Course Hero - We put you ahead of the curve!
You have requested the below document.
Sign up now to view this document for free!
- Title: f10
- Type: Notes
- School: Virginia Tech
- Course: LIB 1513132149
- Term: Fall
Coursehero >> Virginia >> Virginia Tech >> LIB 1513132149
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Path: Virginia Tech >> LIB >> 02182000 Fall, 2008
Path: Virginia Tech >> LIB >> 112399 Fall, 2008
Path: Virginia Tech >> LIB >> 112399 Fall, 2008
Path: Virginia Tech >> LIB >> 112399 Fall, 2008
Path: Virginia Tech >> LIB >> 112399 Fall, 2008
Path: Virginia Tech >> LIB >> 112399 Fall, 2008
Path: Virginia Tech >> LIB >> 112399 Fall, 2008
Path: Virginia Tech >> LIB >> 112399 Fall, 2008
Path: Virginia Tech >> LIB >> 112399 Fall, 2008
Path: Virginia Tech >> LIB >> 112399 Fall, 2008
Path: Virginia Tech >> LIB >> 112399 Fall, 2008
Path: Virginia Tech >> LIB >> 112399 Fall, 2008
Path: Virginia Tech >> LIB >> 112399 Fall, 2008
Path: Virginia Tech >> LIB >> 112399 Fall, 2008
Course Hero has millions of student submitted documents similar to the one below including study guides, homework solutions, papers, and exam answer keys.
2 1 3 4 5 6 7 26S rRNA 17S rRNA Figure 10. Denaturing gel electrophoresis of total RNA from six different developmental stages. Four micrograms of total RNA purified from different developmental time points was used in each lane. The developmental time were: points lanes 1 and 2: 0 hr ; lane 3: 4 hr; lane 4: 8 hr; lane 5: 12 hr; lane 6: 16 hr; lane 7: 20 hr. Lane 1: the total RNA was purified from non-plated cells; lanes 2 to 7: the total RNA was purified from plated cells. [previous figure][next figure]
Find millions of documents here - Study Guides, Homework Solutions, Papers, Exam Answer Keys and more.
Course Hero has millions of course related materials that will enable you to learn better, faster and get an A in all your courses.
Below is a small sample set of documents:
f11.pdf
Path: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 4 5 6 7 1,500 bp 800 bp 600 bp Figure 11. Touchdown PCR with degenerate primers for the DdRPA1 gene. Genomic DNA was the template. Lanes 1 to 3: 81-1 (sense) <-> 81-2c (antisense) degenerate primers; lanes 4 to 6: 81-2 (sense) <-> 81-1...
f12.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: BamH I digestion 1 2 3,900 bp vector 6,223 bp 3,472 bp 600 bp insert EcoR I digestion 3 4 linearized plasmid 800 bp 200 bp insert 200 bp Figure 12. Restriction enzyme digestion of the cloned DdRPA1 touchdown PCR fragment. Lane 1: Sty I DNA stan...
f13.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: A CGT A C G T 84-2 EcoR I 84-1c EcoR I T7 M13 vector 84-2 84-1c Figure 13. DNA sequencing of the PCR fragment for the DdRPA1 gene. 84-2 (sense) and 84-1c (antisense) were the degenerate primers for the touchdown PCR reaction. T7 and M13 revers...
f14.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: DNA sequence: translation: peptide sequence: degenerate primer 81-1c : AGC GTT GAG CTA ATG GGT AAA ACC GGT GAC GA S V E V M G K T G DD VMG K TGDD TAC CCA TTT TGA CCA CTA CT TTC TGG CTG TGT 800 bp touchdown PCR fragment 81-2 81-1c DNA sequence: tra...
f15.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: insert 600 bp EcoR I (2) <-> EcoR I (3) EcoR I (3) EcoR I (2) M13 reverse primer towards N-terminal insert 200 bp EcoR I (1) <-> EcoR I (2) pXW1 T7 primer vector 2,900 bp EcoR I (1) Figure 15. Map of the cloned touchdown PCR fragment for the ...
f16.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 4 5 6 7 800 bp Figure 16. Test of the EcoR I partial genomic DNA library for the presence of the DdRPA1 genes by using PCR. The templates were: lane 1: genomic DNA; lane 2: EcoR I partial library tube 1, 2, and 3; lane 3: EcoR I partial...
