Documents Found!
As seen in
Less Work, Better Grades
Join
Course Hero
Access
best resources
Ace
your classes
Ace your courses with Course Hero!
|
|
|
Study Smarter, Score Higher
Here are the top 5 related documents
...Issued
By The
UNITED STATES GOLF ASSOCIATION GREEN SECTION
ROOM 307, SOUTH BUILDING PUNT INDUSTRY STATION BELTSVILLE, MD.
TIMELY FAIRWAY RENOVATION PROGRAMS PAY DIVIDENDS FIELD DAYS: Pennsylvania Experiment Station will have its Field Day at State...
...An effort should be made to keep all of a golf course's greens consistent and firm enough to force the player to put spin on the ball. 1979 U.S. Amateur Public Links Champion Dennis Walsh in his semi-final match with Jodie Mudd at the West Delta golf...
...What a Club Expects.
of"1ts Superintendent
by ALLEN E. GROGAN, Green Committee Chairman, Baltusrol Golf Club, Springfield, N.J. he golf course superintendent is the most important person on the staff of a golf c1u He b. is in charge of the only asset...
...Designing Irrigation Systems for Golf Courses
By DONALD A. HOGAN, Irrigation Engineer
this of Inattempt first paper madetheto day, an will be discuss some general aspects of golf course irrigation systems. Many points will be elaborated on in papers...
Document Content (unformatted)
Course Hero has millions of student submitted documents similar to the one
below including study guides, homework solutions, papers, exam answer keys and textbook solutions.
1 2 3 4 5 6 7 8 6223 bp 2322 bp genomic dna 564 bp RNA Figure 3. RNase A digestion of purified genomic dna . Ten micrograms genomic dna was used in each lane. The RNase A used in each sample was 100 ng, 500 ng, 1 g, 5 g, 10 g and 20 g, lanes 3 to 8, respectively. Lane 1: Lambda sty I DNA standard; lane 2: genomic dna without RNase A digestion; lanes 3 to 8: one hour RNase A digestion of genomic dna . [previous figure][next figure]
Find millions of documents here - Study Guides, Homework Solutions, Papers, Exam Answer Keys and more.
Course Hero has millions of course related materials that will enable you to learn better,
faster and get an A in all your courses.
Below is a small sample set of documents:
Below is a small sample set of documents:
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
Hind III EcoR I Uva2 genomic DNA Uva3 clr1 clr3 clr9 clr10 X3 clr2 Hind III M13 reverse primer intron cloned plasmid DNA clone site: Hind III The use of the primers: clr3 <-> clr2: PCR assay of the fractions of Hind III digested genomic DNA fragm...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
A 23 6,500 bp B 4 1 234 3,600 bp 2,900 bp 2,000 bp 7,743 bp 6,223 bp 3,472 bp 2,690 bp 1,882 bp 1,489 bp 712 bp 925 bp Figure 31. Southern analysis for construction of genomic sub-library. A: Southern analysis of genomic DNA. B: Agarose gel el...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
12 3 4 6,223 bp 4,254 bp 3,472 bp 2,690 bp fraction I fraction II fraction III fraction IV fraction V fraction VI fragment sizes from 3 kb to 4 kb were separated to 6 fractions Figure 32. Agarose gel purification of fractions of genomic DNA Hin...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
1 2 3 4 5 6 * 7 8 9 600 bp 600 bp Figure 33. PCR assay of fractions of genomic DNA fragments from Hind III digestion . Lane 1: 100bp DNA ladder standard. The PCR templates were: lane 2: water; lane 3:Hind III fragments fraction I; lane 4:H...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
* 15 rows 15 columns total 225 colonies Figure 34. The arrangement of the colonies for screening of the Hind III genomic DNA sub-library #83 was the positive colony pXW6. [previous figure][next figure] ...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
1 234 56 *8 7 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 vector vector 3,472 bp 2,690 bp 1,882 bp 1,489 bp 3,472 bp 2,690 bp 1,882 bp 1,489 bp Figure 35. Plasmid mixtures purified from the Hind III genomic DNA sub-li...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
