41 Pages

THE INTERNATIONAL LEGAL SYSTEM

Course: LAW 7680, Fall 2002
School: Yeshiva
Rating:
 
 
 
 
 

Word Count: 28085

Document Preview

INTERNATIONAL www.swapnotes.com THE LEGAL SYSTEM CHAPTER 1: APPLICATION OF THE LAW OF THE INTERNATIONAL SYSTEM I. Introduction a. Definitions i. IL: a body of legally binding rules principally governing relations among states, rules applicable to international organizations, and rules evolving to provide increasing rights to individuals particularly in the fields of human rights and crimes against humanity. ii....

Register Now

Unformatted Document Excerpt

Coursehero >> New York >> Yeshiva >> LAW 7680

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
INTERNATIONAL www.swapnotes.com THE LEGAL SYSTEM CHAPTER 1: APPLICATION OF THE LAW OF THE INTERNATIONAL SYSTEM I. Introduction a. Definitions i. IL: a body of legally binding rules principally governing relations among states, rules applicable to international organizations, and rules evolving to provide increasing rights to individuals particularly in the fields of human rights and crimes against humanity. ii. General IL: rules and principles that are applicable to a large number of states on the basis of either customary IL or multilateral treaties. If they become binding on all states, they are referred to as "universal IL" iii. Regional IL: applies only to certain groups of states iv. Particularized IL: denotes rules which are binding upon two or a few states only v. International Comity: widespread practice observed b/w states w/o any sense of legal obligation vi. Note - IL predominantly made and implemented by States b. Characteristics of IL i. Unlike traditional government states 1. IL is concerned with the legal regulation of the international intercourse of states which are organized as territorial entities, are limited in number and consider themselves in formal terms as "sovereign"' and "equal" 2. IL is a horizontal legal system, lacking in a supreme authority, the centralization of the use of force, and the differentiation b/w law making, enforcement, and judicial review 3. UN Gen Assembly is not a world legislature 4. ICJ can operate only on the basis of the consent of states to its jurisdiction 5. The law enforcement capacity of the UN Sec Council is legally and politically limited ii. Enforcement of IL 1. A state that violates an international obligation is responsible for the wrongful act towards the injured state or in some circumstances to the international community as a whole 2. Injured state can raise an international claim through arbitration, 3rd party mediation, judicial proceedings 3. If a state commits an illegal act against another state and refuses to make reparation or to appear before an international tribunal, the only thing the injured state can do is to resort to self-help. In modern societies self-help has become the exception rather than the rule, whereas in international law self-help is still the rule c. The Scope of IL i. IL has changed b/c of advances in tech and science, increasing global economic and political interdependence, the need to address probs which can no longer be dealt with in a national framework, principle of reciprocity ii. IL covers topics like the position of states, state succession, state responsibility, peace and security, the laws of war, the laws of treaties, the law of the sea, conduct of diplomatic relations, international protection of human rights d. Sources of IL i. The Statute of the ICJ, Art 38(1): 1. Says the Court will apply international conventions, international custom, the general principles of law recognized by civilized nations, and the judicial decisions and the teachings of the most highly qualified publicists of the various nations to determine the rules of law ii. Customary International Law 1. Two approaches to customary IL: a. Objectivist/sociological approach customary IL is universal and therefore binding on every state of the world community b. Participatory/voluntarist approach customary IL applies only to those states which have participated in the custom and newly independent states have the right not to be bound by a previously established practice as customary IL. See S.S. Lotus i. The Restatement 201 rejects this position and view all states as bound by whatever customs are established at the time the state comes into existence 2. Evolving from the practice of states. The substance of customary IL must be looked for in the actual practice and opinion jurisdiction of States. Customary law follows the basic principle of IL that acts are permitted unless expressly forbidden. Prohibitions as well as affirmative practices must be proven by the state relying upon them. Prof. Halberstam www.swapnotes.com International Law Outline iii. iv. v. vi. vii. a. States in the practice of their international relations implicitly consent to the creation and application of legal rules. i. Look at published materials, newspaper reports, statements by gov't officials, states' laws and judicial decisions, correspondence with other states, documentary sourced produced by the UN, writings of international lawyers, judgments in national and international tribunals ii. State practice consists of what states do, what they say, and omissions what states did not do. Even silence is relevant b/c passiveness/inaction has to do with the doctrine of acquiescence. b. Duration of state practice must have been followed for an appreciable period of time i. Long-term practice was an important consideration in the case of The Paquete Habana. The court looked at the practices of Eng, France, Germany, and the Netherlands from 1400-1900 to conclude that fishing vessels are recognized as exempt from capture as prizes of war. ii. Short term practice not a bar to the formation of a new rule of customary IL if the practice is both extensive and virtually uniform. c. Consistency of state practice Customary rule must be based on a constant and uniform usage i. In Nicaragua v. US, ICJ said it does not consider that for a rule to be established as customary the corresponding practice must be in absolutely rigorous conformity with the rule. The Court deems it sufficient that the conduct of states should be consistent with such rules and that instances of state conduct inconsistent with a given rule should be treated as breaches of that rule ii. Major inconsistencies in the practice (that is, a large amt of practice that goes against the rule in question) prevent the creation of a customary rule d. Number and makeup of states adhering to the practice i. The practice followed by a small number of states is sufficient to create a customary rule, if there is no practice which conflicts with that rule 3. Treaties can be evidence of customary IL. Treaties dealing with a particular subject matter may always contain certain provisions. It has been argued that this standard provision becomes so habitual that it should be regarded as a rule of customary IL. But then why put it in? 4. Customary IL may be limited to a particular region 5. Qualitative factor opinio juris, which is the sent of legal obligation compelling states to follow certain practice. a. SS Lotus the court found that while states in Turkey's position had often abstained from asserting criminal jurisdiction, there was no evidence that the abstentions were based on a sense of legal obligation. Covenants or Treaties 1. An international covenant or treaty is any agreement governed by IL. 2. Vienna Convention on the Law of Treaties is the primary source for the law of treaties General principles of law recognized by civilized nations 1. One so fundamental that it is a basic tenet in virtually every major legal system. General principles are derived from domestic law. 2. Applies to principles of national and international law 3. With regard to international law, the general principles are not so much a source or law but more a method of using existing sources 4. Gaps in IL may be filled by borrowing principles which are common to all or most nat'l systems of law 5. Losing favor in international law - now classified as a secondary source of IL by the 3rd Restatement Judicial Decisions 1. In IL, there is no formal stare decisis doctrine international law courts are not obliged to follow previous decisions 2. ICJ Judges can create new law 3. Judgments of national courts are also covered by Art 38(1)(d) 4. Stare decisis: although Art 59 prohibits the ICJ from following the common law doctrine of binding precedent, the Court does in fact look to prior holdings as being highly persuasive Learned writers 1. they provide the sort of conceptual framework that's necessary for any legal discussion 2. writers quote state and states quote writers Other sources of IL (aside from those stated in Art 38) 2 Prof. Halberstam www.swapnotes.com International Law Outline 1. Acts of international organizations, e.g., resolutions by the UN General Assembly, Chapter VII of the UN Charter a. The resolutions are useful as evidence of customary IL because the votes of the world body may show a consensus or lack thereof on a particular issue b. The UN Declaration of Human Rights has been recognized as expressing customary IL because it created an expectation of adherence and that expectation was gradually justified by state practice (see Filartiga v. Pena-Irala) 2. Soft law has to do with the fact that states in agreement frequently don't want to bind themselves legally but nevertheless wish to adopt and test certain rules and principles before they become law a. operates in a gray zone b/w law and politics b. can be found in treaties not yet in force or in resolutions of international conferences or organizations that lack legally binding quality 3. Equity as a synonym for justice. A judge can always use equity to interpret or fill gaps in the law, even when he has not been expressly authorized to do so. viii. The hierarchy of the sources -- What happens if a rule derived from one source of IL conflicts with a rule derived from another source? 1. Treaties and custom: a. a treaty, when it comes into force first, overrides customary IL as b/w the parties to the treaty b. Treaties and custom are of equal authority; the later is time prevails c. Exceptions: i. A later law, general in nature, does not repeal an earlier law which is more special in nature ii. A Special law prevails over a general law 2. General principles of law are subordinate to treaties and custom 3. Judicial decision and learned writings are subordinate to treaties, custom, and general principles of law ix. Codification of IL - there have been a number of attempts to codify IL in order to clarify the existing rules and to improve them 1. The rules would become more precise and accessible 2. New states are more willing to accept rules which they themselves have helped draft 3. But codification means compromise and there is a limit to the # of compromises that states are willing to accept at one time e. States Rights i. Only states can be members of the UN ii. Only states can call upon the UN Security Council if there is a threat to international peace and security iii. Only states may appear in proceedings before the ICJ iv. Only states can present a claim on behalf of a nation who has been injured by another state if there is no treaty to the contrary f. International Custom Byers, Custom, Power and the Power of Rules i. No static set of rules "continuous evolution" ii. Doesn't occur in legal vacuum 1. Customary Process governs how one particular kind of rules rules of customary international law is developed, maintained, and changed a. Very important to IL b. Not like treaty rules, which are formal CP is informal c. Arise out of vague combinations of behavioral regularity and expressed/inferred acknowledgements of legality d. Provide substantive content and procedural framework e. Influence areas of state immunity, state responsibility, where multilateral treaties haven't yet been negotiated f. Important in human rights area where states aren't part of treaties since those states aren't subject to treaty enforcement mechanisms g. Influence treaty interpretation h. The individual has no individual rights under customary IL and is dependent on the political discretion of the home state as to whether or not to present the claim iii. Voluntarism when a state objects to a rule on the ground that it is incompatible with a vital interest of the State 1. Ex: Cuban Missile Crisis US said IL doesn't deal with questions of ultimate power and the survival of States is not a matter of law, i.e. a state may decide for itself whether its ultimate power or survival are at stake, and, if so, to disregard the law a. Different from legal right of self-defence 3 Prof. Halberstam www.swapnotes.com International Law Outline b. This is a claim saying that the state's will if based on a vital state interest must prevail over the law c. Denies the applicability of IL to critical issues like right to use force g. The UN Charter i. Sponsored by the US, Britain, the Soviet Union, and China 1. These are the "permanent members" they have the right to veto any decision they dislike (see art 2 1, declaring these members more equal than the rest of the member states) ii. Originally signed by 51 states iii. Designed to introduce law and order an and effective collective security system into international relations; preservation of peace was made an overriding objective of the UN iv. Adopted at the 1945 San Francisco Conference ; entered into force on Oct 24, 1945 v. Main innovation attempt to ban the use of force in Art 2(4) of the Charter with the exception of the right of states to collective and individual self-defense against an armed attack, as mentioned in Art 51 vi. Charter established a collective security system in Chapter VII giving the Sec Council the authority to determine whether there is a threat to or breach of international peace and security and to adopt binding economic and military measures against the aggressor state II. APPLICATION WITHIN NATIONAL LEGAL SYSTEMS a. RULES OF CUSTOMARY INTERNATIONAL LAW NOT IN CONFLICT W/ DOMESTIC LAW i. The Paquete Habana / The Lola (US S.Ct. 1900) Boats under Spanish flag fishing off coast of Cuba; boats brought to Key West; a libel for the condemnation of each vessel and cargo as prize of war filed in FL by master of the ships; final decree entered saying since there isn't a law, ordinance, treaty, or proclamation to the contrary, the boats are exempt from seizure so the two boats are sold at auction. HELD, under IL coast fishing vessels, pursuing their vocation of catching and bringing in fresh fish, have been recognized as exempt, with their cargoes and crews, from capture as prize of war. ii. Trendtex Trading Corporation v. Central Bank of Nigeria: In an action brought by Trendtex against the Bank of Nigeria, the Bank argued it was entitled to sovereign immunity and was therefore immune from suit. 1. Is IL incorporated into English law automatically so long as it is not in conflict with an existing act of Parliament? a. Whether the bank was entitled to sovereign immunity in the courts of England 2. The Court found the foreign state was entitled to sovereign immunity by a rule of customary IL. But it also found there was a rule of domestic law which provided immunity for the foreign state. iii. Discussion of IL: two schools of thought 1. Incorporation IL is constantly changing. By adopting the doctrine of incorporation, the courts are allowed to recognize changes in IL w/o the necessity of intervention by Parliament. The rules of IL are incorporated into English law automatically and considered to be part of Eng law unless they are in conflict with an Act of Parliament a. When IL rules change, Eng law accepts changes 2. Transformation rules of IL not part of Eng law except in so far as they have been already adopted and made part of our law by the decisions of judges or Parliament or est custom a. When IL rules change, Eng law does NOT change; Eng law can't develop as IL develops *Recent cases discard the doctrine of incorporation in favor of the doctrine of transformation. If there is a conflict b/w customary IL and an Act of Parliament, the act of Parliament prevails. However, where possible English courts will interpret acts of Parliament so that they do not conflict with customary IL iv. Where there is no constitutional provision directing courts to apply rules of customary IL 1. Some say IL is part of the law of the land but still always look to domestic law v. Provisions in constitutions 1. Statute may say "the state shall endeavor to foster respect for IL and treaty obligations in dealing of organized peoples with one another" 2. when broadly worded constitutional provision justifies application of customary IL look to past practice vi. Unless it unmistakably appears that a congressional act was intended to be in disregard of a principle of IL, the presumption is that it was intended to be in conformity with it b. RULES OF DOMESTIC LAW IN CONFLICT W/ CUSTOMARY INTERNATIONAL LAW 4 Prof. Halberstam www.swapnotes.com International Law Outline III. i. Attorney General of Israel v. Eichmann 1. BLL: a written statute must be carried out by the courts w/o considering if there exists a contradiction b/w the statute and IL. 2. FACTS: Defendant brought to Israel w/o his consent and tried under Israeli law punishing Nazis and their collaborators for crimes against the Jewish people committed in Germany during WWII a. D's Arg: under rules of customary IL, the court had no jurisdiction to try him for crimes committed outside Israel when neither the law, nor Israel, yet existed; also argued that Israel law in conflict w/ IL 3. ISSUE: ques of the validity of IL in Israel and whether, in the event of a conflict, it is to be preferred to the law of the land 4. HOLDING: the law and word of the legislature trumps IL a. Court examines sources of IL and finds there was no foundation of defendant's contention that Israel law conflicts with IL ii. Rule in US: an act of Congress supersedes an inconsistent rules of CIL but that does not relieve the US of its international obligation or of the consequences of a violation of that obligation. See 115(1)(b) of Restatement of the law 3rd, The Foreign Relations Law of the US (1987) c. RULES OF DOMESTIC LAW IN CONFLICT WITH INTERNATIONAL AGREEMENTS i. Conflict may arise in two ways: 1. the agreement may be in conflict with a rule of domestic law already in effect at the time the international agreement becomes binding 2. conflict may happen after the agreement has become binding ii. International agreement in conflict with constitutional provision 1. If this is the case, domestic law prevails unless the constitutional provides otherwise 2. A treaty not in compliance with the Constitution will not be given effect 3. last in time prevails only with regard to legislation 4. some nation's constitutions provide for resolving conflicts b/w the constitutional and international agreements a. Netherlands treaty conflicts can be approved by 2/3 vote of Chambers b. Spain conflicts require constitutional amendments iii. International agreement in conflict with legislation 1. Courts usually resolve the conflict in favor of the international agreement but refuse to take position that the agreement is superior to existing legislation a. Court will treat the two as equal in rank and apply the rule that as b/w anterior and posterior laws in conflict, the one later in time prevails. iv. Decision of the French Cour de Cassation Administration des Douanes v. Societe Cafes Jacques Vabre 1. BBL: Provisions of the Treaty establishing the EEC are binding on its member nations and carry authority greater than the statutes enacted by the member nations subsequent to the Treaty. 2. FACTS: the Customs Administration (D) appealed from a decision supporting plaintiff's position that the discriminatory tax on their imports was in violation of Art 95 of the Rome Treaty, establishing the EEC, contending that the treaty was not superior to the tax, which was enacted subsequent to the Treaty. State said the legislation of 1966, being later in time, prevailed. Lower courts held that the treaty prevailed by virtue of Art 55 of the French Constitution that says treaties have authority over law. On appeal, D argued the term "laws" does not include legislation enacted subsequent to the treaty. 