T3 and T7 primers. Ten microliters of each PCR were fractionated in a 1% agarose gel and DNA was visualized by ethidium bromide staining. 61 Figure 5. Cloning of the STS genomic fragment. A. Agarose gel analysis of primary STS PCR products. Ten microliters of each parallel primary PCR (lanes 1 and 2) was fractionated on a 1% agarose gel and DNA visualized with ethidium bromide staining. One hundred nanograms of A. hypogaea genomic DNA was used as template with nonchimeric primers as a positive control (G). B. Agarose gel analysis of chimeric fusion secondary products. Ten microliters of each parallel secondary PCR (A and B) was fractionated on a 1% agarose gel and DNA visualized with ethidium bromide staining. Specific nonchimeric primers were used to amplify the pBluescript phagemid vector (P) as a size and amplification control. 62 Figure 6. Colony PCR and restriction analysis of STS clones from A. hypogaea. A. Five white transformants were screened for the presence of recombinant plasmids by PCR using T7 and T3 primers. Ten microliters of each PCR (lanes 1 - 5)were fractionated on a 1% agarose gel and DNA was visualized by ethidium bromide staining. B. Restriction digest analysis of recombinant plasmids. Ten microliters of restriction digest (lanes A, B, and C) were fractionated on a 1% agarose gel and DNA was visualized by ethidium bromide staining. 63
Find millions of documents here - Study Guides, Homework Solutions, Papers, Exam Answer Keys and more.
Course Hero has millions of course related materials that will enable you to learn better,
faster and get an A in all your courses.
Below is a small sample set of documents:
Below is a small sample set of documents:
Virginia Tech >> LIB >> 012299 (Fall, 2008)
CHAPTER 5: A null mutation in the first enzyme of flavonoid biosynthesis does not affect male fertility in Arabidopsis* Published in Plant Cell (1996), 8, 1013-1025. ABSTRACT: Flavonoids are a major class of secondary metabolites that serve a multitu...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
CHAPTER 6: Arabidopsis thaliana flavonoid biosynthetic enzymes form a complex.* * to be submitted for publication in Proc. Natl. Acad Sci. ABSTRACT: Flavonoids are secondary metabolites derived from phenylalanine and acetate metabolism that perform a...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
A B d c b b a a c d ...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
CONCLUSIONS: Intracellular enzymes catalyze thousands of chemical reactions simultaneously in the densely-crowded environment of the cytosol. Assembly of enzymes into complexes is thought to play a significant role in normal cellular physiology but h...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
A C C B N N C N N C C ...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
IAN E. BURBULIS Virginia Tech Department of Biology 2119 Derring Hall Blacksburg, VA 24061 Phone: (540)231-9375 email: harley@vt.edu EDUCATION: PH.D. Candidate in Molecular and Cellular Biology. Virginia Tech, Blacksburg, VA. 1/95present. QCA=3.85 B....
Virginia Tech >> LIB >> 012299 (Fall, 2008)
DEDICATION: This work is dedicated to GOD and all those who believed in me, you know who you are. This work was inspired in part by the creative environment that is Virginia Tech. On that note, I strive to live up to the motto UT PROSIM. iii ...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
anti-sera: fraction: CHS anti-CHI pre-immune T U P U P CHI F3H ...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
A N Y X B Y Z C C Z X ...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
1 2 3 45 6 Size (bp) 1500 600 CHS insert 100 78 9 10 11 B CHS insert no insert 1500 600 100 ...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
A 1500 1 2 34 5 STS insert 600 100 A B C B 1500 600 100 ...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
1 2 3 4 Size (kb) 23 4.6 2.0 0.5 ...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
- 2 me Time(hrs) T0 1 4 7 S 1 +2 me 4 7 T H OH me CHI 242 ...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
A Size (bp) 1 2 G NT 1500 CHS primary product 600 400 100 B Size (kb) A B P 4.6 2.0 CHS secondary product 0.5 ...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
A. hypogaea A 1 A. thaliana CHS 2 1 2 1 2 1.5 kb 1.0 0.6 0.1 B Template Primary products internal primers A. hypogaea A. thaliana CHS 1 a 2 b c 1 a 2 b c 1 a 2 b c 1.5 kb 0.6 0.1 ...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
Size (bp) 1500 1 2 G 600 STS primary product 100 Size (kb) A B P 4.6 2.0 STS secondary product 0.5 ...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
H B 1 RH R H 1888 A -1975 73 1344 B E H B Size (kb) 23.0 9.4 6.5 4.6 2.2 2.0 0.5 ...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
pPC62 bait constructs : CHS CHI DFR CHS CHS CHS pPC86 prey constructs : DFR CHI DFR CHI DFR CHI CHS CHS DFR CHI DFR CHI ...