f17.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 6223 bp 3472 bp 1882 bp 925 bp linearized plasmid vector: pBluescript II 2 kb insert 1 kb insert Figure 17. Restriction enzyme digestion of plasmid DNA from EcoR I partial library for the N-terminal region of the DdRPA1 gene. Lane 1: Lambd...
f18.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: Restriction enzyme digestion 1 23 4 567 Southern analysis 2 34 567 undigested plasmid 4254 bp 2.9 kb vector pBluescript II 2322 bp 2 kb insert 1 kb insert Figure 18. Restriction enzyme digestion and Southern analysis of plasmids that were select...
f19.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: EcoR I (1) insert 1,000 bp EcoR I (1) <-> EcoR I (2) EcoR I (2) vector 2,900bp Towards N-terminal pXW3 insert 2,000 bp EcoR I (2) <-> EcoR I (3) EcoR I (3) Figure 19. Map of the positive plasmid obtained from the EcoR I partial genomic library fo...
f2.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: Position of Deletion TAAAAATGGA ACCCACT 7A (-927) 1-11 (-387) 1-9 (-366) 11 (-258) 22 (-231) 10 (-198) 32 (-163) 23 (-97) 29 (-74) 27 (-69) 2-7 (+41) 2A (+113) 2A PLUS (- 198 to -40) Luciferase Activity LUC LUC LUC LUC LUC LUC LUC LUC LUC LUC LUC LU...
f20.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: Plasmid selected from EcoR I partial genomic DNA library 800 bp touchdown PCR fragment ACGT vector sequence ACG T PCR fragment sequence EcoR I site GAATTC same sequence of 62 kDa (81 kDa) gene EcoR I EcoR I PCR fragment plasmid vector EcoR I...
f21.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 4 5 6 7 8 9 6.5 kb 3.6 kb 2 kb Figure 21. Genomic DNA Southern analysis of the DdRPA1 gene. Genomic DNA was digested by: lane 1: BamH I; lane 2: Cla I; lane 3: EcoR I; lane 4: Hind III; lane 5: Kpn I; lane 6: Not I; lane 7: Pst I; la...
f22.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: Digest genomic DNA with Hind III Hind III N-terminal EcoR I Hind III unknown sequence clr2 known sequence uva3 clr4 clr1 Self-ligation Hind III clr1 clr1 clr4 clr2 uva3 uva3 clr4 Inverse PCR The inverse PCR fragment between clr4 and uva3 was ...
f23.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 2690 bp 2250 bp 1882 bp Figure 23. Inverse PCR for the C-terminal region of the DdRPA1 gene. Lane 1: Lambda sty I DNA standard; lane 2 and 3: inverse PCR with clr4 (sense) <-> uva3 (antisense) primers. [previous figure][next figure] ...
f24.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 4 2250 bp 2690 bp 1882 bp 200 bp 421 bp Figure 24. Nested PCR confirmation of inverse PCR fragment. Lane 1: nested PCR with clr4 (sense) <-> clr2 (antisense) primers, inverse PCR fragment was the template; lane 2: positive control PCR r...
f25.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: undigested plasmid DNA linearized form of plasmid DNA supercoiled form of plasmid DNA Figure 25. Southern analysis of the cloned inverse PCR product for the C-terminal region of the DdRPA1 gene. clr1 (sense) <-> clr2 (antisense) PCR fragment was t...
f26.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 2850 bp 3472 bp 2690 bp Figure 26. Inverse PCR with clr1 and Uva3 primers for the C-terminal region of the DdRPA1 gene. Lane 1: Lambda Sty I DNA standard; lane 2: inverse PCR with primers clr1 (sense) <-> uva3 (antisense). [previous figure][n...
f27.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 4 relaxed form of plasmid DNA linearized form of plasmid DNA 23130 bp 6557 bp supercoiled form of plasmid DNA 2.9 kb vector, pBluescript II 2.25 kb insert, inverse PCR fragment 2322 bp 2027 bp Figure 27. Restriction enzyme digestion of ...
f28.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 4 5 6 7 600 bp Figure 28. Enrichment PCR predicts an intron in the C-terminal region of the DdRPA1gene. Genomic DNA was the template. Lane 1: 100 bp DNA ladder standard; lanes 2 to 4: clr1 (sense) <-> polyT primer (antisense); lane 5 to...