3. HOLDING: Appeal dismissed. Provisions of the Treaty establishing the EEC are binding on its member nations and carry authority greater than statutes enacted by member nations subsequent to the Treaty. The Treaty creating the EEC institutes a new legal system in whose favor the member nations restrict the exercise of their sovereign powers in areas covered by the treaty. W/o member nations recognizing the primacy of the Treaty provisions, the unity of the market sought in the creation of the EEC could not be achieved. The lower courts were correct in applying Art 95 of the Rome Treaty over 265 of the Customs Code. APPLICATION IN INTERNATIONAL TRIBUNALS a. THE ICJ i. Purpose: to deal with the cases submitted to it by states members of the UN and parties to the Statute and with the requests for advisory opinions made by UN organs or specialized agencies ii. One of the six principle organs of the UN and its principle judicial organ of the UN 1. has 15 judges 2. Integrated with the Organization by Charter provision 3. a.k.a. "World Court" iii. Three ways for a state to accept jurisdiction of the ICJ: 1. Case by case basis: States file an agreement on an ad hoc basis to have a case heard 5 Prof. Halberstam www.swapnotes.com International Law Outline 2. Advance Declaration: States file application or make a declaration accepting the jurisdiction of the ICJ for all cases (can be subject to exceptions) 3. Treaties include provisions for jurisdiction iv. Membership in the ICJ coincides with membership in the UN v. Jurisdiction to adjudicate has no regional or other geographical boundaries vi. Immediate offspring of the Permanent Court of International Justice (PCIJ) 1. ICJ Statute is largely unchanged from the original PCIJ statute 2. PCIJ was NOT an organ of the League 3. members of the UN are parties to the ICJ Statute 4. Art 94 of the Charter provides that each member of the UN must undertake to comply with the Court's decision in any case to which it is a party and that the Security Council may make recommendations or decide upon measures to give effect to the judgment vii. Currently 59 states adhere to the Court's compulsory jurisdiction under the optional clause, out of 187 parties to the Statute viii. The ICJ Statute cannot be easily amended requires adoption and ratification by 2/3 of the membership of the UN, including all the permanent members of the Security Council ix. Judicial recourse is resorted to more frequently in times of dtente rather than of tension b. Art 36 paragraph 1 of the ICJ Statute i. provides that the "jurisdiction of the Court comprises all cases which the parties refer to it," which is normally done by way of notification to the Registry of a special agreement concluded by the parties for that purpose ii. provides that jurisdiction comprises "all matters specially provided for in treaties and conventions in force." c. Art 36 paragraph 2 of the ICJ Statute Optional Clause i. Accept jurisdiction of the Court "in all legal disputes concerning a) the interpretation of a treaty; b) any question of IL; c) the existence of any fact which, if established, would constitute a breach of an international obligation; d) the nature or extent of the reparation to be made for the breach of an international obligation." ii. States bound by declaration only w/ respect to states which have also made such a declaration iii. The declaration may be made unconditionally or on condition of reciprocity on the part of several or certain States, or for a certain time iv. US Declaration under Art 36(2) 1. Truman made declaration 2. US recognizes ICJ jurisdiction only in relation to any other State accepting the same obligation 3. submit to jurisdiction in all legal disputes arising concerning: a. the interpretation of a treaty b. any question of IL c. the existence of any fact, if established, would constitute a breach of an international obligation d. the nature or extent of the reparation to be made for the breach of an international obligation 4. The declaration shall not apply to: a. Disputes that should be resolved to other tribunals by virtue of agreements already in extent or which may be concluded in the future b. Disputes with regard to matters that are w/in the domestic jurisdiction of the US "as determined by the US" c. Disputes arising under a multilateral treaty unless 1) all parties to the treaty affected by the decision are also parties to the case before the Court or 2) the US specially agrees to jurisdiction 5. Declaration will remain in force for a period of five years 6. Must give 6 month notice before terminating d. France v. Norway i. BLL: Pursuant to the reciprocity provision of the statute of the ICJ, Art 36, jurisdiction is conferred only to the extent to which the declarations of the parties coincide in conferring it. ii. FACTS: D floated several public loans on the French market and P brought this action to have the ICJ declare that the international loans stipulated in gold the amt of D's obligation, which obligation can only be discharged by the payment of gold value of the bonds. iii. HOLDING: jurisdiction of this court depends upon the declarations made by the paties in accordance with Art. 36 of the statute on condition of reciprocity; and that, since two unilateral declarations made by D and P are involved, such jurisdiction is conferred upon the court only to the extent to which the declarations coincide in conferring it. iv. Art 36 provides for unconditional declarations and for declarations based on a condition of reciprocity on the part of other statues. Art 36 under the options clause authorizes only the acceptance of compulsory jurisdiction for limited periods and liability to jurisdiction based 6 Prof. Halberstam www.swapnotes.com International Law Outline e. f. g. h. on the condition that compulsory jurisdiction has been accepted by a particular state or states. It, in effect, does not relate to the doctrine of reciprocity. Initiation of process i. Proceedings before international courts instituted either unilaterally by one of the parties to a dispute or jointly by the parties, depending on the terms of the relevant agreement in force b/w them ii. If parties have accepted the compulsory jurisdiction of the ICJ then proceedings may be instituted unilaterally iii. In the absence of prior acceptance, proceedings can only be brought before international courts on the basis of mutual consent of the parties Nicaragua v. US i. BLL: a state may not, w/o notice, abrogate its jurisdictional commitments to the ICJ ii. FACTS: 1. Apr 9, 1984: Govt of Nicaragua initiated proceedings against US w/ respect to its military and paramilitary activities in Nicaragua 2. Apr 6, 1984 (three days before the filing): US Sec of State sent letter to Sec-General of the UN a. Amended declaration saying it doesn't apply to disputes with any Central American state or arising out of or related to event in Central America b. This proviso shall take effect immediately and shall remain in force for two years iii. US argument 1. Notion of reciprocity a. US says Nicaragua didn't accept ICJ jurisdiction under "the same obligation" as itself for purposes of Art 36(2) and so it can't rely on the US's 6 month termination clause b. the Nicaraguan Declaration was of an undefined duration c. Court says reciprocity concerned with scope and substance and not with the formal conditions of their creation, duration, or extinction iv. HOLDING: a state that has unilaterally submitted itself to ICJ jurisdiction is free to withdraw the submission on its own initiative. However, in accepting, as it did , the provision in the ICJ charter mandating a six months' notice period for abrogations, the US performed an essentially bilateral act w/ binding effect vis--vis other signatory states. The 6 month notice period is an integral part of the US' declaration of acceptance and cannot be ignored. 1. the ICJ had jurisdiction to entertain the application of Nicaragua on the basis of Art 36(2) and (5) of the ICJ Statute 2. just b/c the declaration was unilateral does not mean the US could amend its scope and contents as it pleases 3. principle of good faith important great need in international relations for respect for good faith and confidence in particularly unambiguous terms v. The court found that jurisdiction was excluded in this case with regard to the relevant treaty law (here the UN Charter) but the court proceeded to reach a decision on the basis of customary IL, the content of which it considered to be the same as that laid down in the Charter (concerning the prohibition of the use of force) Case Concerning East Timor Portugal v. Australia i. Portugal says that Australia, in negotiating and concluding the 1989 Treaty, in initiating performance of the Treaty, in taking internal legislative measures for its application, and in continuing to negotiate with Indonesia, has acted unlawfully, in that it has infringed the rights of the people of East Timor. ii. ISSUE: does Portugal's application require the Court to determine the rights of obligations of Indonesia, a third State that has not consented to jurisdiction of the Court? 1. Portugal says its application is concerned only with the conduct of Australia and this question is perfectly separable from any question relating to the lawfulness of the conduct of Indonesia iii. Rule: The Court cannot decide a dispute b/w States w/o the consent of those States to its jurisdiction iv. ICJ concludes Australia's behavior cannot be assessed w/o first looking into why Indonesia could not lawfully have made the 1989 Treaty while Portugal could have this question cannot be answered without the consent of Indonesia ADVISORY OPINIONS i. Does not bind the requesting entity, or any other body, or any State ii. Court gets its power from Art 65(1) of the ICJ Statute 1. the ICJ "may give an advisory opinion on any legal question at the request of whatever body may be authorized by or in accordance with the Charter of the UN to make such a request." 7 Prof. Halberstam www.swapnotes.com International Law Outline 2. this art doesn't tell us who can ask for advisory opinions just says they can be given a. must look to UN Charter to see who can ask for one b. Security Council c. General Assembly iii. Advisory Opinion on the legality of the threat or use of nuclear weapons 1. General Assembly asked for the AO a. Court asked to rule on the compatibility of the threat or use of nuclear weapons w/ the relevant rules and principles of IL i. Whether the possession of nuclear weapons is a violation of provision Art. 2 4 of the UN Charter (use of force by states) 1. Just the possession of nuclear force is a threat could be used at any time a. No circumstance under which it is permissible to use the force; b. such a broad use of force c. Concept of proportionality kills so many and inevitably innocent people ii. States would have to get rid of all nuclear weapons if the ICJ found possession is inconsistent with the Charter tremendous ramifications of a AO 2. Art 11 court can give advisory opinions "in the maintenance of international peace and security, including the principles governing disarmament and the regulation of armaments." 3. Why is there a question here of whether the ICJ can issue an AO? a. General Assembly is clearly authorized by the UN Charter to ask for an AO b. Those who say the ICJ doesn't have jurisdiction argue this is a political question and not a legal question (must be a legal question under 65(1)) i. ICJ concludes it doesn't matter if the AO sought is a political question in addition to being a legal question ii. ICJ says only "compelling reasons" could lead it to refuse to issue an AO i. LaGrand Case i. FACTS: Born in Germany. Moved to US and adopted by US father. Never got US citizenship so officially German citizens. Tried and convicted in Arizona. No claim that they were denied substantive rights. The claim, made at the appellate stage just before execution by the gov't of Germany, was that their international rights were violated. ii. ISSUE: Are provisional measures binding on the US? Germany sued US. 1. US says provisional measures are not binding on a textual basis. 2. Page 11 of opinion language implies states are not mandated to follow such measures fortiori and not mandatory. iii. HOLDING: Found it's mandatory to follow. Too late if not mandatory goal to preserve the status quo and prevent damages. Can't leave it up to country to see if they want to follow the provisional measure since there could be irreparable harm. 1. Germany wanted to delay the execution (like a TRO) and then get the case heard by the ICJ. This is called a provisional measure under the ICJ Statute, Art. 41. 2. If state gets to decide whether or not to follow such measure, irreparable harm could result. iv. Does Art 36 mention individual rights? 1. Party has a right to be informed that he has a right to have his consulate informed that he has been arrested. Doesn't really mention that he has individual rights himself. If breached, are the rights of the individual or the rights of the state violated? 2. Court says it give individual rights 3. US finds this provision important US citizens travel all over the world and need to be able to speak to US consuls while abroad. If the US doesn't honor this provision, other countries won't honor it. a. State prosecutors aren't even away of this provision! The prosecutors may have also thought the defendants were, in fact, US citizens since the kids grew up in this country. a. ARBITRATION i. Applicability of the obligation to arbitrate under 21 of the UN Headquarters Agreement of June 26, 1947 1. US sent letter to the PLO Observer Mission to the UN in NY demanding it to shut down under the Anti-Terrorism Act of 1987. US made demand irrespective to any obligations the US may have under the Agreement b/w the US and UN. 2. ISSUE: Question if the US, as a party to the UN Headquarters Agreement, is under an obligation to enter into arbitration 8 Prof. Halberstam www.swapnotes.com International Law Outline a. 21(a): "any dispute b/w the UN and the US concerning the interpretation or application of this agreement or of any supplemental agreement, which is not settled by negotiation or other agreed mode of settlement, shall be redefined for final decision to a tribunal of three arbitrators..." 3. HOLDING: US must enter into arbitration for the settlement of the dispute b/w itself and the UN. US government's motion for an injunction closing the PLO office was denied and the PLO's motion to dismiss was granted 4. International Arbitration a. Two types: i. Interstate arbitration 1. created and defined by treaty 2. IL leaves the structuring and conduct of the arbitration entirely in the control of the parties ii. International commercial arbitration b. Article 4 i. Members of ICJ elected by General Assembly and by the Security Council from a list of persons nominated by Permanent Court of Arbitration ii. For people not nominated by Permanent Court of Arbitration, candidates can be nominated by nat'l groups appointed for this purpose by their gov't under the same conditions prescribed by PCA by Art 44 of the Convention of The Hague of 1907 iii. Conditions under which a state which is a party to the present Statute but isn't a member of the UN may participate in electing members to the ICJ under recommendations by the Security Council CHAPTER 2: THE STRUCTURE OF THE INTERNATIONAL LEGAL SYSTEM: STATES, INTERNATIONAL ORGANIZATIONS AND OTHER ENTITIES I. STATES AND STATEHOOD: The Aura of Sovereignty a. NOMENCLATURE, STANDING, AND ROLE OF STATES i. States have had the virtually exclusive role in the evolution of the modern international legal system ii. International organizations now play an important role as subjects and contributors to IL 1. Regional economic integration organizations (REIOs) a. supranational organizations b. act on behalf of individuals, companies, and other entities c. field of human rights b. THE ELEMENTS OF STATEHOOD i. The State as a person of IL should possess the following qualifications: 1. Defined territory a. The control of territory is the essence of a state; basis of the notion of territorial sovereignty 2. Permanent population a. This criterion connected with that of territory and constitutes the physical basis for the existence of a state. For this reason, Antarctica isn't a state. However, the fact that large #s of nomads move in and out of Somalis isn't itself a bar to statehood as long as there is a significant # of permanent inhabitants b. The size of the population and the territory may be very small. Mini-states like the Vatican City are admitted to the UN as an equal member 3. Government w/ effective control over its territory and population a. Rationale: reflects the interest of the international system in stability and to avoid a premature change of the status quo since the gov't may be able to restore its effectiveness; also important in the instance when part of the population of a state tries to break away to form a new state b. Internally, the existence of gov't implies the capacity to est and maintain a legal order in the sense of constitutional autonomy c. Externally, it means the ability to act autonomously on the international level w/o being legally dependent on other states w/in the international legal order d. A state does not cease to exist when it's temporarily deprived of an effective gov't as a result of civil war of similar upheavals. Even when all of its territory is occupied by the enemy in wartime, the state continues to exist provided that its allies continue the struggle against the enemy (as in the case of the occupation of European states by Germany in WWII) e. IL is indifferent towards the nature of the internal political structure of states, be it based on Western concepts of demoncracy as the rule of law, the supremacy of the Communist party, Islamic perceptions, monarchies or republics, or other forms of authoritarians or nonauthoritarian rule. 9 Prof. Halberstam www.swapnotes.com International Law Outline i. Just must have a gov't established itself in fact f. Whether the population recognizes the legitimacy of the gov't in power is not relevant to the question of whether or not a state exists. 4. Engagement/capacity to engage in foreign relations with other states a. This isn't essential to statehood ii. Self-determination and recognition as additional criterion 1. In borderline cases, recognition can have an important effect. For instance, recognition of small states like Monaco and the Vatican City is significant b/c otherwise it might be doubted whether the territory and population were large enough to make them states in the international eye. Recognition is also important in the case of secessionary struggles where the mother state's efforts to reassert control are rather feeble. iii. UN Charter 1. Article 4: membership in the UN is open to all states which accept the obligations in the Charter and in the judgment of the organization are able and willing to carry out these obligations a. admission to membership effected by a decision of the General Assembly upon the recommendation of the Sec Council 2. Article 6: the Gen Assembly can vote to expel somebody but it has to get the recommendation of the Securities Council c. MINIMUM FACTS FOR STATEHOOD NOT CLEARLY PRESENT i. Two of the federal states of the USSR admitted to UN even though these units did not engage in international relations with the rest of the world. For purposes of membership in the UN they were treated as though they were states. 1. Did they thereby become states? Does such an entity, not fully meeting the factual criteria for statehood, have a given legal right and obligation normally accorded to states? 2. The current "inflation" of statehood could alter the status of statehood itself. Think about possible problems and consequences of this. d. INTERNATIONAL LAW AND STATE LAW i. IL says states cannot invoke their internal laws and procedures as a justification for not complying with their international obligations. States are required to meet these obligations in good faith but they are free to decide on the modalities of performance w/in their domestic legal systems. 1. To translate international obligations into their domestic law, States can use the concepts of incorporation, adoption, transformation, or reception e. INTERNATIONAL ORGANIZATIONS i. Term used to describe an organization set up by agreement b/w two ore more states. It's different from the term non-governmental organization (NGO), which is set up by individuals. ii. Treaties setting up international organizations often provide (as does art 104 of the UN Charter) that the organization shall enjoy in the territory of each of its members such legal capacity as may be necessary for the exercise of its functions and the fulfillment of its purposes, which means the organization has legal personality under the municipal laws of its member states. An international organization can own property, make Ks, enjoy privileges and immunities, etc. iii. Powers of international organizations need not necessarily be conferred expressly in the organization's constituent treaty; an organization also has such implied powers as are necessary for most efficient performance of its functions II. RECOGNITION OF STATES AND THEIR GOVERNMENTS a. Generally i. Recognition means a willingness to deal with the new state as a member of the international community. When granting/withholding recognition, states are influenced more by political than by legal considerations ii. Act on the international plane affecting the mutual rights and obligations of states and their status or legal capacity generally iii. Consequences on the national level, too where the application of rules of municipal law is affected by a decision to recognize a new state or gov't iv. Recognition of state v. gov't 1. The recognition of a state acknowledges that the entity fulfills the criteria of statehood 2. The recognition of a gov't implies that the regime in question is in effective control of a state. 