* 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 800 bp 600 bp Figure 36. PCR screening of the Hind III genomic DNA sub-library for the C-terminal region of the DdRPA1 gene. Lane 1: 100 bp DNA ladder st...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
postive colony 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 vector 2900 bp 3,472 bp 2,690 bp 1,882 bp 1,489 bp 925 bp 712 bp Figure 37. Restriction enzyme digestion screening of the Hind III genomic DNA sub-library. Lanes 1, 4, 7, 10 and 13: undigested...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
1 1,500 bp 600 bp 2 3 4 5 6 7 8 9 800 bp 600 bp Figure 38. PCR confirmation of the positive plasmid with clr1, clr3 and clr2 primers for the C-terminal region of the DdRPA1 gene. Lane 1: 100 bp DNA ladder standard. The primer pairs were: la...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
uva2 genomic DNA uva3 plasmid DNA 1 2 345 600 bp 360 bp 300 bp Figure 39. PCR confirmation of the positive plasmid with uva2 and uva3 primers for the C-terminal region of the DdRPA1 gene. The templates were: lane 1: water (negative control); l...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
123 4 5 6 78 9 10 11 12 13 925 bp 800 bp 400 bp 421 bp Figure 4. Test for the presence of some known genes in the purified genomic DNA. The DNA templates were: lanes 2, 5, 8 and 11: 500 ng previously purified genomic DNA; lanes 3, 6, 9 and 1...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
1 2,500 bp 2,400 bp 2 3 4 5 6 7 2,690 bp 1,882 bp Figure 40. PCR confirmation of the positive plasmid with clr9, clr10 and M13 reverse primers for the C-terminal region of the DdRPA1 gene. The templates were: lane 1 or 4: undiluted plasmid DNA...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
1 2 3 4 5 6 3,472 bp 2,690 bp 1,882 bp 1,489 bp 925 bp linearized plasmid 3,600 bp 2,900 bp 712 bp Figure 41. Restriction enzyme digestion of the positive plasmid containing the C-terminal region of the DdRPA1 gene. Lane 1: Lambda Sty I DNA ...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
insert 2,900 bp EcoR I (1) <-> Hind III (2) EcoR I (1) towards N-terminal insert 712 bp Hind III (1) <-> EcoR I (1) pXW6 M13 reverse primer T7 primer Hind III (2) EcoR I (2) Hind III (1) vector 2,900 bp Figure 42. Map of the positive plasmid con...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
A CGT C-terminal sequence of DdRPA1 underlined sequence shows the presence of an intron GGGAATATGCCNATNGTATGAGTTTGAAATTATCCGATGGTGATGATGCAATCAGTGT TGAGGTAATGGGTAAAACTGGTGATANATTATTTGGTAAAAGCGCTGCAGAA ACGT TTATATCAAATGAATCAAGAACAAATCAATGAAATCTTTAAC...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
NNGGNTNAATTTCCCAAANANTGGTTTTTTAAAAAAATTTNAAAAAAAAAAATTTTTNNTTTTTTTTTTTNAAAAAAATTTTGGGNTTCCCTTTTAAGGGGGGGGGNNGGGGNNAATTTCNNNNNNNNNNNNNNNNNGGG GNNNAAACAGGGNNTAAATTAAATTTATTTTAAAGGNAATTGGNAAGGGGNGCNAAANGNTTTAAAAAGGGAGGCCAATCCTTTNAATTTTTTTTNNNAAGAAATTAGN...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
A transcriptional start site 1 2 3 4 5 6 1 2 3 4 5 6 B transcriptional start site A T ATAAAGGG Figure 45. Identification of the transcription start site of the gene encoding the DdRPA1 by primer extension. A. uva4 was the primer. The ...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
Hind III 1 23 7 8 9 10 EcoR I 4 5 612 13 11 14 15 N C intron ATG translationstart site T transcription start site PCR fragment, used as probe obtained from Hind III genomic DNA sub-library obtained from EcoR I partial library promoter known ...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
1 2 3 4 5 4.40 kb 2.37 kb 1.35 kb 2.6 kb Figure 48. Northern analysis of the DdRPA1 mRNA. Lane 1: RNA ladder standard; lane 2: 5 micrograms of total RNA from undifferentiated cells; lane 3: 10 micrograms of total RNA from undifferentiated cell...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
1 2 3 4 5 6 7 Figure 49. Northern Analysis of the expression level of the DdRPA1 mRNA during development. Four micrograms of total RNA purified from different developmental time points were used in each lane. The developmental time points were...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