f29.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 800 bp 600 bp 750 bp 300 bp 350 bp Figure 29. Enrichment PCR with clr10 and oligo(dT) primers predicts of an intron in the C-terminal region of the DdRPA1 gene. Genomic DNA was the template. Lane 1: 100 bp DNA ladder standard; lane 2: PC...
f3.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 4 5 6 7 8 6223 bp 2322 bp Genomic DNA 564 bp RNA Figure 3. RNase A digestion of purified genomic DNA. Ten micrograms genomic DNA was used in each lane. The RNase A used in each sample was 100 ng, 500 ng, 1g, 5 g, 10g and 20g, lanes 3...
f30.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: Hind III EcoR I Uva2 genomic DNA Uva3 clr1 clr3 clr9 clr10 X3 clr2 Hind III M13 reverse primer intron cloned plasmid DNA clone site: Hind III The use of the primers: clr3 <-> clr2: PCR assay of the fractions of Hind III digested genomic DNA fragm...
f31.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: A 23 6,500 bp B 4 1 234 3,600 bp 2,900 bp 2,000 bp 7,743 bp 6,223 bp 3,472 bp 2,690 bp 1,882 bp 1,489 bp 712 bp 925 bp Figure 31. Southern analysis for construction of genomic sub-library. A: Southern analysis of genomic DNA. B: Agarose gel el...
f32.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 12 3 4 6,223 bp 4,254 bp 3,472 bp 2,690 bp fraction I fraction II fraction III fraction IV fraction V fraction VI fragment sizes from 3 kb to 4 kb were separated to 6 fractions Figure 32. Agarose gel purification of fractions of genomic DNA Hin...
f33.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 4 5 6 * 7 8 9 600 bp 600 bp Figure 33. PCR assay of fractions of genomic DNA fragments from Hind III digestion . Lane 1: 100bp DNA ladder standard. The PCR templates were: lane 2: water; lane 3:Hind III fragments fraction I; lane 4:H...
f34.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: * 15 rows 15 columns total 225 colonies Figure 34. The arrangement of the colonies for screening of the Hind III genomic DNA sub-library #83 was the positive colony pXW6. [previous figure][next figure] ...
f35.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 234 56 *8 7 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 vector vector 3,472 bp 2,690 bp 1,882 bp 1,489 bp 3,472 bp 2,690 bp 1,882 bp 1,489 bp Figure 35. Plasmid mixtures purified from the Hind III genomic DNA sub-li...
f36.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: * 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 800 bp 600 bp Figure 36. PCR screening of the Hind III genomic DNA sub-library for the C-terminal region of the DdRPA1 gene. Lane 1: 100 bp DNA ladder st...
f37.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: postive colony 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 vector 2900 bp 3,472 bp 2,690 bp 1,882 bp 1,489 bp 925 bp 712 bp Figure 37. Restriction enzyme digestion screening of the Hind III genomic DNA sub-library. Lanes 1, 4, 7, 10 and 13: undigested...
f38.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 1,500 bp 600 bp 2 3 4 5 6 7 8 9 800 bp 600 bp Figure 38. PCR confirmation of the positive plasmid with clr1, clr3 and clr2 primers for the C-terminal region of the DdRPA1 gene. Lane 1: 100 bp DNA ladder standard. The primer pairs were: la...
f39.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: uva2 genomic DNA uva3 plasmid DNA 1 2 345 600 bp 360 bp 300 bp Figure 39. PCR confirmation of the positive plasmid with uva2 and uva3 primers for the C-terminal region of the DdRPA1 gene. The templates were: lane 1: water (negative control); l...
f4.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 123 4 5 6 78 9 10 11 12 13 925 bp 800 bp 400 bp 421 bp Figure 4. Test for the presence of some known genes in the purified genomic DNA. The DNA templates were: lanes 2, 5, 8 and 11: 500 ng previously purified genomic DNA; lanes 3, 6, 9 and 1...
f40.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2,500 bp 2,400 bp 2 3 4 5 6 7 2,690 bp 1,882 bp Figure 40. PCR confirmation of the positive plasmid with clr9, clr10 and M13 reverse primers for the C-terminal region of the DdRPA1 gene. The templates were: lane 1 or 4: undiluted plasmid DNA...