3. Difference is that the recognition of a gov't necessarily has the consequence of accepting the statehood of the entity which the regime is governing while the recognition of a state can be accorded w/o also accepting that a particular regime is the gov't of that state 10 Prof. Halberstam www.swapnotes.com International Law Outline b. RECOGNITION AND MEMBERSHIP OF THE INTERNATIONAL COMMUNITY i. When an entity becomes a member of the international community, it is then bound by the obligations and rights prescribed by IL for states and their gov'ts ii. The grant of recognition by a state is a unilateral act affecting essentially bilateral relations and neither constitutes nor declares the recognized state to be a member of the international community as a whole 1. Recognition by only one state will make it an international person to the limited extent of its relations with that state but it cannot be regarded as a member of the international community in general iii. Do states only become members upon recognition? Two theories: 1. Declaratory Theory (the prevailing view) a. Belief that if a new state comes into existence as a matter of fact, it thereupon enters the international community regardless of whether it has been recognized b. Though it is also said that recognition is necessary to enable every new state to enter into official intercourse with other states c. If an entity satisfies the requirements of a state objectively, it is a state w/ all international rights and duties and other states are obliged to treat it as such. d. Leave unresolved the difficulty of who ultimately determines whether an entitye meets the objective test of statehood or not. 2. Confirmatory or Constitutive Theory a. no new state has a right as against other states to be recognized by them b. no state has a duty to recognize a new state c. a new state before it is recognized cannot claim any right which a member of the international community has as against other members d. recognition is essential to joining the international community iv. What should the policy of the international community on the question of recognition of territory taken in violation of the UN Charter Art 2.4 rule against the threat of force? 1. Ex: Iraqi attack on Kuwait 2. Add Class Notes v. There is no general rule of IL which forbids a group of people from overthrowing the gov't of their state or to break away and form a new state vi. Premature recognition of states after a civil war may constitute a violation of IL and of the rights of the mother country vii. Nonrecognition of a state by other states does not imply that a de facto regime is entirely outside the realm of IL. 1. many rules are still applicable despite the nonrecognition such as prohibition of the use of force viii. Recognition of another state does not lead to any obligation to est full diplomatic relations or any other specific links w/ that state. This remains a mmer of political recognition. Nor does the termination of diplomatic relations automatically lead to de-recognition c. European Community: Declaration on Yugoslavia and on the Guidelines on the Recognition of New States i. Community agreed to recognize the independence of all the Yugoslav Republics ii. Community requests the UN Sec General to continue to est an effective cease-fire and promote a peaceful and negotiated outcome to the conflict iii. Community requires the Yugoslav Republic to commit itself, prior to recognition, to adopt constitutional and political guarantees ensuring that it has no territorial claims towards a neighboring Community State d. RECOGNITION OF GOVERNMENTS i. Recognition of a change in the head of state or in its gov't is different from recognition of a state ii. If a foreign state refuses to recognize a new head of state or a change in the gov't of an old state, the latter does not thereby lose its recognition as an international person 1. although, no formal intercourse is possible b/w the two states as long as recognition is not given either expressly or tacitly iii. When there is a new gov't, recognition is a matter of course (though sometimes done by sending a note of congratulations) iv. When coming into power abnormally and in a revolutionary manner 1. recognition will be more a matter of implication than of express declaration 2. in deciding whether to formally recognize a new gov't, the recognizing state exercises a discretion, which though wide is not arbitrary v. De Facto Recognition 1. the terms de jure or de facto qualify the state recognized rather than the act of recognition itself a. de jure fullest kind of recognition 11 Prof. Halberstam www.swapnotes.com International Law Outline b. de facto lesser degree of recognition so it takes place when the new authority although actually independent and wielding effective power in the territory under its control, has not acquired sufficient stability or does not as yet offer prospects of complying with other requirements of recognition i. recognition limited to such areas as are actually under the territory's control ii. will, in time, be replaced with de jure recognition vi. How to assess the legitimacy of rival ruling bodies -- Credential Process 1. Serves as a process of collective legal recognition a. There have been 8 major credentials contests i. South Africa is the major one; Israel, too 2. It's the GA's practice to accept delegation credentials where they have been properly issued by the head of state, head of gov't or foreign minister of a member state a. GA forced to choose which ruling apparatus shall represent the state of that body when credentials are presented by more than one contestants b. Remember that recognition is a matter of individual state prerogative while a credentials decision is a collective process 3. UN Charter nowhere expressly grants the GA the capacity to make credential determinations, declaratory or constitutive e. Unban the Taliban? time to recognize the Taliban in Afghanistan? i. Under the Taliban, something like a stable gov't seems to have emerged ii. West will not give diplomatic recognition of Afghanistan's rulers b/c they are Islamic Zealots iii. But, diplomatic recognition need not be the enemy of morality countries recognize each other not b/c they like or approve of their counterparts' politics, but b/c they must deal with them f. Non-recognition distinguished from severance of diplomatic relations i. Banco Nacional de Cuba v. Sabbatino (S.Ct. 1964) 1. US argues that Cuba is an unfriendly power and shouldn't be able to obtain relief in US courts. Also, the US has no diplomatic relations with Cuba and has frozen Cuban assets in this country so Cuba shouldn't be able to sue in a US court 2. HELD: a US court will not decide the validity of a foreign act applicable to property w/in a foreign state. Court enforced a foreign act of state w/o considering its validity under IL; essentially saying a US court must enforce a foreign act even if that act violates IL or US law 3. Can Cuba sue in US? Sure - the only time the courts of the US should be closed to the gov't of a fed state is when there's an issue of national policy transcending the interests of the parties to the action a. Privilege of suit has been denied only to gov'ts at war with the US b. Court says severance of dip rels may take place for any number of political reasons and whatever expression of animosity it may imply does not approach that implicit in a declaration of war. c. Refusal to allow suit has unique legal aspects i. Signifies the country's unwillingness to acknowledge that the gov't in question speaks as the sovereign authority for the territory it purports to control ii. Political recognition is exclusively a function of the Executive ii. In response to the Sabbatino decision, Congress enacted the Hickenlooper Amendment, which substantially repealed the decision of the Supreme Court in Sabbatino. 1. The Amendment provides that no court in US shall decline on the ground of the federal act of state doctrine to make a determination on the merits giving effect to the principles of IL in a case in which a claim of title or other right to prop is asserted by any party based upon an act of that sate in violation of the principles of IL 2. The Hickenlooper Amendment says the court should not refuse to consider the foreign law. The court should still follow the act of state doctrine and should not consider the validity if the executive has said the act is against the policy and interests of the state. Amendment overrules Sabbatino but with a caveat if the exec says the court's consideration is going to interfere with our foreign affairs then the court should defer examining the validity of the foreign law a. court reads Hickenlooper very narrowly courts are afraid to touch foreign affairs (want to defer to the State Dept) 3. Exception If we didn't have the act of state doctrine, the courts would consider the validity of the act under IL. Act of state is a choice of law issue. a. In so far as property is concerned, the law where the property is located applies b. Most states say they will apply the law of the place where it should apply except where it conflicts with the state's public policy 12 Prof. Halberstam www.swapnotes.com International Law Outline c. Here, if Cuba seized the property and the court found it didn't violate IL, Cuba gets the property. But the District Court said it won't apply Cuban law b/c it violates IL. Supreme Court said you can't do that must apply Cuban law. iii. Sabbatino Resurrected: The Act of State 1. 428 of the Restatement of the Foreign Relations Law of the US: "courts in the US will refrain from examining the validity of an act of a foreign state taken in its sovereign capacity w/in the state's own territory." 2. Court in Sabbatino holdsthe judicial branch will not examine the validity of a taking of prop w/in its own territory by a foreign sovereign gov't even if it is alleged that the taking is contrary to IL. Effect of S.Ct. decision requires US courts to enforce a foreign act of state, even if that act is contrary to IL and to the US Constitution o Courts must render judgment and thereby validate the lawless act 3. What is the rationale of this doctrine that requires a US court to direct a US citizen to turn over property in the US to a foreign state, pursuant to an act of that state that violates IL and deprives him of his property precisely b/c he is a US citizen? Court's reasoning a. A judicial determination of the validity of a foreign act of state under IL might embarrass the executive in its conduct of foreign affairs (not true) b. since the content of the applicable IL was unsettled, it should not be determined by municipal courts not true for 2 reasons i. it would eliminate a major source for the interpretation, application, and development of IL ii. it would help those states that choose to violate IL to do so 4. we need national courts to contribute to the development of IL 5. where the foreign act violates a generally accepted principle of IL then domestic courts fulfill their role by refusing to further the policy of the foreign legal system (in Sabbatino, for ex., the decree was discriminatory so it was correct to declare it invalid) 6. Since the purpose of the act of state doctrine is to further the foreign policy interests of the US, its application in situations where an individual is compelled to relinquish his private prop towards that end, w/o compensation, violates the "taking w/o just compensation" clause iv. First National City Bank v. Banco Nationale de Cuba (supplement) 1. FACTS: Plaintiff loaned $ to defendant. Castro came to power. Loan not repaid. Plaintiff sold the collateral on the loan, making a profit of $1.8M. Defendant sued for the profit, saying it belongs to them. Under normal circumstances, the Cuban Bank is right. But plaintiff's justification was that they needed to recover damages as a result of Castro's taking of their property in Cuba under nationalization (essentially a set-off or counterclaim). a. Plaintiff didn't sue Cuba for the $ owed b/c it has to be limited not arising out of the same transaction. b. Cuba interposed the defense of act of state. The act in this case was the nationalization of US assets in Cuba. Can't consider whether that violated IL, have to enforce, have to give money back to Cuba. 2. HELD: bank recovered the $. The S.Ct. applied the Bernstein exception a. the Executive sent a letter saying you don't need to apply act of state doctrine. Proposition is that when the executive tells us we shouldn't apply the act of state doctrine, then we won't. 3. The Bernstein Exception started in the 2d Cir. Bernstein's ship had been confiscated by the Nazis and ended up in US. He attached it and tried to get it back. The defendant said act of state (law of Germany took away property of Jews). Under act of state doctrine, US courts can't look into validity of that law. L.Hand said that's correct. But plaintiff said we went to war with Germany why would it embarrass the US for the courts to consider the validity. Hand said he can't go beyond this unless he has a letter from the Executive. The plaintiff gets a letter and wins. v. W.S. Kirkpatrick & Co., Inc. v. Environmental Tectonics Corporation, International (571) (1990) 1. FACTS: Nigeria wanted to construct an airport and so they took bids. Kirkpatrick put in a bid as did ETC. Plaintiff gets the K, which they fulfilled. ETC finds out that they were the lowest bidder but they didn't get the K b/c Kirkpatrick bribed gov't officials. US gov't prosecuted plaintiff for violating US law by getting a K abroad through bribery. Kirkpatrick entered a plea not admitting guilt and not denying guilt. He paid a penalty w/o ever admitting guilt. Then ETC brought this action they wanted $ damages. The statute that makes what Kirkpatrick did illegal is called private attorney's general. It gives private people incentive to bring civil action for troubled damages and attorneys' fees. 13 Prof. Halberstam www.swapnotes.com International Law Outline a. Kirkpatrick's defense: act of state. Here, the act was the K to do the building But under act of state, the court is not supposed to question the validity of anything. The K was performed. Even if it wasn't, the court couldn't examine its validity. b. The district judge told ETC to go to the state dept and get a Bernstein letter, which would say it's ok for the court to consider the validity of this act b/c it would not embarrass the country. c. The state dept said there is no act of state here. The court read this to me that the dept would not issue a Bernstein exception so the court will apply act of state NOTE: act of state can be invoked by anyone; it's a law that says a US court cannot question the validity of a foreign law. 2. PH: Went to Circuit Court, which reversed the district court. DOJ and SD wrote a brief together, urging SCT to take cert. Sabbatino decided in the 60s. Then the Hickenlooper expanded act of state doctrine with rule that if the motivation of the foreign gov't is at issue, the courts would not consider the issue b/c it might embarrass the foreign gov't. 3. HELD: In Bernstein and Sabbatino, there were acts of state. The doctrine has no application here b/c the validity of no foreign sovereign act is at issue. vi. Notes on Hickenlooper: 1. Hickenlooper requires the pres to say considering the validity wouldn't embarrass this country (affirmative act). While the Bernstein exception, requires plaintiff to get the state dept to come in on his side. 2. Courts have found so many ways of avoiding Hickenlooper that for all intents and purposes it doesn't exist 3. One of the ways deals with property the exact same property seized has to be the property at issue 4. Attempt to overrule the whole thing Rule of Law Bill vii. Differences/Similarities b/w Foreign Immunities and Act of State 1. Only a state can raise a claim of sovereign immunity; Anyone can raise act of state 2. If the court finds sovereign immunity exists the case is dismissed (not on the merits) 3. If the court finds act of state it enforces the foreign law 4. State could try to invoke sovereign immunity and if that doesn't work go for the act of state doctrine viii. Exception to act of state doctrine 1. if there are controlling legal principles in a treaty then the act of state doesn't apply 2. Hickenlooper (amendment) 3. Bernstein (just got plurality of the court written by Rehnquist) o Douglas' Concurrence: act of state does not apply to counterclaims o Powell's Concurrence: the court shouldn't automatically defer to the exec; doesn't think the Bernstein exception applies 4. Commercial exception (listed in Dunhill) ix. Difference b/w the Bernstein exception and the Hickenlooper Amendment 1. Bernstein act of state will apply unless plaintiff can get the state dept to come into court on your behalf and say the act of state doctrine doesn't apply 2. Hickenlooper exec files its objection to the act of state doctrine being applied; plaintiff does nothing, but rather the defendant has to take affirmative steps to prove that act of state applies g. The Lawmaking Authority of Unrecognized Governments i. A.M. Luther CO. v. James Sagor & Co. 1. Russian gov't seized all the stock at plaintiff's mill and sold it to the defendants. a. The plaintiffs contend that the so-called gov't had no existence as a gov't b/c it was not recognized by the English head of state. Thus, they argue the gov't cannot nationalize all factories of Russia (and then seize their goods). b. Defendants respond that the Republican gov't that nationalized all factories was the de facto gov't of Russia and that it had been recognized as such. 2. Court said it was the state's right to nationalize the factory. De facto recognition in this case British giving the Russian gov't a lesser degree of recognition (gov't is one in which possession may be wrongful or precarious so it cannot be recognized as de jure) a. Court refers to letters written by officials of the British gov't as evidence of the recognition III. JURISDICTION 14 Prof. Halberstam www.swapnotes.com International Law Outline a. Jurisdiction is the authority to effect and affect the legal interests to prescribe rules of law, to adjudicate legal questions, and to compel compliance i. In the international legal system, jurisdiction is the authority of the state as a whole, not of its constituent units or political subdivisions 1. a state's jurisdiction is the international sys means that the state is entitled under IL to subject certain categories of persons, events, or places to its rules of law 2. A state owes special obligations of fair treatment to aliens who are w/in its territory. Failure to provide the alien with a fair trial gives the state of his nationality a claim against the failing country, even though that nation in trying the alien acted w/in its rights under international rules of jurisdiction. b. FIVE BASES OF JURISDICTION: i. Territorial 1. Predominant theory a state has jurisdiction to prescribe rules governing conduct taking place w/in its territory a. Rationale: the jurisdiction of a nation w/in its own territory is exclusive and absolute. It is susceptible of no limitation not imposed by itself. Any restriction upon it, getting its validity from some other source, would diminish its own sovereignty, which isn't allowed b. Computer technology presents new probs to jurisdiction criminal can hide in cyberspace c. Subjective Territoriality - when an essential part of the conduct covered by legislation occurs w/in the state i. Constituent element of a crime ii. When employment, marriage, acquisition of prop, disposition of wealth, conclusion of Ks, commission of torts occurs w/in the territory 2. Sometimes a state will prosecute conduct that it considers illegal even though the conduct is not criminal in the state where it culminates a. Case of the Artsy Pornographers i. FACTS: Two Austrians assembled and published a book in Germany through a German publisher. They were prosecuted in Austria for publishing pornography. ii. Austrian Court convicted them even though their charges had been dropped in Germany as being non-criminal. They were held to have committed some elements of the crime of pornography in Austria b. Denunciation to the Enemy Case i. FACTS: bank guy tells German police that Jewish brothers put money in bank in Netherlands against German law. German authorities get brothers to return the money. The heirs sued the bank guy and the Bank. ii. HELD: Act directed against a fortune in the Netherlands and was calculated to injure the Bank in the Netherlands. Netherlands law applies b/c bank guy's act took place to such an extent in the Netherlands. 