Virginia Tech >> LIB >> 012299 (Fall, 2008)
MACROMOLECULAR ORGANIZATION OF FLAVONOID BIOSYNTHESIS IN ARABIDOPSIS THALIANA. by Ian Eric Burbulis Dissertation submitted to the faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the de...
Virginia Tech >> LIB >> 09112001 (Fall, 2008)
Identification and Quantification of Video Display Workstation Set Up on Risk Factors Associated with the Development of Low Back and Neck Discomfort Jennifer R. Stanfield Thesis submitted to the Faculty of the Virginia Polytechnic Institute and Sta...
Virginia Tech >> LIB >> 02072003 (Fall, 2008)
Bayesian Methodology for Missing Data, Model Selection and Hierarchical Spatial Models with Application to Ecological Data Edward L. Boone Dissertation submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial f...
Virginia Tech >> LIB >> 1156928297 (Fall, 2008)
1 Chapter 1.0, INTRODUCTION This thesis involves research investigations which have included two different areas of polymer science. The first has been concerned with the synthesis and characterization of high performance poly(arylene ether)s, which...
Virginia Tech >> LIB >> 1156928297 (Fall, 2008)
Synthesis and Characterization of Phosphorus Containing Poly(arylene ether)s Daniel J. Riley Dissertation Submitted to the Faculty of theVirginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree o...
Virginia Tech >> LIB >> 04202005 (Fall, 2008)
Time-Compressed Professionalization: The Experience of Public School Sign Language Interpreters in Mountain-Plains States Laurie A. Bolster A dissertation submitted to the faculty of the Virginia Polytechnic and State University in partial fulfillm...
Virginia Tech >> LIB >> 12012001 (Fall, 2008)
GAS TRANSPORT PROPERTIES IN POLYCARBONATE - INFLUENCE OF THE COOLING RATE, PHYSICAL AGING, AND ORIENTATION by Christelle M. Laot Dissertation submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillment...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
CRYSTALLIZATION, MORPHOLOGY, THERMAL STABILITY AND ADHESIVE PROPERTIES OF NOVEL HIGH PERFORMANCE SEMICRYSTALLINE POLYIMIDES by Varun Ratta Dissertation submitted to the Faculty of Virginia Polytechnic Institute and State University in partial fulfill...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
CRYSTALLIZATION, MORPHOLOGY, THERMAL STABILITY AND ADHESIVE PROPERTIES OF NOVEL HIGH PERFORMANCE SEMICRYSTALLINE POLYIMIDES by Varun Ratta Chairman: Garth L. Wilkes Department of Chemical Engineering Abstract It was the objective of this research t...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
DEDICATION To my parents Reva and D.B. Ratta without whose sacrifices none of this would be possible iv ...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
ACKNOWLEDGEMENTS I am going to cherish my experiences at Virginia Tech for a long time to come. Indeed, this university, along with providing a first class education, has given me several opportunities for both academic and personal growth. In this ...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
Table of Contents ABSTRACT ACKNOWLEDGEMENTS TABLE OF CONTENTS LIST OF FIGURES LIST OF TABLES INTRODUCTION CHAPTER 1 .1 POLYIMIDES: CHEMISTRY & STRUCTURE-PROPERTY RELATIONSHIPS LITERATURE REVIEW 1.1 1.2 1.2. Introduction . 3 Two step method for...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
LIST OF FIGURES Figure 1.1 Figure 1.2 Figure 1.3 Figure 1.4 Reaction scheme for the preparation of Kapton polyimide (ref 2) .4 Generalized reaction mechanism of imide formation (ref 2).5 Idealized charge transfer complex formation in dianhydrides (re...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