f41.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 4 5 6 3,472 bp 2,690 bp 1,882 bp 1,489 bp 925 bp linearized plasmid 3,600 bp 2,900 bp 712 bp Figure 41. Restriction enzyme digestion of the positive plasmid containing the C-terminal region of the DdRPA1 gene. Lane 1: Lambda Sty I DNA ...
f42.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: insert 2,900 bp EcoR I (1) <-> Hind III (2) EcoR I (1) towards N-terminal insert 712 bp Hind III (1) <-> EcoR I (1) pXW6 M13 reverse primer T7 primer Hind III (2) EcoR I (2) Hind III (1) vector 2,900 bp Figure 42. Map of the positive plasmid con...
f43.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: A CGT C-terminal sequence of DdRPA1 underlined sequence shows the presence of an intron GGGAATATGCCNATNGTATGAGTTTGAAATTATCCGATGGTGATGATGCAATCAGTGT TGAGGTAATGGGTAAAACTGGTGATANATTATTTGGTAAAAGCGCTGCAGAA ACGT TTATATCAAATGAATCAAGAACAAATCAATGAAATCTTTAAC...
f44.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: NNGGNTNAATTTCCCAAANANTGGTTTTTTAAAAAAATTTNAAAAAAAAAAATTTTTNNTTTTTTTTTTTNAAAAAAATTTTGGGNTTCCCTTTTAAGGGGGGGGGNNGGGGNNAATTTCNNNNNNNNNNNNNNNNNGGG GNNNAAACAGGGNNTAAATTAAATTTATTTTAAAGGNAATTGGNAAGGGGNGCNAAANGNTTTAAAAAGGGAGGCCAATCCTTTNAATTTTTTTTNNNAAGAAATTAGN...
f45.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: A transcriptional start site 1 2 3 4 5 6 1 2 3 4 5 6 B transcriptional start site A T ATAAAGGG Figure 45. Identification of the transcription start site of the gene encoding the DdRPA1 by primer extension. A. uva4 was the primer. The ...
f46.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: Hind III 1 23 7 8 9 10 EcoR I 4 5 612 13 11 14 15 N C intron ATG translationstart site T transcription start site PCR fragment, used as probe obtained from Hind III genomic DNA sub-library obtained from EcoR I partial library promoter known ...
f48.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 4 5 4.40 kb 2.37 kb 1.35 kb 2.6 kb Figure 48. Northern analysis of the DdRPA1 mRNA. Lane 1: RNA ladder standard; lane 2: 5 micrograms of total RNA from undifferentiated cells; lane 3: 10 micrograms of total RNA from undifferentiated cell...
f49.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 4 5 6 7 Figure 49. Northern Analysis of the expression level of the DdRPA1 mRNA during development. Four micrograms of total RNA purified from different developmental time points were used in each lane. The developmental time points were...
f5.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 4 5 6 7 8 9 10 11 23130 bp 6557 bp 2322 bp 2027 bp 7743 bp 3472 bp 2690 bp 1882 bp 1489 bp 925 bp Figure 5. Restriction enzyme digestion of genomic DNA. Lane 1: Lambda Sty I DNA standard; Ten micrograms of newly purified genomic DNA...
f50.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 4 5 6 7 Figure 50. Standard for the Northern analysis of the DdRPA1 (Northern blot analysis of actin8 mRNA) Four micrograms of total RNA purified from different developmental time points were used in each lane. The developmental time poi...
f51.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: Time after inititiation of development (h) 0 0 (not plated) (plated) 4 8 12 16 20 gene DdRPA1 DdRPA1 DdActin8 DdActin8 Intensity ratio intensity ratio 1428.98 0.81 1277.12 0.87 0.93 DdRPA1 mRNA expression level 1502.18 0.85 1262.58 0.86 0.99 1e 543....
f52.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 1,500 bp 600 bp 2 3 4 5 6 7 8 9 260 bp Figure 52. PCR with degenerate primers for the DdRPA2 gene. The PCR template was the genomic DNA. Lane 1: 100 bp DNA ladder. The degenerate primer pairs were: lane 2: 35-1 (sense) <-> 35-3c (antisens...
f53.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 3.9 kb vector 2 600 bp 280bp insert 300 bp Figure 53. Restriction enzyme digestion of the cloned DdRPA2 PCR fragment. Lane 1: EcoR I digestion of cloned 35 kDa PCR fragment; lane 2: 100 bp DNA ladder standard. [previous figure][next figure] ...