3. Objective Territoriality Jurisdiction The Effects Theory a. Acts done outside a jurisdiction but intended to produce and producing detrimental effects w/in it justify a state in punishing a cause of the harm as if he had been present at the effect i. Doesn't apply it only intend have to produce a significant effect or the offense must actually occur w/in the state's territory b. The S.S. "Lotus" -- France v. Turkey i. FACTS: collision b/w the French steamer Lotus and a Turkish boat; people were killed. Boats continued on to Constantinople. French officer arrested and charged with manslaughter. Ensuing protests over arrest of the officer and which his case should be transferred from the Turkish Courts to the French Courts. 1. French arg the Turkish Courts, to have jurisdiction, should be able to point to some title to jurisdiction recognized by IL in favor of Turkey 2. Turkish arg Art 15 allows Turkey jurisdiction whenever such jurisdiction does not conflict with a principle of IL ii. QP before PCIJ has Turkey acted in conflict with the principles of IL by instituting criminal proceedings against a French officer arrested on the high seas? iii. HELD: reject French arg, finding Turkey is not required to cite a rule of IL authorizing its exercise of jurisdiction and that Turkey has not acted in conflict with the principles of IL 15 Prof. Halberstam www.swapnotes.com International Law Outline 1. All that can be required of a state is that it should not overstep the limits which IL places upon jurisdiction; otherwise, state free to exercise jurisdiction based on its own sovereignty 2. No rule of IL prohibited Turkey from acting the way it did a. Not necessary to consider the arg that a state cannot punish offenses committed abroad by a foreigner by reason of the nationality of the victim (only applies when the nationality of the victim is the sole criterion on which jurisdiction of the state is based) iv. Current rule as to prosecution for high seas collision 1. Based on Art 11 of the 1958 Convention on the High Seas and Art 97 of the UN Convention on the Law of the Sea 2. "In the event of a collision...no penal or disciplinary proceedings may be instituted against such persons except before the judicial or administrative authorities either of the flag state or of the state of which such person is a national" v. Legality of the threat or use of nuclear force ICJ considers the scope of the Lotus decision 1. States are free to threaten or use nuclear weapons unless it can be shown that they are bound not to do so by reference to a prohibition in either treaty law or custom 4. Ethereal Effects a. United States v. Aluminum Co. of America i. FACTS: Prosecution for violation of the Sherman Act. One of the defendants, a Canadian corporation, formed to take over properties of Alcoa outside the US. Court concluded that Alcoa was not a party of the Alliance, the foreign cartel organized to effect US markets. ii. ISSUE: whether Congress intended to attach liability under the Sherman Act to conduct outside the US by persons not in allegiance to the US iii. HELD: US can regulate foreign activities if the activities are intended to have an effect on US and do, in fact, have an effect 1. Sherman Act does not cover agreements, even though intended to affect imports or exports, unless its performance is shown actually to have had some effect upon them. Both conditions must be satisfied. 2. Court finds the Alliance's agreement violated the Sherman Act (intended to have an affect on US commerce and did have an effect) b. American Banana Co. v. United Fruit Co. (S.Ct. 1909) shows how rigidly the anti-extraterritoriality presumption was applied during the 19th century and the first two decades of the 20th i. FACTS: plaintiff is an AL corporation and defendant is a NJ corporation. Defendant monopolized and restrained the banana trade. Plaintiff bought a banana plantation, which was seized by Costa Rican soldiers. Defendant, by outbidding, has driven purchasers out of the market and has compelled producers to come it is terms, preventing plaintiff from buying for export and sale. Plaintiff argued the defendant and Costa Rican gov't involved in a conspiracy resulting in driving plaintiff out of business ii. HELD: court dismisses plaintiff's complaint for failure to state a cause of action. 1. Acts done outside the jurisdiction of the US. The character of an act as lawful or unlawful must be determined wholly by the law of the country where the act is done. 2. Can't interfere with the authority of another sovereign c. Hartford Fire Ins. Co. v. California i. FACTS: Sherman Act makes every K, combination, or conspiracy in unreasonable restraint of interstate or foreign commerce illegal. Plaintiffs allege that both domestic and foreign defendants violated the Sherman Act by engaging in activities to affect the American ins mkt. ii. HOLDING: most of the domestic defendants' conduct is not immunized from antitrust liability and that the principle of international comity does not preclude District Court jurisdiction over the foreign conduct. 1. Court overrules Banana finding the Sherman Act applies to foreign conduct that was meant to produce and did in fact 16 Prof. Halberstam www.swapnotes.com International Law Outline produce some substantial effect in the US (here the defendants were cornering the market) a. Notice all the Court is doing is interpreting US law (what Congress intended of the Sherman Act) 2. Court of Appeals agreed that it should look to international comity and that application of American antitrust laws to the London reinsurance mkt would lead to conflict with English law and policy a. Such conflict, unless outweighed by other factors, would by itself be reason to decline jurisdiction. But here other factors existed outweighing the supposed conflict and requiring the exercise of jurisdiction (like the London reinsurers' express purpose to affect US commerce and the substantial nature of the effect produced) iii. Scalia's DISSENT: 1. Agreed with the majority that the court had adjudicatory jurisdiction and that Congress did possess legislative jurisdiction to regulate the defendants' London activity. However, the question was whether Congress had actually done so, which depended on how one delineates the extraterritorial reach of the Sherman Act. a. An act of Congress ought not to be construed in a way that violates the principles of IL, including international comity, which is traditionally part of COL theory 2. Defendants' activity took place primarily in UK. Defendants are British corporations having their principal place of business outside the US. UK has established a comprehensive regulatory scheme governing the London reinsurance market and has a heavy interest in regulating the activity. 3. This interpretation of the Act is inconsistent with the rule of reasonableness of the Restatement a. Prob with this dissent is Scalia's reliance on the Restatement in discussing IL d. Extraterritorial Principles i. Presumption against extraterritoriality ii. Courts must determine whether Congress really intended for its laws to extend beyond its own territory iii. However general and comprehensive the phrases used in municipal laws may be, they must always be restricted in construction to places and persons upon whom the legislature has authority and jurisdiction. iv. Has the principle against extraterritoriality been abandoned with this decision? v. Rule of Reasonableness 1. Limits the impact of extraterritorial jurisdiction by providing that even where a basis for jurisdiction applies, it should not be asserted if such assertion is unreasonable or exorbitant 2. Think of busting drug dealers from another country before the drugs reach the US. Does the US have jurisdiction as long as their intent was to violate US law or territory? vi. US has tried to exclude domestic economic impacts resulting from external conduct such effects, although not palpable like those resulting from a bullet, are harmful and may be considered "territorial." If the econ activity produces discernible and serious econ damage, shouldn't there be jurisdiction? ii. Nationality 1. Permits a state to prescribe rules of conduct for nationals even when they are outside its territory a. Rationale nat'l sovereign pride and honor are tainted when a national commits an offense abroad b. Assumes that the national's own system of justice is more appropriate and fair to apply to nationals c. The US does not refuse to extradite its nationals 2. Active personality principle provides jurisdiction over a state's nationals 3. Passive personality principle provides jurisdiction over those who injure a state's nationals, i.e., focusing on the nationality of the victim 17 Prof. Halberstam www.swapnotes.com International Law Outline a. Rationale: b/c crim law has as its essential object to protect public and private interests, the victim's national system has the better appreciation of what protection should be afforded b. US finds this the most controversial bases of jurisdiction for fear that it could lead to indefinite criminal liability for its own citizens i. Objection based on belief that foreigners visiting US should comply with US laws and shouldn't be able to carry their own laws with them. Otherwise, Americans would face crim prosecution for actions unknown to them as illegal. c. The Cutting Case Letter, Sec of State to US Ambassador to Mexico i. FACTS: US Ambassador instructed to demand the Mexican gov't to release Cutting, a US citizen, imprisoned on the charge of libel for a publication in TX against a citizen of Mexico. Cutting allegedly circulated the article in TX and some in Mexico ii. ARGUED: citizens of the US cannot be held answerable in foreign countries to offenses which are wholly committed and consummated either in their own country or in other countries not subject to the jurisdiction of the punishing state 1. Can't prosecute Cutting merely b/c the person offended by his actions was a Mexican d. US v. Yunis (172) i. Jurisdiction based on nationality of the victim 1. Each state has a legitimate interest in protecting the safety of its citizens when they go outside national boundaries. 2. B/c American nationals were on board the Jordanian aircraft, the gov't contended that the Court may exercise jurisdiction over Yunis ii. Passive personality limited in its acceptance; now it's in the Hostage Convention and Terrorism on the High Seas 1. the state of the nationals/victims has an interest when the target is chosen solely b/c of the citizenry of the nationals e. Omnibus Anti-Terrorism Act i. Terrorist Acts of Violence Abroad Against US Nationals ii. Provides jurisdiction to US in cases where there are certain crimes committed against US nationals extraterritorially iii. Limitation on Jurisdiction no prosecution except on written cert of the AG, finding that such offense was intended to coerce, intimidate, or retaliate against a gov't or civilian population 1. less elements of the crime need to be est it's hard to prove that someone intended to do something (tough burden of proof) 4. Ascribed personality nationality where a state's nationality is ascribed to a legal person like a ship or a corporation a. The nationality of these entities provides a basis for jurisdiction the scope, though, is not the same as that for nationality of a natural person b. Jurisdiction to enforce the rules prescribed accompanies the vessels, aircraft, or military services wherever they go c. Corporations have the nationality of the place of their incorporation 5. Realsystem emphasized the role of the state's duty to protect its sovereignty, dignity and security, which were infringede when a nat'l committed a crime or was the victim of a crime. 6. Samuel Sheinbein Case arose in the US and Israel a. Israel refused to extradite a national but prosecuted him. Sam was a dualnational. The US sought his extradition but Israel's law forbade extradition of Israeli nationals so the request was denied. The Supreme Court, in a 3-2 decision, held that he was a national, that he could not be extradited, but that the law on extradition on this point should be changed. Israel amended its law to allow extradition of nationals on condition that they would be allowed to serve their sentences in Israel. iii. Protective Principle extraterritorial conduct affecting important state interests 1. A state has jurisdiction to prescribe a rule of law attaching legal consequences to conduct outside its governmental functions provided the conduct is generally recognized as a crime under the law of states that have reasonably developed legal systems 18 Prof. Halberstam www.swapnotes.com International Law Outline a. All elements of the crime occur in a foreign country and jurisdiction exists b/c these actions have a potentially adverse effect upon security or gov't functions; no effect in the country required, unlike the territorial principle b. Requires no territorial nexus; focus on the nature of the interest that is or may be injured rather than the territory upon which the conduct or its effect occur. i. But conduct must injure or threaten to injure the state's sovereignty, security, or an important gov't function 1. even if it's outside the state, if it threatens the above, the territory can assert jurisdiction 2. hostage taking, terrorism both meet this test ii. This principle is the only accepted theory that allows jurisdiction over conduct that poses only a potential threat to the interests of the asserting state in other words, no actual effect is needed to assert jurisdiction c. US used to apply this principle sparingly, but it has found acceptance in IL (Restatement 403). Used when you can't apply another bases of jurisdiction. 2. US v. Pizzarusso a. FACTS: Defendant lied in an application for a Visa to enter the US. Defendant not a national of the US and the act is outside the territory. i. There is no victim so can't use passive personality theory. ii. Lying probably doesn't undermine the national security of the US; doesn't even threaten the sovereignty of the US. iii. Protective principle used to deal with people who do something outside the country but is somehow contrary to government functions. b. ISSUE: question of jurisdiction of the DC to indict and convict a foreign citizen of knowingly making a false statement under oath in a visa application to an Amer consul located in a foreign country c. HELD: US has jurisdiction. PP applicable b/c the conduct of aliens abroad had a "potentially adverse effect" upon an important governmental function i. Court could have held that an effect in the territory had taken place when the aliens entered the US 3. Constitutional Limitations on Extraterritorial Jurisdiction: US combines jurisdictional bases as factors to determine where a sufficient nexus exists b/w a defendant and the US to satisfy due process iv. Universality 1. Any country can invoke jurisdiction regardless of whether person is its national, where the act occurred, who the victim was, etc., i.e., even where none of the bases of jurisdiction are present a. Act is so heinous it offends all of humanity b. Any state, if it captures the offender, may prosecute and punish that person on behalf of the world community 2. 1987 Restatement, 404 state has jurisdiction to define and prescribe punishment for certain offenses recognized by the community of nations as of universal concern a. Ex: piracy, slave trade, attacks on or hijacking of aircraft, genocide, war crimes, and perhaps certain acts of terrorism 3. Theory says that some conduct, wherever it occurs, creates jurisdiction and an obligation to prosecute or extradite in any nation that obtains custody of the perpetrator a. Many offenses are made universal by treaties to which virtually all nations are parties. These treaties must be consulted to determine the requirements for a state, which otherwise would have no jurisdiction, may participate in the repression of the particular crime 4. "Terrorism" does not have one definition a. Aim is to induce a state of fear in the victim b. Acts that are ruthless and does not conform to humanitarian norms 5. Three categories under which a terrorist attack has jurisdiction under IL: a. Universal ex. Pirate is the enemy of all mankind b. Passive personality state whose victims are on the place, on the ship, etc. c. Protective principle if someone seizes ship of a particular country, that's an attack on that particular government 6. US v. Yunis -- infra passive personality principle a. FACTS: Defendant, national of Lebanon, hijacked a Jordanian civilian aircraft in the Middle East. Aircraft never flew over US and had no contact with US territory. b. ISSUE: How are crimes classified as heinous and do aircraft piracy and hostage taking fit into this category? 19 Prof. Halberstam www.swapnotes.com International Law Outline c. HELD: Treaties and conventions find these crimes heinous for purposes of asserting universal jurisdiction i. Many states have signed/ratified these treaties, indicating that this has become generally accepted and you don't need to look to see if the universality principle applies. Even if a particular state hasn't ratified, that state is still bound by it b/c it has become part of customary law. ii. Not enough that there would be jurisdiction under IL; Congress still needs to give the courts statutory permission to act in the particular case 7. UN Resolution on international terrorism Resolution 40/61 (pg.183) a. GA unequivocally condemns all acts/practices of terrorism wherever and by whomever committed b. GA then says nations are allowed to fight colonialism and exercise its right to self-determination (this was done for places like Algeria, Nigeria, Congo, etc.) c. Years later GA started to denounce terrorism without adding in exceptions based on political motives. v. Restatement 402 1. 402 says even if there is jurisdiction under one of the bases subject to limitations under 403 2. Even when one of the bases of jurisdiction under 402 is present (all except universality), a state may not exercise jurisdiction unless it is reasonable. a. Factors: conflicting regulations with another state, length of activity, extent to which activity takes place in territory, substantial effects, 3. Only if the court finds that there is jurisdiction and that the act does constitute an offense, that it gets into the calculus under the Restatement. Court has to determine if it's reasonable/unreasonable. Congress ought to consider these factors. Can a court do this on a case by case basis. Can't hold hearings and gather all the evidence. Even if the court decides that it is reasonable, there's another hurdle. The Restatement says the court must defer the case if another state has a greater interest. Is this appropriate? Hand says in the Alcoa case that once Congress gives the court jurisdiction, the courts are obligated to exercise it. The Restatement is suggesting the opposite. 4. Very controversial sections of the Restatement. IV. SOVEREIGN IMMUNITY a. Immunity of the state and immunity of certain persons i. Rationale: If you could sue ambassadors, they'd be too busy defending in court they wouldn't be able to do their jobs b. Types: i. For a while states had "absolute sovereign immunity" can't sue no matter what ii. Restrictive immunity c. Public acts (jure imperi) v. private acts (jure gestionis) i. Sovereign has immunity for public acts ii. Ex: Italy ordered boots for its army. Italy was sued. Is the gov't's order of boots for the army a public or private act? 1. Private focus on the act buying boots is commercial; dealing with a vendor 2. Public focus on the purpose supplying military with necessary goods d. State dept determination court bound by what this dept says; if the dept is silent, immunity cannot be granted i. Problem with this is that the dept's decision has nothing to do with immunity theories; state has its own interests ii. Client wouldn't be there. State not doing a judicial hearing done ex parte so plaintiff cannot be heard. e. 1976 Foreign Sovereign Immunities Act i. Who decides questions of immunity? Answer: the court (see 1602) no longer by the state dept ii. Which theory of sovereign immunity does the act adopt? Answer: restrictive iii. Does the act provide the circumstances under which states have immunity? 1. The act provides instances when the state will not have immunity 2. If you want immunity, must show that one of the exceptions apply 3. Look at the nature of the act a. There would be no immunity in the buying the boots Italian example iv. Exceptions 1. Waiver a. Express: State X saying "X hereby waives all rights to immunity" 20 Prof. Halberstam www.swapnotes.com International Law Outline b. Implied/Implicit: if the party shows up in court and starts defending w/o raising the immunity issue 2. Commercial Activity (most commonly used exception). Three categories: a. Act is in US b. Act in US is not the commercial activity but is done in connection with a commercial activity somewhere else c. Commercial activity done outside the US but has an effect in the US 3. Rights of property taken in violation of IL a. Property doesn't have to be in US; just exchange for it b. If the property or the money never end up in US, then one can't sue c. Keep the Hickenlooper amendment in mind 4. Inherited Property 5. Torts a. Limitations personal injury or death or loss of property must occur in US b. Example: PanAm flight hijacked and crashed in Scotland. Can't sue based on tort exception b/c the accident didn't happen in US. But could make argument that it was a US plane so it should be treated like a US ship, which is US territory. 