Introduction The last twenty-five years of this century have seen a flurry of activity in the synthesis and development of high performance and high temperature polymers. This has been in large part due to need for advanced materials required for a ...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
Chapter 1 POLYIMIDES: chemistry & structure-property relationships literature review 1.1 Introduction Polyimides are a class of thermally stable polymers that are often based on stiff aromatic backbones. The chemistry of polyimides is in itself a v...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
Chapter 2 Polymer Crystallization Literature review 2.1 Introduction While it is not possible to cover the subject of polymer crystallization in a review of this size, it is important in light of authors research to review the fundamental features ...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
Chapter 3 Semi-Flexible Semicrystalline Polyimides- Literature Review 3.1 Introduction The prime objective of this research is to develop and characterize high temperature and high performance thermoplastic semicrystalline polyimides. Although stron...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
Chapter 4 Polyimides as Adhesives: -Literature review 4.1 Introduction Much like the subject of polymer crystallization, the field of adhesion is vast and thus it is impossible to even remotely cover the area in a review of this size. The material ...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
Chapter 5 A Melt Processable Semicrystalline Polyimide Structural Adhesive based on 1,3-bis (4-aminophenoxy) benzene and 3,3, 4,4-biphenyltetracarboxylic dianhydride. Abstract: Introducing crystallinity in polyimides offers the advantage of increas...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
Chapter 6 Thermal Stability, Crystallization Kinetics and Morphology of a New Semicrystalline Polyimide based on 1,3-bis (4aminophenoxy) benzene (TPER) and 3,3, 4,4biphenyltetracarboxylic dianhydride (BPDA). Abstract This work investigates the cryst...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
Chapter 7 Wedge and Double Cantilever Beam Tests on a High Temperature Melt Processable Polyimide Adhesive, TPERBPDA-PA 7.1 Introduction This work focuses on with the wedge and double cantilever beam tests on a novel high temperature polyimide that...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
CHAPTER 8 Crystallization and Multiple Melting Behavior of a New Semicrystalline Polyimide based on 1,3-bis (4-aminophenoxy) benzene (TPER) and 3,3, 4,4-benzophenonetetracarboxylic dianhydride (BTDA) Abstract This study addresses the crystallizati...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
Chapter 9 Summary and Recommendations for Future Work 9.1 Summary The essence of this research work is well encapsulated by the title of this work, namely, Crystallization, Morphology, Thermal Stability and Adhesive Properties of Novel High Perfor...
Virginia Tech >> LIB >> 051799 (Fall, 2008)
VITA Varun Ratta was born to Reva and D.B. Ratta on March 15, 1972 in New Delhi, India. Raised up in New Delhi, he completed all his schooling at Salwan Public School, Rajindar Nagar. Subsequent to this, he joined Indian Institute of Technology, Khar...
Virginia Tech >> LIB >> 07082008 (Fall, 2008)
FAMILY GROWTH RESPONSE TO FISHMEAL AND PLANT-BASED DIETS SHOWS GENOTYPE X DIET INTERACTION IN RAINBOW TROUT (O CORHY CHUS MYKISS) Lindsey Renea Pierce Thesis submitted to the Graduate Faculty of the Virginia Polytechnic Institute and State Universi...