1 2 3 4 5 6 7 8 9 10 11 23130 bp 6557 bp 2322 bp 2027 bp 7743 bp 3472 bp 2690 bp 1882 bp 1489 bp 925 bp Figure 5. Restriction enzyme digestion of genomic DNA. Lane 1: Lambda Sty I DNA standard; Ten micrograms of newly purified genomic DNA...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
1 2 3 4 5 6 7 Figure 50. Standard for the Northern analysis of the DdRPA1 (Northern blot analysis of actin8 mRNA) Four micrograms of total RNA purified from different developmental time points were used in each lane. The developmental time poi...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
Time after inititiation of development (h) 0 0 (not plated) (plated) 4 8 12 16 20 gene DdRPA1 DdRPA1 DdActin8 DdActin8 Intensity ratio intensity ratio 1428.98 0.81 1277.12 0.87 0.93 DdRPA1 mRNA expression level 1502.18 0.85 1262.58 0.86 0.99 1e 543....
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
1 1,500 bp 600 bp 2 3 4 5 6 7 8 9 260 bp Figure 52. PCR with degenerate primers for the DdRPA2 gene. The PCR template was the genomic DNA. Lane 1: 100 bp DNA ladder. The degenerate primer pairs were: lane 2: 35-1 (sense) <-> 35-3c (antisens...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
1 3.9 kb vector 2 600 bp 280bp insert 300 bp Figure 53. Restriction enzyme digestion of the cloned DdRPA2 PCR fragment. Lane 1: EcoR I digestion of cloned 35 kDa PCR fragment; lane 2: 100 bp DNA ladder standard. [previous figure][next figure] ...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
AC G T A C G T 35-2c EcoR I 35-3 EcoR I T7 M13 35-3 vector vector 35-2c Figure 54. DNA sequencing of a PCR fragment for the DdRPA2 gene. 35-3 (sense) and35-2c (antisense) were the degenerate primers for the PCR reaction. T7 and M13 reverse pri...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
Bcc I Asp16H I BspG I Bsr I Tsp509 I Mse I Tru9 I Tsp509 I Tsp509 I Mse I Tru9 I Apo I Tsp509 I NgoB I Cje I\' HgiE II Bse59 I BstE II Mae III Esp16 I Cje I Alw26 I BsmA I Esp3 I FmuI Dsa VI Acc I Csp6 I BscH I Rsa I Mme I Hph I Nla IV Cvi...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
reverse complementary DNA sequence:ATT CAA GGT translation: I Q G peptide sequence: degenerate primer 35-2c: TAC CTC GTC TCC TAC Y LV LV SY SY I QG Y CAA GGU UAU UUA GUU UCA UAU UAC CUC GUC UCU UAC CUU GUA UCC UUG 261 bp PCR fragment 35-3 clr5...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
1 2 3 4 upper rRNA lower rRNA 1.25 kb Figure 57. Northern analysis of DdRPA2 mRNA. Lane 1: 5 micrograms of total RNA from undifferentiated cells; lane 2: ten micrograms of total RNA from undifferentiated cells; lane 3: five micrograms of total ...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
1 2 3 4 5 6 7 8 9 5 kb 1150 bp Figure 58. Southern analysis of genomic DNA for the DdRPA2 gene. Genomic DNA was digested by: lane 1: Acc I; lane 2: BamH I; lane 3: Cla I; lane 4: EcoR I; lane 5: Hind III; lane 6: Kpn I; lane 7: Pst I; lane ...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
A 260 1. 2. 2.0020 1.1098 A 280 0.9490 0.5479 A 260/ A 280 2.11 2.03 conc. vol. amount 1.6 mg/ml 0.89 mg/ml 2 ml 1 ml 3.2 mg 0.89 mg Figure 6. Determination of the concentration and purity of purified total RNA. 1: total RNA purified from undiffe...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
1 2 3 9.49 kb 7,46 kb 4.40 kb 2.37 kb 26S rRNA 17S rRNA 1.35 kb Figure 7. Denaturing-agarose gel electrophoresis of total RNA. Lane 1, RNA standard; lane 2, total RNA purified from differentiated cells; lane 3, total RNA purified from undiffere...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
1 2 3 580 bp 450 bp 600 bp 500 bp 400 bp Figure 8. Test for genomic DNA contamination of the total RNA by reverse transcriptase PCR of the gp2 gene. The PCR templates were: lane 1: genomic DNA; lane 2: the total RNA. The primer pair was GP2-5 (s...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
developmental A 260 time points A 280 conc. g/L 0.8 1.47 4.81 1.1 0.53 0.11 0.042 vol. purity mL A 260/A 280 0.25 0.06 0.1 0.1 0.15 0.2 2 2 2 2 2 1.9 1.9 standard 0 hr 4 hr 8 hr 12 hr 16 hr 20 hr 0.0290 0.0525 0.1717 0.0392 0.0189 0.0039 0.0015 ...