6. Arbitration a. Can bring a civil action against a foreign state for an act of terrorism provided the state has been designated as a "terrorist state" by the state dept b. This amendment was added precisely b/c of the Libya case c. 6-7 states have been designated as terrorist states Iraq, Syria, Iran, Libya d. If you got a judgment, can enforce against property found in the US. But the US has frozen these assets. State dept argues people who get judgment against these nations should not be able to get these assets either. But the assets were frozen for this very purpose! i. Contradiction protects terrorist states more than any other. If I sue France, I could get a judgment and collected. Not letting people collect the assets undermines the purpose of freezing the property in the first place. v. Counterclaims in addition to the various exceptions, one can sue based on counterclaims (1607) 1. Does the counterclaim have to be arising out of the same events or actions or transactions as the lawsuit against you? NO 2. Is the amt can you recover under a counterclaim limited by the amt of the lawsuit brought against you? NO 3. If they don't have immunity, you aren't getting jurisdiction b/c it's a counterclaim; getting jurisdiction b/c it falls under one of the exceptions vi. HYPO: class action brought in US against a French RR Co. for transporting people during WWII to the death camps (jews and non-jews including pilots shot down over France). French got money per head. Trains packed. Sued in NY. French claim foreign sovereign immunity. The RR is completely owned by the French gov't. vii. Separate Entities Rule even if a company is wholly owned by gov't that entity could be sued. 1. Could make argument based on 1602 "...claims of foreign states to immunity should henceforth be decided by courts of the US and of the States in conformity with the principles set forth in this chapter." 2. General assumption that statutes are not retroactive unless Congress specifically says so a. Retroactivity raises vest rights and constitutional problems viii. Is the Foreign Sovereign Immunities Act substantive or procedural? f. Argentine Republic v. Amerada Hess Shipping Corporation i. FACTS: Liberian ship bombed in international waters. Argentina sued in federal court in the US and claimed sovereign immunity Plaintiff tried to use the Alien Tort Claims Act 1350 as a basis of jurisdiction: 1. DC has orig jurisdiction of any civil action by an alien for a tort only, committed in violation of the law of the nations or a treaty of the US a. Action has to be brought by an alien b. Only good for torts c. Tort has to be against IL 2. To get jurisdiction, must proved substantive fact (that action violated IL). This statute has been invoked very few times. Nobody knows why Congress adopted this Act. ii. Holding: Foreign Sovereign Immunities Act provides the sole basis for obtaining jurisdiction over a foreign state in the courts of the US 1. None of the enumerated exceptions to the Act apply to the facts of this case 21 Prof. Halberstam www.swapnotes.com International Law Outline 2. Think of sovereign immunity like a SOL defense a. If SOL has expired and the other party asserts it, you don't have jurisdiction. It's not b/c the court wouldn't have power, it's power something prevents the Court from exercising its power. Here, the torts claim does exist, the court just can't hear the claim as against this defendant. g. Republic of Argentina and Banco Central De La Republica Argentina, Petitioners v. Weltover, Inc. i. FACTS: Because of inflation of Argentine currency, country had troubles borrowing US money. Argentine entered a K to sell US dollars. Couldn't meet its Ks so it refinanced with Argentine bonds to creditors. They agreed to pay for the bonds at the creditors request in NY in dollars. Argentine didn't have enough dollars so the creditors, fed up and wanting to get paid, sued in fed court in NY. Argentina claimed sovereign immunity. 1. If you want an exception to sovereign immunity, have to prove it. Plaintiff claimed 1605(a)(2). Have to show activity is commercial a. Could argue this was a public act and thus not a commercial activity. Look at 1603(d) which requires the court to look to the nature of the transaction and not its purpose. b. The nature here is issuing bonds, which is something private companies can do c. The breakdown is no longer public/private look at nature and not purpose of act 2. Direct effect in US simply b/c money to be paid in NY was NOT paid in NY h. USA v. The Public Service Alliance of Canada i. FACTS: No strike clause for Canadian employees. US base was in Canada. Suit was brought in US saying the no strike clause violated US law as did the prohibition on unionizing. ii. ISSUE: is the US entitled to sovereign immunity in an action involving routine employees at a military base? iii. HOLDING: US has sovereign immunity 1. Court really looking at purpose of the Act even though they should be examining the nature -- sometimes the two are interrelated i. Saudi Arabia v. Nelson i. FACTS: Nelson hired in US to work in Saudi Arabian hospital. He alleged he was detained and tortured by Saudi Arabian authorities. He brought the action in SDNY claiming the Saudi gov't violated his human rights. ii. HOLDING: suit couldn't be maintained under FSIA b/c the conduct of which Nelson complained (a beating) was not based upon commercial activities but upon abuse of sovereign power; imprisoning someone is a sovereign act 1. the Act requires more than a mere connection with or relation to commerce for conduct to be based on commercial activity 2. 1605(a)(2): "action is based upon a commercial activity...performed in US in connection with a commercial activity of the foreign state elsewhere" recruiting or hiring Nelson is the act in US and running hospital is the act occurring outside the US 3. State dept arguing on the side of Saudi Arabia iii. White concurrence: focus on running the hospital and what they did to Nelson; those acts together are a commercial activity but it's not the type of activity that has substantial contacts with US 1. Rule from White's opinion - the commercial activity that you are suing on has to have substantial connection to US iv. Kennedy concurrence and dissent: arrest was a sovereign act; but he would reverse b/c the failure to warn Nelson when recruiting was part of a commercial activity in US upon which Nelson could sue v. Steven dissent: agrees with White that there was a commercial activity (running hospital) and contact with US (recruiting); can sue for something unrelated to these two things are long as they exist. vi. Bottom line country gets sovereign immunity with the State Dept so desires V. NATIONALITY a. Traditional bases of nationality: place of birth, parent(s) nationality, naturalization (apply for it) b. US nationality based on birth - Source is the US Constitution, 14th Amendment i. This is unusual. In Switzerland, you are a national only if your parents were nationals. ii. Congress can't take away someone's nationality. Nothing in the 14th that says the gov't can take away one's citizenship. iii. Having a parent who is a national of the country statutory citizenship conferred on the child (different rights that if born to citizenship); this can be taken away from the child c. Is it possible for a person to have two nationalities as of birth? YES, dual nationality, e.g., you are born in US and your parents are Swiss. 22 Prof. Halberstam www.swapnotes.com International Law Outline d. e. f. g. i. Advantages to dual nationality: 1. might be entitled to protection from both countries 2. choice of where you can live don't need any permission ii. Disadvantages: 1. Might have to serve in two armies both countries draft you 2. Might be charged with treason in one if the two countries are at war w/ each other 3. Double taxes iii. State of Effective Nationality 1. If a person has dual nationality, the state of effective nationality can sue the other state of nationality. So conversely, the other state of nationality cannot assert a claim against the state of effective nationality. a. the state that is not the state of effective nationality can sue other states though 2. Factors in determining state of effective nationality (598) a. habitual residence b. center of his interest c. family ties d. participation in public life e. attachment for a given country f. property g. serving in the armed forces h. passport i. where you are registered to vote It is also possible to be stateless w/ no nationality i. Advantages: Might not have to pay taxes ii. Disadvantages: 1. *Don't have a right to live anywhere 2. Don't get the protections 3. Hard to travel Re Immigration Act and Hanna (586) i. FACTS: Hanna born at sea. No record of his birth. The name of the ship which he was born and the particulars of her nationality or port of registry are unknown. Nobody knows who his father is. The ship landed in Canada. Canada immigrant officials want to deport him but to where? Court said it cannot confine him to the ship. ii. HELD: Hanna is a prisoner of the ship and it won't stand for that. The Court held that the Order was illegal. At the same time, the court said it cannot give him nationality. That question is for the immigration official. Hanna gets no answer here. The Universal Declaration of Human Rights says everyone has a right to nationality. But, no treaty or declaration requires states to give a person a nationality. What does it mean than to have a right? People get displaced and lose their nationality they can seek asylum but nobody can force a country to accept them. Law that determines nationality is up to each state themselves Nottebohm Case (Liechtenstein v. Guatemala) (three countries involved: Germany, Liechtenstein, Guatemala) i. FACTS: Born in 1905 in Germany. His parents and extended family lived in Germany. Business ties to Germany, too. Lived in Guatemala for 34 years. His business and nuclear family in Guatemala. No settled home, no prolonged residence, no intention of settling in Liechtenstein. The only links he has to Liechtenstein are the short sojourns he had when applying for naturalization. His property is seized in Guatemala. He had gotten naturalized before this. 1. Liechtenstein sues in the ICJ on his behalf. He can't sue himself. ii. ISSUE: whether country X has to recognize the nationality of a citizen of Y deemed proper under a country Y's domestic law (now this is a question of IL) iii. HELD: Guatemala is under no obligation to recognize a nationality granted to Nottebohm by Liechtenstein. Liechtenstein is not entitled to extend its protection to Nottebohm vis--vis Guatemala and its claim must be held inadmissible. The domestic law of each country decides nationality (See Tunis and Morocco case pg 601) iv. RULE: A state does not have to recognize the nationality conferred by another state if that other state is not the state of effective nationality. Here, the state of effective nationality is Germany. 1. The court is applying the rule here as if Guatemala is the state of Nottebohm's effective nationality. The effect of the court's ruling is to deny him any nationality at all. His ties are really w/ Guatemala. It makes sense that the lesser ties country cannot sue the greater ties country (citizen chose the greater ties one) v. This case is problematic. It does exactly the opposite of what IL would tell us to do. He has no right of protection. Interesting question is why didn't he have nationality of Guatemala? 23 Prof. Halberstam www.swapnotes.com International Law Outline 1. Prof would have found he had nationality of Liechtenstein. Court should have compared his ties to Germany and Liechtenstein not b/w Liechtenstein and Guatemala (he didn't have nationality there!!!) There has to be a genuine link for nationality for the court to order a country to recognize but there doesn't have to be a genuine link to get citizenship h. Discrimination Against Women i. OLD RULE: woman lost her nationality if she married a foreign national. Most states have ratified Art 9 of the Women's Convention than any other human rights act (w/ lots of exceptions/reservations) 1. # of Muslim states have ratified but said the convention doesn't apply to the laws that are contrary to Islamic laws i. Barcelona Traction, Light and Power Co., Ltd. (Belgium v. Spain) i. The state of incorporation can sue on behalf of a corporation. State of the majority of the shareholders cannot sue. If the start of incorporation is being sued, the question hasn't been answered yet whether this is ok or not. ii. Any state can sue based on a right that everyone has (e.g. against genocide) j. Nationality of a ship is its flag state -- have to have genuine link b/w the flag and the people on board VI. THE INTERNATIONAL LAW ABOUT INTERNATIONAL AGREEMENTS (855) a. Treaties are the most vital part of IL they promote trade and commerce, provide for common defense, promote friendship, cooperation in areas of international intercourse, protect and environment, protect the rights and interests of individuals. In international law, any state can enter into a treaty, including a law-making treaty. International treaties apply only to states which agree to them. b. The Vienna Convention on the Law of Treaties i. Art 2.1(a) defines treaty as "an international agreement concluded b/w states in written form and governed by IL, whether embodied in a single instrument or in two or more related instruments and whatever its particular design." ii. State Dept has stated, since 1973, the Vienna Convention to be a codification or at least good evidence of customary IL on treaties iii. The Exec and Judiciary have considered the Vienna Convention to be authoritative with respect to the executive's treatment of issues related to international agreements arising after May 22, 1969 iv. The argument has been made that the progressive development provisions of the Convention have been so widely accepted that they have been transformed into customary law v. The US has not ratified this Convention vi. The Convention requires that an international agreement meet the following criteria in order to be a treaty w/in its scope: 1. Must be b/w states 2. Must be in writing 3. Must be governed by IL c. Treaties i. In the US, treaties are concluded by the President with the advice and consent of the Senate. Senate ratification requires a 2/3 vote. ii. May alter, expand, or restate customary IL. iii. Mulitlateral agreements are used to make new law iv. Some treaties have constitutional characteristics (UN Charter and Treaty of Rome are examples); All treaties have K like elements (like the Louisiana Purchase) v. Topic of treaties: composed of the rights and obligations of the parties subject to two restrictions 1. Jus Cogens Limitation: the treaty may not set forth rights and obligations which conflict with jus cogens (the imperative norms of IL) 2. UN Charter Limitation: the treaty may not set forth rights and obligations which conflict with those obligations a member-state has undertaken under the UN Charter (Art 103) a. Ex. treaties condoning wars of aggression, slavery or genocide are prohibited vi. Treaties may be bilateral, multilateral, restricted multilateral, and general multilateral according to the # of contracting parties 1. Multilateral treaties: divided into two categories restricted and general. Restricted are agreements involving close cooperation among a limited # of states for specific purposes; the consent of all states is necessary to adopt the text of the treaty. General are open to all states w/in a large geographic region; more legislative in character and don't require unanimity for adoption or entry into force vii. Although a party has not yet ratified a treaty, it may have an obligation not to defeat the object and purpose of the treaty (Vienna Convention Art 18). 24 Prof. Halberstam www.swapnotes.com International Law Outline d. e. f. g. viii. Amendment of treaties found in Art 39 and 40 (a treaty may be amended by agreement b/w all the parties) and modification of treaties in Art 41 (can be made by a limited # of parties). ix. Grounds for invalidating a treaty: error, fraudulent conduct, corruption, coercion, conflict with peremptory norms, conflict with domestic law. See Art 48-52. 1. Note a treaty is void if it conflicts with a rule of jus cogens. Treaties contemplating genocide, slavery or the use of physical or armed force against the territorial integrity or political independence of any state are unenforceable as conflicting with jus cogens. x. Separability of treaty provisions (art 44) xi. Termination/suspension of treaties 1. can have a fixed duration 2. parties can agreed to terminate it (art 54) 3. the purpose of the treaty is realized 4. breach, impossibility, frustration of purpose, change in circumstance Executive agreements are concluded by the President based on authority granted by Congress or based on the inherent authority granted the Pres by the Constitution. i. The Pres may not conclude executive agreements regulating areas clearly w/in the congressional domain. The regulation of foreign trade, for instance, is vested in Congress ii. The Pres may conclude exec agreements extinguishing US nationals' claims against foreign countries (See Dames v. Moore & Regan). iii. It is possible for an agreement to be denied legal force and effect under US domestic law and yet still be binding under IL Some international agreements are regards as executed internationally as b/w the parties when made (boundary treaties). While others are executory, such as the mutual promises of the members of NATO to consider an attack on one an attack on all and to respond effectively. Still others may require implementing legislative. Treaties and the EU i. Modern use of treaties to create international structures like those underlying the EU ii. Est new institutions and bind member states to uniform course of action. iii. The treaties made under EU law are superior to member states' national laws in enumerated situations and provide for centralized budgeting and financing of important activities International Agreements as Bases of Legal Rights and Duties i. Pacta Sunt Servanda, The Standard of Performance 1. rule that a treaty undertaking should be performed in good faith a. good faith performance is required regardless of any conflicting domestic law, which does not excuse a state from its treaty obligations unless the state's consent to be bound by the treaty was expressed in violation of the state's domestic law and the violation was manifest and concerned an intern law of fundamental important (VC, Art. 46). 2. seen as a rule of customary IL ii. Uberrima fides another standard of "utmost fidelity" iii. Art 26 of VC adopted PSS iv. Yalta Conference, agreement regarding entry of the Soviet Union into the war against Japan, Feb 11, 1945 -- Great Powers agree USSR will enter into war on the side of the Allies v. Legal Status of Eastern Greenland Denmark v. Norway (PCIJ, 1933) 1. Danish Court, relying on Art 36, paragraph 2 of the Statute, brought before the PCIJ a suit against the Norwegian gov't on ground that Norway had published a proclamation declaring that it had proceeded to occupy certain territories in Eastern Greenland, which Denmark says are under its sovereignty. a. Asking Court for judgment that the occupation = violation of the existing legal situation and is unlawful/invalid b. In support of its contention that the area occupied was subject to Danish sovereignty and could not be occupied by another power, the Danish gov't advances 2 ideas: i. Sovereignty over Greenland by D has existed for a long time has been continuous, peacefully exercised, never contested by another power (up until now) ii. Norway has by treaty herself recognized Danish sovereignty over Greenland as a whole and can't dispute it now 2. HELD: Norway is under an obligation to refrain from contesting Danish sovereignty over Greenland as a whole and to get out of the country 3. REASONING: Ihlen Declaration foreign minister of Norway wrote the Danish gov't a letter saying "Norway would not make any difficulty in the settlement of the Greenland question" which was that there would be no opposition to Denmark extending its political and economic interests to Greenland as a whole. 