Virginia Tech >> LIB >> 012899 (Fall, 2008)
INVESTIGATION OF THE EFFECTS OF FEEDBACK AND GOAL-SETTING ON KNOWLEDGE WORK PERFORMANCE IN THE DISTRIBUTED WORK ENVIRONMENT by Kriengkrai Tankoonsombut Dissertation submitted to the Faculty of the Virginia Polytechnic Institute and State University ...
Virginia Tech >> LIB >> 03132007 (Fall, 2008)
A Study of Landscape Architecture Design Methods Christopher James Lidy Thesis submitted to the faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of Master of Landscape Archit...
Virginia Tech >> LIB >> 5398 (Fall, 2008)
Depositional Environments and Sequence Stratigraphy of Upper Mississippian Strata in the Central Appalachian Basin Daniel J. Miller Dissertation submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillme...
Virginia Tech >> LIB >> 5398 (Fall, 2008)
INTRODUCTION This dissertation is comprised of three chapters that independently present and discuss the sedimentological/ stratigraphic features within Upper Mississippian strata of southern West Virginia. Chapter 1 presents an interpretation of the...
Virginia Tech >> LIB >> 05252001 (Fall, 2008)
An Evaluation of a Jail-Based Public Inebriate Intervention and Treatment Program By Danielle Yvonne McDonald Thesis submitted to the Faculty of Virginia Polytechnic Institute and State University In partial fulfillment of the requirements for the ...
Virginia Tech >> LIB >> 1338146597 (Fall, 2008)
CHARACTERIZATION AND MOLECULAR ANALYSIS OF FRAGILYSIN: THE BACTEROIDES FRAGILIS TOXIN Richard Joseph Obiso, Jr. Dissertation submitted to the graduate faculty of the Virginia Polytechnic Institute and State Universityin partial fulfillment of the r...
Virginia Tech >> LIB >> 08062001 (Fall, 2008)
ASSESSMENT OF MURINE EMBRYO DEVELOPMENT FOLLOWING ELECTROPORATION AND MICROINJECTION OF A GREEN FLUORESCENT PROTEIN DNA CONSTRUCT by Carolyn A. Schmotzer Thesis Submitted to the faculty of the Virginia Polytechnic Institute and State University in p...
Virginia Tech >> LIB >> 07252001 (Fall, 2008)
STATISTICAL MODELING OF SIMULATION ERRORS AND THEIR REDUCTION VIA RESPONSE SURFACE TECHNIQUES By Hongman Kim A DISSERTATION SUBMITTED TO THE FACULTY OF THE VIRGINIA POLYTECHNIC INSTITUTE AND STATE UNIVERSITY IN PARTIAL FULFILLMENT OF THE REQUIREMENT...
Virginia Tech >> LIB >> 06142005 (Fall, 2008)
Hear Dem Cryin Rastafari and Framing Processes in Reggae Music Ed Skopal Virginia Polytechnic Institute and State University Master of Science Department of Sociology M.S. Thesis Committee Dr. Terry Kershaw (Chair) Dr. Dale Wimberley Dr. Betty Fine...
Virginia Tech >> LIB >> 06142005 (Fall, 2008)
Hear Dem Cryin Rastafari and Framing Processes in Reggae Music Ed Skopal Abstract In social science, reality is too frequently conceived of from the point of view of European or American white men. I intend to examine the perceived realities and worl...
Virginia Tech >> LIB >> 06142005 (Fall, 2008)
I. STATEMENT OF RESEARCH PROBLEM The purpose of this study is to analyze how reggae music serves certain social movement functions for the Rastafarian movement. I intend to explore the relationship between reggae music and the Rasta movement. In part...
Virginia Tech >> LIB >> 12312002 (Fall, 2008)
Modeling Dynamic Ground Reaction to Predict Motion of and Loads on Stranded Ships in Waves Jeffrey McQuillan A thesis submitted to the faculty of Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the ...