Virginia Tech >> LIB >> 1513132149 (Fall, 2008)
Cloning and Characterization of Replication Protein A from Dictyostelium discoideum. Xiao Wen Thesis submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of M...
Virginia Tech >> LIB >> 02182000 (Fall, 2008)
PERCEPTION OF COLOR QUALITY FOR NATURAL IMAGES VIEWED, EDITED, AND PRINTED WITHIN THE CONTEXT OF A HOME DIGITAL COLOR IMAGING SYSTEM Wende L. Dewing Dissertation submitted to the faculty of Virginia Polytechnic Institute and State University in par...
Virginia Tech >> LIB >> 112399 (Fall, 2008)
STRUCTURE AND PROPERTIES RELATIONSHIPS OF DENSIFIED WOOD Elena V. Kultikova Thesis submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE i...
Virginia Tech >> LIB >> 112399 (Fall, 2008)
CHAPTER 1 Project Description 1.1 INTRODUCTION Wood is widely used as a material for many structures, furniture, tools, decorative objects, and composites. The continual utilization of the virgin forests has reduced the available supply of large clea...
Virginia Tech >> LIB >> 112399 (Fall, 2008)
CHAPTER 2 Literature Review 2.1 DENSIFIED WOOD 2.1.1 Background Wood with inadequate mechanical properties can be modified by various combinations of compressive, thermal and chemical treatments. It can be densified by impregnating its void volume wi...
Virginia Tech >> LIB >> 112399 (Fall, 2008)
CHAPTER 3 Effect of Densification on Tensile Strength and Stiffness Parallel to the Grain 3.1 INTRODUCTION Wood exhibits its highest strength in tension parallel to the grain. Tensile strength parallel to the grain of small clear specimens is approxi...
Virginia Tech >> LIB >> 112399 (Fall, 2008)
CHAPTER 4 Effect of Densification on the Cellular Structure of Wood 4.1 INTRODUCTION During densification, the cellular structure of wood is permanently changed, which results in a material with new properties. One of the major factors influencing me...
Virginia Tech >> LIB >> 112399 (Fall, 2008)
CHAPTER 5 Effect of Densification on Chemical Composition of Wood 5.1 INTRODUCTION It was shown in many studies that the combination of high temperature and steam pressure, used during preparation of densified wood, may cause changes in chemical comp...
Virginia Tech >> LIB >> 112399 (Fall, 2008)
CHAPTER 6 Summary The results of the tensile tests showed that ultimate tensile stress and tensile modulus increased significantly after all densification treatments at both 25 and 50 % strain levels. There was no significant thermal degradation dete...
Virginia Tech >> LIB >> 112399 (Fall, 2008)
APPENDIX A Calculations of the Pump Pressure 1. Cylinder with effective area of 4.43 in2 Pressure on the samples: 2500 psi (17236.9 kN/m2) Area (3 samples 27 x 120 mm): 3.19 in x 4.72 in = 15.066 in2 (9720 mm2) Force on the press: 2500 lb/in2 x 15.06...