25 Prof. Halberstam www.swapnotes.com International Law Outline 4. DISSENT: whether the Norwegian constitutional law authorizes the Minister of Foreign Affairs to make the declaration does not concern the Danish gov't: it was Ihlen's duty to refrain from giving his reply until he had obtained any assent that might be requisite under Norwegian law. 5. NOTES: did the majority and dissent accept agency principles as part of IL? a. See VC art 7(1)(b) and art 47 about agency principles in this context vi. Free Zone of Upper Savoy and the District of Gex (France v. Switzerland) PCIJ, 1932 1. FACTS: France said Treaty of Versailles (1919) abrogated certain tariff-free areas w/in France on the border with Switzerland. Switzerland said that her rights in these areas had been provided international he post-Napoleonic settlement of Europe but various treaties stemming from the congress of Vienna (1814-15) 2. HELD: (i) Switzerland had sufficiently participated in the earlier arrangements as to have acquired rights as to the free zones; (ii) Treaty of Versailles not intended to abrogate these rights 3. Dictum on 3rd party rights: it must be decided whether the States which have stipulated in favor of a 3rd state meant to create for that state an actual right which the latter has accepted as such considered on a case by case basis vii. Jus Cogens compelling laws or peremptory norms of general IL 1. Some earlier writers on IL said that a treaty would be void if it was contrary to morality or to certain (unspecified) basic principles of IL. The logical basis for this rule was that a treaty could not override natural law. With the decline of the theory of natural law, the rule was largely forgotten. There are very few instances where jus cogens has been invoked. 2. Art 53 of the Convention of the Law of Treaties signed at Vienna provides that a treaty is void if, at the time of its conclusion, it conflicts with a peremptory norm of general IL. For the purposes of the present Convention, a peremptory norm of general IL is a norm accepted and recognized by the international community of States as a whole as a norm from which no derogation is permitted and which can be modified only by a subsequent norm of general IL having the same character. a. A norm from which no derogation is permitted b. Norm can be modified c. So a rule cannot become a peremptory norm unless it is "accepted and recognized by the international community" d. Possibly basic human rights could fall under the concept of jus cogens as a concern of all states 3. JC rule develops as customary international law not of treaty IL 4. Are there overriding restrictions on what states may do by international agreement? 5. SS Wimbeldon (866) dissenting judge says that by permitting the passage of the ship under flag of a neutral state carrying contraband, Germany would have violated the duties of the neutral ("it cannot have been the intention of the victorious states, he said, to bind Germany to commit offenses against 3rd states") 6. The negotiating history of JC at Vienna Kearney and Dalton, The Treaty on Treaties a. Discussion of Art 53 on treaties conflicting with a peremptory norm of IL (the Jus Cogen doctrine) b. 116 of Restatement: "an international agreement may be made with respect to any matter except to the extent that the agreement conflicts with, a) the rules of international law incorporating basic standards of international conduct" i. Prob leaves open the ? what is a peremptory norm or what is the basic standard of international conduct? c. Three categories of JC: i. Use/threat of force in contravention of the principles of the UN Charter ii. International crimes so characterized by IL iii. Acts/omissions whose suppression is required by IL d. Real prob was how to define the test for recognizing a rule of JC 7. Questions to think about: a. Is JC a general principle or a custom of the ICJ Statute article hierarchy of sources? b. How does the VC see it: custom or super-custom? c. Does it function like public policy or constitutional law? d. Does JC supersede domestic law? 8. The basic idea is that certain norms are so compelling as to be peremptory a. But what does that mean? Who/what decides which norms are peremptory? 9. VC art 53 defines a "peremptory norm" as one "accepted and recognized by the international community of states as a whole" h. Reservations to International Agreements 26 Prof. Halberstam www.swapnotes.com International Law Outline i. What are reservations and why are they made? 1. A state may try to become a party to a convention while excepting itself out of or modifying "unacceptable" provisions 2. VC, Art 2 d says a reservation is "a unilateral statement, however phrased or named, made by a State, when signing, ratifying, accepting, approving, or acceding to a treaty, whereby it purports to exclude or to modify the legal effect of certain provisions of the treaty in their application to that state." 3. State parties may accept reservations to increase world-wide participation but this may compromise the value/integrity of the convention 4. Reservations are NOT APPLICABLE to bilateral treaties because the terms of the treaty are tailored specifically to the interests of the two contracting parties. Either the parties accept one another's terms or they do not accept them 5. A reservation expressly permitted by the treaty does not require acceptance unless the treaty so provides (VC Art 20, 2). But when it appears from the limited number of the negotiating states and the object/purpose of the treaty that the application of the treaty in its entirety b/w all the parties is an essential condition of the consent of ea one to be bound by the treaty, a reservation requires acceptance by all the parties. ii. When are reservations put in? 1. Issue hot and disputed in the negotiating conference - reservations will be put forward by a state that has decided to be seen as the treaty community 2. Today signatures indicate that the negotiators have agreed to the text language. Even so, reservations are sometimes made at signature so as to give clear notice to the other states involved or to protect the negotiators from criticism at home 3. International agreement may provide that it's open for acceptance or accession by states that didn't participate in the negotiation a. Acceding state can make reservation at time of attempted accession 4. In some states, international authorization to be bound requires the consent of the legislative branch a. Legislative authorization may itself be conditioned upon reservations exec has no choice but to agree with leg if he wants to be a part of the treaty iii. Effect of reservation on other states 1. Acceptance of a reservation: If a state accepts the reservation, the treaty will enter into force b/w the accepting and reserving state. The modification is effective only b/w the reserving state and the accepting state, and is of no consequence b/w other parties to the treaty. 2. Objection to a reservation: if a state objects to a reservation, there are two possible outcomes: a. Objecting state still a party the treaty is in force b/w the objecting and accepting state but the provisions to which the reservation relates do not apply as b/w the two states to the extent of the reservation b. Objecting state refuses to be a party the reserving state and objecting state are not parties to the treaty vis--vis each other 3. Prob: shall State X be allowed to enter the treaty community on its altered version of the treaty or shall it be excluded? a. Substantive and procedural issues i. Pre-WWII rule prohibited State X to participate unless its reservation was unanimously accepted ii. Greater flexibility post-VC (see Restatement 313(2)(c)) b. growing trend to prohibit reservations iv. Permissible reservations according to Art. 19: A state may, when signing, ratifying, accepting, approving or acceding to a treaty, formulate a reservation unless: a. The reservation is prohibited by the treaty b. The treaty provides that only specified reservations, which do not include the reservation in question, may be made; or c. In cases not falling under sub-paragraphs (a) and (b), the reservation is incompatible with the object and purpose of the treaty v. Reservations to the Convention on Genocide (Advisory Opinion) 1. Issue: what kind of reservations can be made and what kind of objections may be taken to them at the Genocide Convention 2. Court first looks to the special characteristics of the Convention (its origins, intentions, etc.) a. Genocide = crime of IL, involving denial of right of existence of entire human groups; shocks the conscience of mankind; results in great losses to humanity b. Principles underlying the Convention are recognized by civilized nations as binding on states 27 Prof. Halberstam www.swapnotes.com International Law Outline c. Purpose of the Convention purely humanitarian and civilizing; thus, the it was the intention of the GA and of the States which adopted it that as many states as possible should participate in the Convention i. The exclusion of one of more states would detract from the authority of the moral and humanitarian principles which are its basis. The contracting parties didn't contemplate that an objection to a minor reservation would produce such a result. 3. HELD: (i) a State which has made and maintained a reservation which has been objected to by one or more of the parties to the Convention but not by others, can be regarded as being a party to the Convention if the reservation is compatible of the object and purpose of the convention; otherwise, that State cannot be regarded as being a party to the Convention; (ii) if a party accepts the reservation as compatible with the object and purpose of the Convention, it can consider that the reserving State is a party to the Convention. That an objection to a reservation made by a State which is entitled to sign or accede but which has not yet done so, is w/o legal effect vi. See hypos on 876 i. Interpretation of International Agreements i. The basic principles for interpreting treaties are: ordinary meaning in context, good faith, object and purpose ii. See Art 31 and 32 VII. Treaties and Other International Agreements in the Constitutional and Statutory Law of the US a. Constitution i. Article I, Article 10 no state shall entered into treaties ii. Article II, 2 President shall have power to make treaties provided 2/3 of the Senators concur 1. League of Nations is an example where the Senate vetoed the proposal for US to entered into a treaty 2. Framers didn't provide for a majority approval b/c they wanted it to be harder to enter into treaties; the framers wanted the leg and exec branches to be partners in foreign relations 3. Changing a treaty commitment is much harder than changing a domestic commitment (Senate can just amend or repeal one of its own statutes) iii. Article VI Supremacy Clause Constitution and the laws of the US and all treaties made under authority of US shall be the supreme law of the land. If the US fails to carry out a treaty obligation b/c of its unconstitutionality, it remains responsible for the violation of the treaty under IL 1. Ware v. Hylton a. The person here repaid the debt to a British subject by going to a US state loan office. He was told to pay the loan again. He said he already paid to the State of Virginia pursuant to US state law. Creditor argues that there is a treaty in existence b/w the British and the US which provides that loans have to be repaid to the debtor himself and not to the States. If there hadn't been a treaty, the creditor may not have won. b. HELD: even if VA had the power to confiscate the property, the treaty annuls the confiscation. c. This case proves that treaties supersede state law the poor debtor had to repay the loan twice. 2. Missouri v. Holland a. FACTS: brought by state of Missouri to prevent a game warden of the US from attempting to enforce the Migratory Bird Treaty Act of 1918. Treaty b/w the US and Britain prohibiting a certain kinds of migratory birds. There is a federal law that also prohibits the shooting of migratory birds. This is what was at issue here, the federal law and not the treaty. MO says the birds are property of the state and under the 10th Amendment they have reserved rights. MO says Congress didn't have the authority to pass the federal law under its Art 1, 8 enumerated powers. Congress had adopted a law prohibiting the shooting. This law went to the Cir. Ct., which said the law was unconstitutional. Now Congress trying to pass the law again. i. Necessary and Proper Clause "Congress shall have power to make all laws which shall be necessary and proper..." this gives Congress the power to carry out the enumerated powers and those powers vested in the gov't of the US 28 Prof. Halberstam www.swapnotes.com International Law Outline 1. so Congress can implement the powers of Congress and the powers of the other branches of the gov't, including the treaty power 2. Congress adopts the same legislation after the treaty is passed. This is ok b/c under the N&C Clause Congress can implement its own power and the treaty power. b. ISSUE: whether the treaty and statute are void as an interference with the rights reserved to the States c. MO should have argued that the treaty power is limited to those powers enumerated in the Constitution; otherwise Congress can adopt legislation that isn't enumerated in the Constitution (this could undermine federalism) d. HOLDING: i. US may adopt a treaty even if it deals with matters that are NOT enumerated to Congress in the Constitution ii. Congress can adopt legislation under N&C Cl to implement such treaties even if such legislation would be outside its enumerated powers e. Gov't said it wouldn't use this power in bad faith f. "Here a nat'l interest of very nearly the first magnitude is involved" in other words, Congress can't do whatever it wants. i. In order for a treaty to be valid, it has to be of international concern 1. the present Restatement doesn't have this requirement that treaties can deal with anything the US wants them to deal with 2. the international concern requirement could be met with anything a. think of all the human rights treaties we have everything has become a matter of international concern g. Is this case the basis for undermining federalism? i. Bricker Amendment tried to get rid of MO v. Holland ii. In reality, are there any limitations on the treaty power? iv. Amendment X Rights Reserved to States (1791) VIII. SELF-EXECUTING v. NON-SELF EXECUTING TREATIES a. The distinction concerns the issue whether an agreement should be given legal effect w/o further implementing national legislation and is relevant when a party seeks to rely on the agreement in a case before an American court. i. In the US, most treaties are not concluded under Art II with the consent of the Senate. They are "statutory" or "congressional-executive agreements" signed by the President under ordinary legislation adopted by a majority of both the HOR and Senate. ii. There are also treaties called "executive agreements" which the President concludes alone w/o the participation of Congress. b. In US, treaties have the same status as national statutes. They derogate pre-existing legislation but are overruled by statutes enacted later. Some constitutions even make treaties superior to ordinary national legislation and subordinate law. c. Foster v. Neilson i. FACTS: Defendant wanted his land back under terms of a treaty b/w the US and Spain. Treaty provided that all grants of land by the King shall be ratified and confirmed ii. ISSUE: whether the defendant was entitled to the land iii. HOLDING: Marshall held the defendant wasn't entitled to the land. By the language, it required an act of the legislature ("ratified"). He saw the words of the treaty as requiring someone to do something. He was distinguishing b/w two types of treaties one that provides that someone has to do something to give rights and one that gives rights off the bat. At this time, treaties didn't become the law of the land on their own the Legislature has to implement it. 1. In other states, a treaty is not a legislative act; it's not effective itself. It is carried into execution by the sovereign. In the US, a treaty can be effective immediately, but doesn't necessarily have to. 2. Spanish version said the treaty shall remain ratified and confirmed. So Marshall changed his mind and enforced the treaty. IX. HUMAN RIGHTS a. Human Rights Provisions of the UN Charter (665) i. Preamble: We the Peoples of the UN determine "to reaffirm faith in fundamental human rights, in the dignity and worth of the human person, in the equal rights of men and women and of nations large and small" conferring no substantive rights ii. Art 1(3): "The Purposes of the UN are (3) To achieve international co-operation in solving international problems of an economic, social, cultural, or humanitarian character, and in 29 Prof. Halberstam www.swapnotes.com International Law Outline promoting and encouraging respect for human rights and for fundamental freedoms for all without distinction as to race, sex, language, or religion" not giving any rights; just objs. iii. Art 2(7): "The Organization and its Members, in pursuit of the Purposes stated in Article 1, shall act in accordance with the following Principles: (7) Nothing contained in the present Charter shall authorize the United Nations to intervene in matters which are essentially within the domestic jurisdiction of any state or shall require the Members to submit such matters to settlement under the present Charter; but this principle shall not prejudice the application of enforcement measures under Chapter VII. iv. Art 55: "With a view to the creation of conditions of stability and well-being which are necessary for peaceful and friendly relations among nations based on respect for the principle of equal rights and self-determination of peoples, the United Nations shall promote: a. higher standards of living, full employment, and conditions of economic and social progress and development b. solutions of international economic, social, health, and related problems; and international cultural and educational cooperation c. universal respect for, and observance of, human rights and fundamental freedoms for all without distinction as to race, sex, language, or religion" *Just have to promote gives no rights v. Art 56: "All Members pledge themselves to take joint and separate action in cooperation with the Organization for the achievement of the purposes set forth in Article 55" 1. If this conferring a right? Yes, b/c the provision is mandating action for the benefit of individuals/nations. 2. Some commentators say this article imposes an international legal obligation on states to take immediate national action to correct internal HR deficiencies. Others claim that is serves merely as a statement of political principle that human rights are important 3. Some states wanted members to have to pledge "to take such independent action as they deem appropriate to achieve these purposes w/in their own territories." 4. US accepted art 56 w/o reservation to retain domestic jurisdiction over HR matters 5. Apartheid debate in S.Africa gives interesting meaning to this article and art 2(7)'s prohibition against intervention in domestic jurisdiction a. Traditional claim - how a nation treated its own citizens was its own business 6. Is Art 56 self-executing? a. In Sei Fujii v. State, it was held not to be a self-executing treaty. Court held that Cali's law that prohibited ownership of land by a Japanese citizen ineligible for American citizenship was unconstitutional under the 14th amendment. Court said the provisions of the charter pledging cooperation in promoting observance of fundamental freedoms lack the mandatory quality of definiteness which would indicate an intent to create justiciable rights in private persons immediately upon ratification. i. Did the provisions impose affirmative obligations? - NO b. Impact on Human rights i. A self-executing treaty is one that needs no implementing domestic legislation; it takes effect upon ratification. ii. In the US, if a treaty isn't self-executing or if Congress has not passed legislation if does not create a cause of action or provide a remedy. Thus if a treaty is non-self-executing, it provides no legal effect. Though it may influence policy or legislation. iii. Human rights conventions generally are not considered self-executing in the US. This hampers human rights protection generally and in relation to extradition iv. Is the idea of non-self-executing treaties inconsistent with the Supremacy Clause? 