f54.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: AC G T A C G T 35-2c EcoR I 35-3 EcoR I T7 M13 35-3 vector vector 35-2c Figure 54. DNA sequencing of a PCR fragment for the DdRPA2 gene. 35-3 (sense) and35-2c (antisense) were the degenerate primers for the PCR reaction. T7 and M13 reverse pri...
f55.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: Bcc I Asp16H I BspG I Bsr I Tsp509 I Mse I Tru9 I Tsp509 I Tsp509 I Mse I Tru9 I Apo I Tsp509 I NgoB I Cje I\' HgiE II Bse59 I BstE II Mae III Esp16 I Cje I Alw26 I BsmA I Esp3 I FmuI Dsa VI Acc I Csp6 I BscH I Rsa I Mme I Hph I Nla IV Cvi...
f56.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: reverse complementary DNA sequence:ATT CAA GGT translation: I Q G peptide sequence: degenerate primer 35-2c: TAC CTC GTC TCC TAC Y LV LV SY SY I QG Y CAA GGU UAU UUA GUU UCA UAU UAC CUC GUC UCU UAC CUU GUA UCC UUG 261 bp PCR fragment 35-3 clr5...
f57.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 4 upper rRNA lower rRNA 1.25 kb Figure 57. Northern analysis of DdRPA2 mRNA. Lane 1: 5 micrograms of total RNA from undifferentiated cells; lane 2: ten micrograms of total RNA from undifferentiated cells; lane 3: five micrograms of total ...
f58.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 4 5 6 7 8 9 5 kb 1150 bp Figure 58. Southern analysis of genomic DNA for the DdRPA2 gene. Genomic DNA was digested by: lane 1: Acc I; lane 2: BamH I; lane 3: Cla I; lane 4: EcoR I; lane 5: Hind III; lane 6: Kpn I; lane 7: Pst I; lane ...
f6.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: A 260 1. 2. 2.0020 1.1098 A 280 0.9490 0.5479 A 260/ A 280 2.11 2.03 conc. vol. amount 1.6 mg/ml 0.89 mg/ml 2 ml 1 ml 3.2 mg 0.89 mg Figure 6. Determination of the concentration and purity of purified total RNA. 1: total RNA purified from undiffe...
f7.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 9.49 kb 7,46 kb 4.40 kb 2.37 kb 26S rRNA 17S rRNA 1.35 kb Figure 7. Denaturing-agarose gel electrophoresis of total RNA. Lane 1, RNA standard; lane 2, total RNA purified from differentiated cells; lane 3, total RNA purified from undiffere...
f8.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: 1 2 3 580 bp 450 bp 600 bp 500 bp 400 bp Figure 8. Test for genomic DNA contamination of the total RNA by reverse transcriptase PCR of the gp2 gene. The PCR templates were: lane 1: genomic DNA; lane 2: the total RNA. The primer pair was GP2-5 (s...
f9.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: developmental A 260 time points A 280 conc. g/L 0.8 1.47 4.81 1.1 0.53 0.11 0.042 vol. purity mL A 260/A 280 0.25 0.06 0.1 0.1 0.15 0.2 2 2 2 2 2 1.9 1.9 standard 0 hr 4 hr 8 hr 12 hr 16 hr 20 hr 0.0290 0.0525 0.1717 0.0392 0.0189 0.0039 0.0015 ...
thesis0520.pdfPath: Virginia Tech >> LIB >> 1513132149 Fall, 2008
Description: Cloning and Characterization of Replication Protein A from Dictyostelium discoideum. Xiao Wen Thesis submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of M...
Dewing_Dissertation2.pdfPath: Virginia Tech >> LIB >> 02182000 Fall, 2008
Description: PERCEPTION OF COLOR QUALITY FOR NATURAL IMAGES VIEWED, EDITED, AND PRINTED WITHIN THE CONTEXT OF A HOME DIGITAL COLOR IMAGING SYSTEM Wende L. Dewing Dissertation submitted to the faculty of Virginia Polytechnic Institute and State University in par...
01title.pdfPath: Virginia Tech >> LIB >> 112399 Fall, 2008
Description: STRUCTURE AND PROPERTIES RELATIONSHIPS OF DENSIFIED WOOD Elena V. Kultikova Thesis submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE i...