Virginia Tech >> LIB >> 112399 (Fall, 2008)
APPENDIX C Images of Undensified and Densified Wood Specimens 84 Figure C1. SEM micrograph of juvenile yellow-poplar (control). Figure C2. SEM micrograph of juvenile yellow-poplar (control). 85 Figure C3. SEM micrograph of compressed juvenile ye...
Virginia Tech >> LIB >> 112399 (Fall, 2008)
Figure C27. SEM micrograph of uncompressed mature yellow-poplar (4mm), TRT1. Figure C28. SEM micrograph of uncompressed mature yellow-poplar (4mm), TRT1. 98 Figure C29. SEM micrograph of compressed mature yellow-poplar (4mm), TRT1. Figure C30. SE...
Virginia Tech >> LIB >> 112399 (Fall, 2008)
Figure C53. SEM micrograph of compressed mature yellow-poplar (4mm), TRT3, showing multiple fractures in the cell walls. Figure C54. SEM micrograph of compressed mature yellow-poplar (4mm), TRT3. 111 Figure C55. SEM micrograph of uncompressed matu...
Virginia Tech >> LIB >> 112399 (Fall, 2008)
Figure C79. SEM micrograph of compressed mature southern pine, TRT1. Figure C80. SEM micrograph of compressed mature southern pine, TRT1. 124 Figure C81. SEM micrograph of compressed mature southern pine, TRT1, showing multiple fractures in earlyw...
Virginia Tech >> LIB >> 112399 (Fall, 2008)
VITA Elena Vasilyevna Kultikova was born on October 24, 1972 in Kotlas, Arkhangelsk region, Russia. She graduated from Kotlas high school # 18 in 1990. She studied at Vyatka State Technical University in Kirov, Russia and obtained a Diploma of Engine...
Virginia Tech >> LIB >> 112399 (Fall, 2008)
ADDENDUM Corrections: 1) 04ch3.pdf page 14: change 50 % and 25 % strain compression levels to 50 % and 33 % strain compression levels change 50 % or 25 % of their original thickness to 50 % or 67 % of their original thickness page 24: change Table 3....
Virginia Tech >> LIB >> 11092000 (Fall, 2008)
ETD-db: Item Temporarily Restricted This item has been taken ofine by Virginia Tech Library or Graduate School. This restriction is temporary, and the item will be automatically made available again shortly. For more information, contact Gail McMilla...
Virginia Tech >> LIB >> 042499 (Fall, 2008)
INTRODUCTION Disseminating new theories, ideas and the results of research has always been an integral part of scientific practice. The need to share findings and scientific knowledge with the scientific community where it can become the common prope...
Virginia Tech >> LIB >> 042499 (Fall, 2008)
Chapter 2 - The Current Context From Preprints to E-Prints The practice of sending out preprints, although common among many fields of science, has long been established among physicists. Many scholars have remarked about this distinctive preprint cu...
Virginia Tech >> LIB >> 042499 (Fall, 2008)
Chapter 3-The Physicists Description of the Physics Department The Physics Department at the University of Maryland (UMD) has one the largest physics research programs in the United States. According to the National Academy of Sciences, The UMD docto...
Virginia Tech >> LIB >> 042499 (Fall, 2008)
Chapter 4-The Chemists Description of the Department and the IPST The Department of Chemistry and Biochemistry at UMD is divided into five units: Organic, Inorganic, Biochemical, Analytical-Nuclear-Environmental (ANE), and Physical Chemistry. I chose...
Virginia Tech >> LIB >> 042499 (Fall, 2008)
REFERENCES Abate, T. (1997) . Publishing scientific journals online. Bioscience, 47, 175-179. ACS publication policy. (1998) . Retrieved December 5, 1998 from WWW: http:/pubs.acs.org/journals/jacsat/policy.html. ACS web editions: Additional features,...
Virginia Tech >> LIB >> 042499 (Fall, 2008)
APPENDIX A-REFERS TO philips@pion.umd.edu> Date: Tue, 10 Jun 1997 14:01:55 -0400 (EDT) (24kb)...