1. One arg: treaties do not have the force of law and may be ignored by the courts, citizens, and other state or federal officials who enforce domestic law 2. Counter: Supremacy Clause calls for a "default rule" whereby a treaty automatically will be considered the law of the land unless the treaty itself is entered with an explicit reservation that clearly provides that the treaty is considered non-self-executing 3. the reality in the US is that no human rights clauses are being incorporated and the traditional exemptions to extradition are being significantly restricted, rather than expanded v. To est whether treaties are self-executing 30 Prof. Halberstam www.swapnotes.com International Law Outline 1. courts look to the "intent of the signatory parties" language of the instrument and the circumstances surrounding; see if there are declarations and/or reservations 2. Treaties that condemn conduct as criminal are non-self-executing a. Torture Convention held to be non-self-executing b. Exception: Gallina v. Fraser court noted that three could be some "procedures or punishment so antipathetic to a federal court's sense of decency as to require reexamination of the exception to the principle of noninquiry. Some courts have discussed a possibility of a humanitarian exception to extradition. c. Art 3 of the Torture Convention has become part of the Foreign Affairs Reform and Restructuring Act so even thought the Torture Convention is not considered selfexecuting, art 3 has been enabled. vi. To protect individuals from being extradited, either a specific human rights clause barring extradition would have to be incorporated into each extradition treaty or the traditional exemptions to extradition would have to be expanded by interpretation to include more human rights protections. b. The Universal Declaration of Human Rights i. Adopted w/o dissent by the UN Gen Assembly, Resolution 217A(III) on Dec 10, 1948 by vote of 48 to 0. 1. Eleanor Roosevelt played a major role ii. Basic character of the document: it is not a treaty; not an international agreement. It is a declaration of basic principles of human rights and freedoms, to be stamped with the approval of the Gen Assembly by formal vote of its members, and to serve as a common standard of achievement for all peoples of all nations 1. Cannot be ratified just can be adopted 2. Soviet Union abstained from voting iii. Listed rights applicable to all human beings: equal protection of the law (art 7), right to fair and public hearing (10), to be presumed innocent (11) , to freedom of movement (13.1), right to seek and enjoy asylum (14), to marry and found a family (16), social security (22), to work, to form and join trade unions (23), to a standard of living adequate for health and well-being (25), to education (26), right to own property alone as well as in association with others; no one shall be arbitrarily deprived of his property (17), right to a nationality (15), right to leave any country (13) iv. Various covenants mentioned below taken off of this collection of rights v. If it had been legally binding it would have almost been a constitution for the world 1. It is binding as customary IL - especially the right to equality a. The Declaration has been recited and reaffirmed now that states take part in votes at the UN. States keep voting for it; those votes should be considered as creating customary law. b. Another arg says that not all resolutions become customary law, but when it is recited 100s of times, it becomes customary c. States are estopped from arguing it isn't binding, having voted for it over and over 2. Declaration interprets provision on human rights. But there's nothing in the Charter that gives the GA the authority to interpret the Charter. c. The Human Rights Covenants i. International Covenant on Economic, Social and Cultural Rights 1. Has NOT be ratified 2. Objectives: The aim of economic, social, and cultural rights is to guarantee people their rights as whole people. These rights are founded on a belief that we can enjoy our rights, our freedoms, and economic justice all at the same time. 3. The International Covenant on Economic, Social and Cultural Rights seeks to achieve and protect the most basic human rights for all people. Key Provisions Art 7, 8 a. the right to work (art 6) b. the right to form and join trade unions c. the right to just and favorable working conditions d. the right to an adequate standard of living e. the right to the best standards of physical and mental health f. the right to education g. the right of self-determination h. equal rights for men and women 31 Prof. Halberstam www.swapnotes.com International Law Outline i. the right to social security and social insurance j. the right to take part in cultural life k. the right to enjoy the benefits of scientific progress 4. The Committee on Economic, Social and Cultural Rights monitors how well countries establish or maintain these rights, and reports its findings to the Economic and Social Council each year ii. International Covenant on Civil and Political Rights 1. Has been ratified 2. Purpose: to develop friendly relations based on respect for certain principles: selfdetermination, equal rights 3. Art 1(a): All peoples have the right of self-determination. By virtue of that right they freely determine their political status and freely pursue their economic, social and cultural development. a. American Indians do they have the right to form their own nation? b. Self-determination sounds good, but we don't know what it really is and who is entitled to it i. How do you define a self? ii. How do you implement it? 1. Almost impossible to provide for self-determination in an objective way c. Possibilities to realize self-determination: decide to be part of another country, to be their own country, to join with another country d. It isn't desirable to have states disintegrate into lots of smaller states 4. Art 24: right to nationality 5. Art 6: right to life 6. Art 7: No one shall be subjected to torture or to cruel, inhuman or degrading treatment or punishment. In particular, no one shall be subjected without his free consent to medical or scientific experimentation. 7. Art 9: Everyone has the right to liberty and security of person. No one shall be subjected to arbitrary arrest or detention. No one shall be deprived of his liberty except on such grounds and in accordance with such procedure as are established by law. 8. Art 2 3: Each State Party to the present Covenant undertakes: a. To ensure that any person whose rights or freedoms as herein recognized are violated shall have an effective remedy, notwithstanding that the violation has been committed by persons acting in an official capacity; to ensure that any person claiming such a remedy shall have his rights thereto determined by competent judicial, administrative or legislative authorities, or by any other competent authority provided for by the legal system of the State, and to develop the possibilities of judicial remedy; b. To ensure that the competent authorities shall enforce such remedies when granted. 9. Does not prohibit death penalty 10. Many of the rights in the Bill of Rights found in the treaty d. US Ratification of the International Covenant on Civil and Political Rights i. See chapter on self-executing treaties ii. Insert class notes e. Human rights as customary international law 1987 Restatement, 702 i. A state violates IL if it practices/encourages genocide, slavery, murder, torture, prolonged arbitrary detention, systematic racial discrimination, a consistent pattern of gross violations of internationally recognized human rights f. Pursuit of human rights under customary IL in national courts i. Filartiga v. Pena-Irala (2nd Cir.) (718) 1. Landmark decision in its time. Paraguay citizen opposed to its gov't came to US to live there. She found out a gov't official killed her brother in Paraguay. She brought guy to NY and sued him for wrongful death. She alleged jurisdiction under the Alien Torts Act, which is a federal statute giving the 2nd Cir. jurisdiction. a. Aliens can use this to get jurisdiction but US citizens can't b. This was creative lawyering. 28 USC 1350 gives US jurisdiction to any alien over a person(s) who committed a tort in violation of the law of Nations or the US. Nobody knew why this statute was adopted and it wasn't used for some 100 yrs before this case. c. They claimed the rule of torture was violated, which is a violation of IL (today this wouldn't have been a prob b/c there's a treaty on torture. There was a UN Resolution prohibiting torture. Study by Amnesty International that most states 32 Prof. Halberstam www.swapnotes.com International Law Outline engage in torture as a state practice. Nevertheless, the judge found torture is a violation of the law of Nations. 2. For the first time, a domestic court heard alleged violations of human rights - and gave a remedy! ii. INSERT CASE NAME (725) 1. District Court took position that court didn't have jurisdiction b/c IL only applies to states and not individuals. Cir. Ct. goes through various areas of law to show IL DOES applies to individuals. Full circle how IL has developed in the human rights context. District Ct. ignorant of IL. g. Genocide Convention i. Convention on the Prevention and Punishment of the Crime of Genocide. Adopted by the U.N. General Assembly (9 December 1948). ii. Doesn't list political groups this was deliberate b/c the purpose of the convention was to protect people b/c of their national, ethnical, racial or religious group 1. most conflicts today involve dual reasons political + one of the groups above 2. If political conflict is included, then 99% of all conflicts would fall under the definition of genocide iii. Article II. In the present Convention, genocide means any of the following acts committed with intent to destroy, in whole or in part, a national, ethnical, racial or religious group, as such: a) Killing members of the group; b) Causing serious bodily or mental harm to members of the group; c) Deliberately inflicting on the group conditions of life calculated to bring about its physical destruction in whole or in part; d) Imposing measures intended to prevent births within the group (i.e., sterilizing) e) Forcibly transferring children of the group to another group iv. Article III. The following acts shall be punished: a) Genocide; b) Conspiracy to commit genocide; c) Direct and public incitement to commit genocide; d) Attempt to commit genocide; e) Complicity in genocide. v. Just saying "kill all the X" isn't prohibited have to prove imminent likelihood vi. Reservation: nothing in the convention requires the US to do anything that is a violation of the US Con as interpreted by the US 1. The purpose of the convention isn't to prevent incitement, it's to prevent genocide. vii. Anyone can be held responsible for genocide including heads of state (art iv) viii. Genocide and the Head of State 1. Leader of the gov't most likely to be guilty of genocide b/c they are instructing the armies. 2. But the tribunal of a state isn't going to try its own head of state remedy isn't meaningful. See Art VI. 3. No international tribunal established to try these leaders. So the convention doesn't have enforcement teeth. 4. Art IX gives the ICJ the power to interpret the treaty doesn't give ICJ authority to hear criminal trials. ix. Argument that US couldn't ratify b/c the individual US states have rules just like the convention provision 1. Missouri v. Holland counters this x. This treaty deals with how a state treats its own citizens it is NOT matter of international concern. 1. Reply: so many states have ratified that it has become a matter of international concern 2. Senate gave its advice/consent in the 80s Reagan ratified the treaty on behalf of US in 1988. It was the first human rights treaty the US ratified. xi. Senate Resolution Giving Advice: Part III. Instead of making the treaty non-self-executing, the Senate said that Congress has to first adopt the implementing legislation and then the Pres can ratify it h. Convention on the Elimination of all Forms of Racial Discrimination: i. Convention on the Elimination of all Forms of Discrimination Against Women: i. Adopted in 1979 by the UN General Assembly - often described as an international bill of rights for women. 1. Has not been ratified ii. Defines what constitutes discrimination against women and sets up an agenda for national action to end such discrimination. iii. Discrimination against women = "...any distinction, exclusion or restriction made on the basis of sex which has the effect or purpose of impairing or nullifying the recognition, enjoyment or exercise by women, irrespective of their marital status, on a basis of equality of men and women, of human rights and fundamental freedoms in the political, economic, social, cultural, civil or any other field." 33 Prof. Halberstam www.swapnotes.com International Law Outline iv. By accepting the Convention, States commit themselves to undertake a series of measures to end discrimination against women in all forms, including: 1. to incorporate the principle of equality of men and women in their legal system, abolish all discriminatory laws and adopt appropriate ones prohibiting discrimination against women; 2. to establish tribunals and other public institutions to ensure the effective protection of women against discrimination; and 3. to ensure elimination of all acts of discrimination against women by persons, organizations or enterprises. v. The Convention provides the basis for realizing equality between women and men through ensuring women's equal access to, and equal opportunities in, political and public life -including the right to vote and to stand for election -- as well as education, health and employment. States parties agree to take all appropriate measures, including legislation and temporary special measures, so that women can enjoy all their human rights and fundamental freedoms. vi. The Convention is the only human rights treaty which affirms the reproductive rights of women and targets culture and tradition as influential forces shaping gender roles and family relations. It affirms women's rights to acquire, change or retain their nationality and the nationality of their children. States parties also agree to take appropriate measures against all forms of traffic in women and exploitation of women. j. Countries that have ratified or acceded to the Convention are legally bound to put its provisions into practice. They are also committed to submit national reports, at least every four years, on measures they have taken to comply with their treaty obligations k. Helsinki Accords (1973) i. Neither a treaty nor a binding document on any participating state. It was a statement by the Soviet Union, other European states, and some Western counties. 1. Something the SU wanted for a long time, but the West resisted. ii. Many thought this was another instance of where the West was duped by the SU. All the West got was a statement about human rights, which the SU wasn't going to do anything about anyway. While SU got right to stay in Turkey and other eastern parts of Europe 1. Turns out the human rights portion of the accords are the blueprint for many future human rights conventions. 2. Demand for SU to comply with the human rights provisions of the Helsinki Accords some say this was the end of communism iii. States meet every so often for a conference and they issue new reports example is the Copenhagen Meeting of the Conference on the Human Dimension of the CSCE 1. Not a treaty; didn't involve all countries but it did involve Western countries, eastern countries, Japan, Germany, etc. 2. The purpose of gov't, according to art 1 1, is to protect and promote human rights and fundamental freedoms. It says you need a democracy to accomplish this (art 1 3 says "democracy is an inherent element of the rule of law). Basic tenets of western democracy: a. Need a freely elected gov't (only gov'ts like this are legitimate art 6) b. Form of gov't that is representative in character c. Gov't must be subject to rule of law 3. Detailed rules on how to hold free elections included 4. Art 6 PROF thinks there is a right and responsibility for other states to come to the aid of those states that don't have free elections l. The Helsinki Final Act (1975) i. Aimed at opening lines of communication 1. Covers matters of security in Europe; cooperation in fields of science, econ, tech, environment; cooperation in humanitarian effort 2. Important outcome assurance that borders would not be disturbed by force ii. Follow up doc in 1983 iii. Principle VII of the Declaration of Principles seeks to tie the signatory states to international law says the signing states will act in conformity with the principles/purposes of the UN Charter and w/ the Universal Declaration of Human Rights X. USE OF FORCE a. What was the law on the use of force before the UN? i. Nothing before Kellogg-Brant Pact (of 1928) that said war is illegal. Just had something that regulated treatment of civilians, types of weapons used, rights of neutral states, etc. 1. Nuremberg charter said planning a war is a crime. Doesn't define what is aggressive war. 34 Prof. Halberstam www.swapnotes.com International Law Outline 2. Major innovation of UN Charter was its prohibition on the use of force b. UN Charter i. Art 2, 4: All Members shall refrain in their international relations from the threat or use of force against the territorial integrity or political independence of any state, or in any other manner inconsistent with the Purposes of the United Nations 1. Does this apply only to military force or does it apply to economic force, too?, i.e., what if State A put economic pressure on State B? (this is called anticipatory self-defense) a. Could compromise the political independence of a nation if that nation is economically dependent on another state b. Policy Argument: the withholding of voluntary aid cannot be a threat of use of force c. Wording in other articles: Drafters aware of the distinction b/w armed force and regular force (in art 41 they use armed force but in art 2 4 they just said force implies economic pressure is a type of force) d. Legislative history e. Language in art 2 4 speaks of if an attack occurs. But if also talks about collective self-defense, which is done by prior agreements. How can you not have anticipatory if you have collective. There's inconsistency in the language. 2. What about boycotts? a. HYPO: Arab states officially declare a boycott from all products from Israel and a boycott of secondary companies that deal with Israel? 3. Bottom line you can attack before you've been attacked. But then you get the question how early or how long after the threat of attack can a state attack ii. Peaceful settlement (Art 2 3): All Members shall settle their international disputes by peaceful means in such a manner that international peace and security, and justice, are not endangered iii. Chapter VII of the UN Charter impose mandatory obligations on the states 1. Art 39: The Security Council shall determine the existence of any threat to the peace, breach of the peace, or act of aggression and shall make recommendations, or decide what measures shall be taken in accordance with Articles 41 and 42, to maintain or restore international peace and security 2. Art 41: The Security Council may decide what measures not involving the use of armed force are to be employed to give effect to its decisions, and it may call upon the Members of the United Nations to apply such measures. These may include complete or partial interruption of economic relations and of rail, sea, air, postal, telegraphic, radio, and other means of communication, and the severance of diplomatic relations 3. Art 42: Security Council can authorize the use of force -- Should the Security Council consider that measures provided for in Article 41 would be inadequate or have proved to be inadequate, it may take such action by air, sea, or land forces as may be necessary to maintain or restore international peace and security. Such action may include demonstrations, blockade, and other operations by air, sea, or land forces of Members of the United Nations 4. Art 51: Exception on the prohibition on the use of force Self Defense: "Nothing in the present Charter shall impair the inherent right of individual or collective self-defense if an armed attack occurs against a Member of the United Nations, until the Security Council has taken measures necessary to maintain international peace and security." 5. Examples Sec Council imposed non military and non economic sanctions on Libya; economic sanctions imposed on Iraq 6. If a state is acted it can use force until Security Council responds 7. How is the Security Council going to get armed forces? a. Art 43: i. All Members of the United Nations, in order to contribute to the maintenance of international peace and security, undertake to make available to the Security Council, on its call and in accordance with a special agreement or agreements, armed forces, assistance, and facilities, including rights of passage, necessary for the purpose of maintaining international peace and security ii. Such agreement or agreements shall govern the numbers and types of forces, their degree of readiness and general location, and the nature of the facilities and assistance to be provided. iii. The agreement or agreements shall be negotiated as soon as possible on the initiative of the Security Council. They shall be concluded between the Security Council and Members or between the Security Council and groups of Members and shall be subject to ratification by the signatory states in accordance with their respective constitutional processes. 