02ch1.pdfPath: Virginia Tech >> LIB >> 112399 Fall, 2008
Description: CHAPTER 1 Project Description 1.1 INTRODUCTION Wood is widely used as a material for many structures, furniture, tools, decorative objects, and composites. The continual utilization of the virgin forests has reduced the available supply of large clea...
03ch2.pdfPath: Virginia Tech >> LIB >> 112399 Fall, 2008
Description: CHAPTER 2 Literature Review 2.1 DENSIFIED WOOD 2.1.1 Background Wood with inadequate mechanical properties can be modified by various combinations of compressive, thermal and chemical treatments. It can be densified by impregnating its void volume wi...
04ch3.pdfPath: Virginia Tech >> LIB >> 112399 Fall, 2008
Description: CHAPTER 3 Effect of Densification on Tensile Strength and Stiffness Parallel to the Grain 3.1 INTRODUCTION Wood exhibits its highest strength in tension parallel to the grain. Tensile strength parallel to the grain of small clear specimens is approxi...
05ch4.pdfPath: Virginia Tech >> LIB >> 112399 Fall, 2008
Description: CHAPTER 4 Effect of Densification on the Cellular Structure of Wood 4.1 INTRODUCTION During densification, the cellular structure of wood is permanently changed, which results in a material with new properties. One of the major factors influencing me...
06ch5.pdfPath: Virginia Tech >> LIB >> 112399 Fall, 2008
Description: CHAPTER 5 Effect of Densification on Chemical Composition of Wood 5.1 INTRODUCTION It was shown in many studies that the combination of high temperature and steam pressure, used during preparation of densified wood, may cause changes in chemical comp...
07ch6.pdfPath: Virginia Tech >> LIB >> 112399 Fall, 2008
Description: CHAPTER 6 Summary The results of the tensile tests showed that ultimate tensile stress and tensile modulus increased significantly after all densification treatments at both 25 and 50 % strain levels. There was no significant thermal degradation dete...
08appab.pdfPath: Virginia Tech >> LIB >> 112399 Fall, 2008
Description: APPENDIX A Calculations of the Pump Pressure 1. Cylinder with effective area of 4.43 in2 Pressure on the samples: 2500 psi (17236.9 kN/m2) Area (3 samples 27 x 120 mm): 3.19 in x 4.72 in = 15.066 in2 (9720 mm2) Force on the press: 2500 lb/in2 x 15.06...
09appC1.pdfPath: Virginia Tech >> LIB >> 112399 Fall, 2008
Description: APPENDIX C Images of Undensified and Densified Wood Specimens 84 Figure C1. SEM micrograph of juvenile yellow-poplar (control). Figure C2. SEM micrograph of juvenile yellow-poplar (control). 85 Figure C3. SEM micrograph of compressed juvenile ye...
10appC2.pdfPath: Virginia Tech >> LIB >> 112399 Fall, 2008
Description: Figure C27. SEM micrograph of uncompressed mature yellow-poplar (4mm), TRT1. Figure C28. SEM micrograph of uncompressed mature yellow-poplar (4mm), TRT1. 98 Figure C29. SEM micrograph of compressed mature yellow-poplar (4mm), TRT1. Figure C30. SE...
11appC3.pdfPath: Virginia Tech >> LIB >> 112399 Fall, 2008
Description: Figure C53. SEM micrograph of compressed mature yellow-poplar (4mm), TRT3, showing multiple fractures in the cell walls. Figure C54. SEM micrograph of compressed mature yellow-poplar (4mm), TRT3. 111 Figure C55. SEM micrograph of uncompressed matu...
12appC4.pdfPath: Virginia Tech >> LIB >> 112399 Fall, 2008
Description: Figure C79. SEM micrograph of compressed mature southern pine, TRT1. Figure C80. SEM micrograph of compressed mature southern pine, TRT1. 124 Figure C81. SEM micrograph of compressed mature southern pine, TRT1, showing multiple fractures in earlyw...
13vita.pdfPath: Virginia Tech >> LIB >> 112399 Fall, 2008
Description: VITA Elena Vasilyevna Kultikova was born on October 24, 1972 in Kotlas, Arkhangelsk region, Russia. She graduated from Kotlas high school # 18 in 1990. She studied at Vyatka State Technical University in Kirov, Russia and obtained a Diploma of Engine...