Virginia Tech >> LIB >> 41298 (Fall, 2008)
IDENTIFICATION OF TOPICS TAUGHT IN PROFESSIONAL COURSES FOR AGRICULTURAL TEACHER EDUCATION by Robin Claire McLean Thesis submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements fo...
Virginia Tech >> LIB >> 04282005 (Fall, 2008)
ETD-db: Item Temporarily Restricted This item has been taken ofine by Virginia Tech Library or Graduate School. This restriction is temporary, and the item will be automatically made available again shortly. For more information, contact Gail McMilla...
Virginia Tech >> LIB >> 061899 (Fall, 2008)
Second Order Nonlinear Optics in Ionically Self-Assembled Thin Films by Charles C. Figura Dissertation submitted to the Faculty of Virginia Polytechnic Institute and State University In partial fulfillment of the requirements for the degree of DOCT...
Virginia Tech >> LIB >> 061899 (Fall, 2008)
Chapter One: An Introduction to Nonlinear Optics, Second Order Nonlinear Applications, and Nonlinear Materials This thesis presents an investigation into a novel organic polymer nanoscale film deposition technique, detailing its potential for produ...
Virginia Tech >> LIB >> 061899 (Fall, 2008)
Chapter Two: Ionic Self-Assembled Monolayer (ISAM) Deposition 2.1 ISAM Film Deposition Process Ionic Self-Assembled Monolayer films, or ISAM films, are formed by depositing alternately charged layers of polyelectrolyte onto a substrate. These pol...
Virginia Tech >> LIB >> 061899 (Fall, 2008)
Chapter Three: Second Order Nonlinear Optics in ISAM Films The primary goal of this study is to investigate the second-order nonlinear optical properties of ISAM films. This is achieved through measurements of second-harmonic generation. These meas...
Virginia Tech >> LIB >> 061899 (Fall, 2008)
Chapter Four: Enhancements for Second-Order Nonlinear Susceptibility in ISAM Films The excellent design characteristics associated with ISAM films, the ease of fabrication, and the remarkable thermal stability/recovery of the second order nonlinear...
Virginia Tech >> LIB >> 10062000 (Fall, 2008)
Agronomic and Nitrate Leaching Impacts of Pelletized versus Granular Urea by Sanjay B. Shah Dissertation submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of...
Virginia Tech >> LIB >> 051499 (Fall, 2008)
A CROSS-CULTURAL COMPARISON OF FACTORS RELATED TO HELP-SEEKING ATTITUDES FOR PSYCHOLOGICAL DISORDER by Michiyo Hirai Thesis submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements...
Virginia Tech >> LIB >> 04032003 (Fall, 2008)
ETD-db: Item Temporarily Restricted This item has been taken ofine by Virginia Tech Library or Graduate School. This restriction is temporary, and the item will be automatically made available again shortly. For more information, contact Gail McMilla...
Virginia Tech >> LIB >> 081999 (Fall, 2008)
Chapter VI Functionalization of Dendrimers with Crown Ethers VI.1 Introduction P. J. Flory first introduced the concept of highly branched-chain, threedimensional macromolecules (known today as \"dendrimers\") in the early 1940s.1-4 He demonstrated, by...
Virginia Tech >> LIB >> 11092008 (Fall, 2008)
A Case Study of the Dimensions of Affordability of Undergraduate Education in Virginia Jennifer Marie Ortgies Thesis submitted to the faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for th...
Virginia Tech >> LIB >> 03022006 (Fall, 2008)
Topical Antimicrobial and Bandaging Effects on Equine Distal Limb Wound Healing Douglass B. Berry, II, DVM Thesis submitted to the Faulty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the d...
Virginia Tech >> LIB >> 08242006 (Fall, 2008)
Modeling Dierential Charging of Composite Spacecraft Bodies Using the Coliseum Framework Alexander Barrie Thesis submitted to the faculty of the Virginia Polytechnic Institute and State University in partial fulllment of the requirements for the deg...
What are you waiting for?