Virginia Tech >> LIB >> 10262000 (Fall, 2008)
Aerodynamic Properties of the Inboard Wing Concept Matthew W. Orr Thesis submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of Master of Science in Aerospace E...
Virginia Tech >> LIB >> 5326175397 (Fall, 2008)
The Production of 2-Keto-L-Gulonic Acid by Different Gluconobacter Strains by Lana Amine Nassif Thesis submitted to the Faculty of Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of MAST...
Virginia Tech >> LIB >> 11082001 (Fall, 2008)
EFFICIENCY AND ACCURACY OF ALTERNATIVE IMPLEMENTATIONS OF NO-ARBITRAGE TERM STRUCTURE MODELS OF THE HEATH-JARROW-MORTON CLASS Tae Young Park Dissertation submitted to the Faculty of Virginia Polytechnic Institute and State University in partial fulf...
Virginia Tech >> LIB >> 05272008 (Fall, 2008)
Preliminary Design of an Autonomous Underwater Vehicle using a MultipleObjective Genetic Optimizer Matthew A. Martz A thesis submitted to the Faculty of Virginia Polytechnic Institute and State University in partial fulfillment of the requirement for...
Virginia Tech >> LIB >> 123099 (Fall, 2008)
THERMOPLASTIC SIZINGS: EFFECTS ON PROCESSING, MECHANICAL PERFORMANCE, AND INTERPHASE FORMATION IN PULTRUDED CARBON FIBER/VINYL-ESTER COMPOSITES By Norman S. Broyles Dissertation submitted to the faculty of the Virginia Polytechnic Institute and Sta...
Virginia Tech >> LIB >> 5698 (Fall, 2008)
Chapter 1. Introduction 1.1 Parkinson\'s disease Parkinson\'s disease (PD) is a gradual progressive central neurodegenerative disorder that affects body movement and is characterized by symptoms such as muscle rigidity, resting tremors, loss of fac...
Virginia Tech >> LIB >> 5698 (Fall, 2008)
Chapter 2. Research proposal and background 2.1. Steric parameters that influence enzyme selectivity Monoamine oxidase A and B, as previously stated, display substrate and inhibitor selectivity and the factors that influence this selectivity are ...
Virginia Tech >> LIB >> 5698 (Fall, 2008)
Chapter 3. Evaluation of steric parameters that influence substrate and inhibitor properties of C-4 substituted tetrahydropyridines Little is known regarding the structural features of the MAO-A and B active sites which lead to the selectivities ob...
Virginia Tech >> LIB >> 5698 (Fall, 2008)
Chapter 4. Evaluation of the neurotoxicity of 1-methyl-4-(4phenylphenyl)-1,2,3,6-tetrahydropyridine As previously discussed, MPTP induces an MAO-B mediated selective striatal dopaminergic neurotoxicity in the established C57Bl/6 mouse model (sectio...
Virginia Tech >> LIB >> 5698 (Fall, 2008)
Chapter 5. Evaluation of other tetrahydropyridinyl analogs for potential neurotoxicity The factors that influence and control the degree of observed dopaminergic neurotoxicity displayed by MPTP and other MPTP-like tetrahydropyridine MAO substrates ...
Virginia Tech >> LIB >> 5698 (Fall, 2008)
Chapter 6. Evaluation of the neuroprotection of the reported selective neuronal nitric oxide synthase inhibitor 7nitroindazole using the MPTP model of neurotoxicity 6.1. Research rationale and background The possible role of nNOS and NO in cytoto...
Virginia Tech >> LIB >> 5698 (Fall, 2008)
Chapter 7. Efforts toward docking the endogenous MAO substrates in the MAO-A and MAO-B active site models developed using tetrahydropyridinyl derivatives There have been several proposed models151,196 of the active sites of MAO generated using vari...
Virginia Tech >> LIB >> 5698 (Fall, 2008)
Chapter 8 Summary and conclusions 8.1 MAO-A and MAO-B active sites One of the goals of this project was to investigate the active sites of MAOA and MAO-B using designed bulky substrates to probe the steric limits in the active sites as there are ...
What are you waiting for?