35 Prof. Halberstam www.swapnotes.com International Law Outline iv. NOTE: there has never been such an agreement. We wanted the Security Council to have its own armed force. Never happened. c. Concept of Self-Defense at what point does a right to self-defense i. Daniel Webster's definition: self defense applies in cases "in which the necessity of that self defense is instant, overwhelming, and leaving no choice of means and no moment of deliberation" ii. Questions to consider: 1. When does the right to self-defense arise? 2. Can you only attack if and when you are attacked? 3. Do you have to wait until the bombs are flying? Some say yes and others say it would be suicide to wait until you are attacked. iii. UN Peacekeeping Force in 1967 1. Rhetoric about destroying Israel 2. Jordan puts planes near Israeli border. Egypt asked Jordan to join in attack on Israel. Israel asks for assurances by Jordan that it won't attack. Jordan refuses to give such assurances. Israel bombs Jordan planes. 3. What do you do with the language of Art 51 that says "if an armed attack occurs?" a. One could say it was ok that Israel attacked merely after threats b/c the country was living in a constant state of war since 1948 b. What about the way you define "armed" preparation, thought, propaganda part of it d. The right to self defense once the Security Action takes action i. Interpretation of the "until" clause in Art 51 of the UN Charter: does a state retain the right of self defense once the Security Council has taken measures to deal with the problem? 1. Some commentators take position that a country can defend itself until Security Council takes action but once the Security Council does act, the use of self defense by the victim state is barred (unless authorized by the Security Council), even if the measures taken by the Security Council didn't succeed in removing the aggressor 2. One commentator states that art 51 is not an affirmative grant of a right of self-defense but a statement of the situations in which the exercise of an inherent right is not precluded by the Charter. Those situations are subject to a limit of time they endure only until the Security Council has taken the measures necessary to maintain international peace and security. 3. Halberstam: it's hard to believe that all the nations that ratified the Charter all agreed to give up their right to self-defense in response to an armed attack once the Security Council takes action regardless of the action taken or of its success a. She thinks art 2 4 means the victim can continue to use self defense until the measures taken by the Sec Council in fact maintain international peace and security. ii. Self-defense as a fundamental right 1. right of a state to use force in self-defense has long been recognized by customary IL 2. it has been characterized as jus cogens, a tenet of natural law, and as an inherent right iii. The Language of Art 51 1. Formulated as an affirmation of, rather than as a limitation on, the right to self-defense 2. the authors of the Charter knew how to formulate language prohibiting the use of force iv. The legislative history indicates that the intent was to preserve a state's right to self-defense until the Sec Council had taken adequate measures to restore international peace and security e. GA Resolution 3314 on Aggression i. Art. 3 defines aggression 1. invasion or attack 2. bombing 3. blockade of ports 4. attack by armed forces on the land or sea 5. attack of armed forces which are w/in a territory (starts lawfully but becomes an act of aggression) 6. sending of groups ii. If there's a struggle for self-determination, is that a justification for committing these acts under the article defining aggression? 1. See Art 5 no consideration of whatever nature may service as a justification for aggression 2. See Art 7 nothing in definition should inhibit anyone if they are fighting for selfdetermination and, in fact, other countries should support them in their fight for freedom. *This articles are conflicting!! Can use one to take position that self-determination isn't permissible and the other to say it's ok 36 Prof. Halberstam www.swapnotes.com International Law Outline f. Nicaragua v. United States i. FACTS: the US claimed collective self-defense as a justification for various hostile acts towards Nicaragua 1. US didn't appear before ICJ so it couldn't counter Nicaragua's arguments. US had invoked its multilateral treaty reservations. One of the reservations the US made was that it wouldn't consent to jurisdiction in any case where there was a treaty right but not all states appeared before the court. ICJ says it doesn't have compulsory party pull. Court didn't permit these states to intervene. *After this case, the US withdrew its acceptance of compulsory jurisdiction ii. HOLDING: collective self-defense cannot justify hostile behavior unless the aggrieved state requests aid. Particularly where, as here, the acts of the allegedly offending state do not constitute an armed attack, a state may not come to the defense of another state under the doctrine of collective self defense unless asked to do so. 1. This is true under UN Charter and customary IL. Here, neither El Salvador nor Honduras were under armed attack and neither requested aid. So, the US could not properly invoke collective self-defense as a basis for justifying its hostile activities toward Nicaragua. 2. The Court ordered the US to cease its activities and make reparations 3. Court defines armed attack as action by regular armed forces across an international border, sending armed bands which carry out acts of armed forces. Assistance to rebels, provision of weapons or logistical support are NOT considered armed attack just intervention a. What US did constituted an armed attack. What Nicaragua did, did not. What's the distinction? Nicaragua just sent weapons intervention. iii. Dissents 1. Japanese judge: thought the US Treaty reservation could not be overcome by saying customary IL is the same. He also thought that if there was jurisdiction, the court should adopt a discretionary approach of a political question so the court shouldn't decide the case 2. English judge: Case barred by multilateral treaty provisions 3. Judge Schwebel: US actions done in self-defense, finding that Nicaragua's activities towards its neighbors amounted to armed attack; he dissented on jurisdictional grounds, too iv. NOTE: ICJ decisions in the international arena are equal in importance to Supreme Court decisions in US; but they are not binding g. Legality of the Threat or Use of Nuclear Weapons (ICJ Advisory Opinion, July 9, 1996) i. Question presented before the GA is the threat or use of nuclear weapons in any circumstances permitted under IL? ii. Ramifications of decision: If the court found that there's never a circumstance where its use is illegal, mere possession of nuclear weapons has to be illegal, too iii. Court holds that it can't reach a definitive conclusion as to the legality or illegality of the use of nuclear weapons by a State in an extreme circumstance of self-defense 1. Court rejects the attempt for it to rule that nuclear weapons can never be used 2. State can use nuclear weapons if its very survival is at stake h. Humanitarian Intervention i. Definition: the use of force by one state to protect people in another stake who are in imminent danger of death or grave injury ii. Requirements: 1. threat of imminent death/injury; 2. territorial state must be unwilling or unable to protect those endangered; and 3. intervening state must withdrawal after it has helped those in danger or otherwise has averted the danger iii. Is humanitarian intervention lawful or unlawful according to the UN Charter Art 2 4? 1. Could be seen as a threat of use of force by one state in the territory of another state 2. On the other hand, the state doing the intervening has to get out as soon as they accomplish the purpose a. Critics say, though, that the nation doesn't get out soon enough and does effect the sovereignty of the territory involved 3. Purpose of the Charter is to promote human rights human intervention is consistent with this objective 4. The Charter originally contemplated that when people are in imminent danger of attack, the Security Council army (established under ch. 7) would immediately act on the victims' behalf. So the Charter didn't need human intervention b/c of the UN force. a. This isn't the answer today b/c that force never came into being. The protection of human rights is one of the purposes and the saving of human lives is the most 37 Prof. Halberstam www.swapnotes.com International Law Outline important thing, the creation of the UN and the adoption of the Charter is actually regression of IL. i. Intervention in defense of democracy? XI. TERRORISM a. Number of treaties adopted as a reaction to terrorist acts (a # of planes hijacked and/or sabotaged) b. Convention for the Suppression of Unlawful Seizure of Aircraft (Hague) i. Art 1 defines as offense: an act done by any person who unlawfully seizes or exercises control of an aircraft or is an accomplice **Killing people on the plane is not made an offense under this Convention. The drafters wanted it to be very narrow (just applies to seizure) ii. Jurisdiction: Each contracting state shall take such measure as may be necessary to est its jurisdiction 1. Flag state -- when the offense is committed on board a plane registered in that state 2. State where plane lands 3. when plan leased to lessee who has principal place of business or residence in that state 4. State of nationality of the offender/victim does NOT have jurisdiction **Very narrow jurisdiction under this convention iii. Extradite or Prosecute Provision: The 3rd state where the alleged offender is found is found is required to exercise jurisdiction iv. All of the above only applies to states that ratified the convention c. Convention for the Suppression of Unlawful Acts Against the Safety of Civil Aviation (Montreal) i. Ratified by US Senate ii. Offense: 1. performs an act of violence against a person on board a plane 2. destroys a plane 3. places a device that is likely to destroy the plane (a bomb) 4. destroys/damages air navigation facilities or interferes with its operations 5. communicates info which he knows to be false 6. Must be an act that endangers the safety of the plane! Only if killing someone is likely to endanger the safety of the aircraft will it be an offense iii. Jurisdiction 1. Flag state 2. state where plane lands 3. State where registered *Again, state of nationality of the offender/victim no good iv. Extradition Art 7 (same as above) d. Convention for the Prevention and Punishment of Crimes Against Internationally Protected Persons, Including Diplomatic Agents i. Adopted by the GA in 1973; Ratified by Senate and the Pres ii. Offense: Art 2 1. murder, kidnapping, or attack 2. threat 3. attempt iii. Jurisdiction: Art 3 1. when in territory of state 2. when offender is a national of that state (this is the first time jurisdiction can be placed on nationality) 3. the state the internationally protected person represents (nationality of the victim; close to passive personality) iv. Extradite/Prosecute Provision: Art 7 e. International Convention Against the Taking of Hostages i. Adopted through UN Gen Assembly ii. Wanted an exception for National Liberation Movements states thought this defeated the purpose of the convention iii. Offense defined: Art 1 1. any person who seizes or detains and threatens to kill to injure to continue to detain another person in order to compel a 3rd party to do or abstain from doing something for the release of the hostage commits the offense of hostage taking iv. Jurisdiction: Art 5 1. territorial jurisdiction 2. based on nationality of hostage taker or the hostage 3. the target state has jurisdiction v. Extradite/Prosecute Clause: Art 6 38 Prof. Halberstam www.swapnotes.com International Law Outline vi. Article 12: Is there an exception for National Liberation Movements for taking hostages? 1. "the present convention shall not apply to an act of hostage-taking committing in the course of armed conflicts..." 2. Hostage taking is illegal it is illegal either under some existing convention or under this convention a. Covered by the Geneva Convention on Protocols (if you're bound by it) b. Or this convention c. But why all the language about self-determination maybe for political purposes **So killing someone on a plane is NOT a crime according to the above Conventions unless the terrorist threatened to damage or destroy the plane f. Convention for the Suppression of Unlawful Acts Against the Safety of Maritime Navigation i. What if two sailors are in a fight and one kills the other? that is NOT an offense under this convention ii. What about jurisdiction based on the nationality of the victim? 1. Art 6 2.2 state has jurisdiction when during the commission of the offense a national of that state is seized, threatened, injured, or killed iii. Extradite/prosecute provision requires all states in which the offender is found to either extradite or prosecute the person; this is the real teeth of these conventions 1. Assuming the US asserts jurisdiction based on nationality of the victim but the offender is found in another state, can the US claim jurisdiction? In other words, does the state have to extradite him in favor of US prosecution? a. Art 10 iv. Do all these treaties est universal jurisdiction? This is a theoretical arg based on the fact that wherever the offender is found, that state may prosecute g. Security Council Resolution 1373 (Sept 28, 2001) i. Reaffirms its condemnation of the terrorist attacks on 9/11 ii. International terrorism = threat to international peace and security iii. Reaffirms right to collective or individual self-defense iv. Freeze funds and other financial assets or economic resources of persons of commit or attempt to commit terrorists acts or participate in or facilitate the commission of terrorists acts v. Prevent the movement of terrorists or terrorist groups vi. Ensure that any person who participates in the financing, planning, preparation or perpetration of terrorist acts is brought to justice and that such acts are est. as serious criminal offense in domestic laws vii. Art 6: declares to est a committee of the sec council consisting of members of the council to monitor implementation of this resolution and calls upon the states to report to the committee no later than 90 days from the date of adoption of this resolution viii. Art 7: directs the committee to delineate its tasks, submit a work program w/o 30 days of adoption of this resolution h. UN PROVISION i. Just discussing terrorism met tremendous conflict "one man's terrorism is another man's heroism" ii. In 1995, the Gen Assembly issued a resolution entitled "Measures to Eliminate International Terrorism" 1. Unequivocal condemnation of all acts of terrorism wherever and by whomever; no justification of terrorist acts even self-determination iii. Draft Comprehensive Convention on Terrorism (1996) 1. makes it an offense for any person to cause death or serious bodily injury or serious damage to public or private property when the purpose is to intimidate a population or to compel a gov't or an international organization to do or abstain from doing any act 2. requires the States Parties to ensure that refugee status is not granted to any person where there are serious reasons for considering that the has committed an offense referred to in Art 2. 3. contains an extradite/prosecute provision 4. Contains a new art 18 to replace the draft of art 18, which provides in part `the activities of the parties during an armed conflict, including a situation of foreign occupation are not governed by this Convention.'" a. Such a limitation is inconsistent with and arguably a violation of UN resolutions b. It doesn't matter whose armed conflict it is and it's unlikely that you aren't going to have a terrorist attack that it's somehow related to an armed conflict. i. Question of US use of force in Afghanistan 39 Prof. Halberstam www.swapnotes.com International Law Outline i. Did US need approval from Congress? Halberstam thinks there's no question that the US has a right under IL to use force in self-defense against those who perpetrate these attacks and against any state that provides a safe haven to those responsible for these attacks. 1. This right comes from Art 51 of the UN Charter the right to self-defense is an inherent right and nothing in the Charter shall be interpreted as impairing that right 2. Halberstam thinks anticipatory self-defense is permissible under the Charter ii. Not the government of Afghanistan, but rather a group from Afghanistan committed the terrorist acts. But the Taliban has allowed bin Laden to stay in the country 1. The Sec Council asked Afghanistan to give up bin Laden to ensure that no further attacks come about and the gov't did not cooperate. 2. It's an attack if armed bans from the country came. As long as the country didn't stop them from acting, the target state could attack the country harboring the terrorist faction. See Nicaragua v. US. iii. The target state can act against a planned terrorist act emanating from the territory of another state if it was clear that: 1. the state from who territory the action was emanating could not, even with the information supplied to it by the target, respond in a timely fashion to prevent the terrorist act because of a shortage of time 2. the state from whose territory the action was emanating could not, even with adequate notice, act effectively to arrest the terrorist action. 3. the state from whose territory the action was emanating would not, even with adequate notice, act effectively to arrest the terrorist action. iv. The argument was made that the US no longer has a right to self-defense because bin Laden already attacked the US and doesn't plan on doing it again in this case the US can't attack because it's attack would just be in retaliation; but bin Laden made it clear that the WTC attack was just the beginning v. Proportionality attack in proportion to how the target state was attack vi. Can't hit civilians bombing Afghanistan will inevitably kill civilians. Does that mean the US can't take action knowing innocent people will die? vii. Resolutions of the Sec Council following 9/11 1. 1368: self-defense implicitly applies since the Security Council condemns the terrorist acts 2. 1373: reaffirms the right to self-defense to combat all terrorist acts by any means a. every state has the duty to refrain from organizing, instigating, assisting or participating in terrorist acts in another state or acquiescing in organized activities w/in its territory directed towards the commission of such acts b. acting under Ch VII of the Charter which means this resolution is binding on the states XII. INTERNATIONAL CRIMINAL LAW a. Attorney General of Israel v. Eichmann (pg.1375) i. Eichmann escaped to Argentina; but the state did little to arrest or prosecute him. Eichmann kidnapped and brought to trial in Israel. ii. Defenses raised by Eichmann to his trial in Israel: 1. Israel didn't have jurisdiction a. Nationality and territoriality are the most accepted bases of jurisdiction. Eichmann was not an Israeli national and the crimes didn't take place in Israel. b. Israel used the universality basis of jurisdiction crime against all of humanity. Genocide is one of those crimes. c. Israel = home of the Jewish. Use the passive personality basis, which is a modified nationality of the victim theory. 2. Ex post facto state cannot make laws criminalizing acts that weren't criminal when committed and then prosecute the offender a. Response to this arg: killing people has always been a crime (it was wrong when Eichmann did it and it still wrong) b. Demjanjuk v. Petrovsky (1380) i. Demjanjuk made false claims, such as denying he was ever involved with a Nazi prison camp. Israel wanted him extradited from US. He opposed the extradition on various grounds. ii. There are two type of extradition treaties: 1. States agree to extradite people in certain situations 2. List the crimes iii. He argued the crime listed was murder and that what he did wasn't murder court rejects this. He also asserted a jurisdiction argument. iv. Jurisdiction based on universality 40 Prof. Halberstam www.swapnotes.com International Law Outline c. "Ivan the Terrible" Case (1387, note 5) i. Convicted by trial court in Israel. Allegation was that he was "Ivan the Terrible" in a death camp. This trial was 50 yrs. after the events. Some of the witnesses couldn't identify him. So the highest court in Israel reversed the conviction. He was a guard but the court couldn't say with the evidence beyond a reasonable doubt that he was "Ivan the Terrible." The complaint should have just alleged that he was a guard. This was provable. ii. He came back to US. He wasn't brought back to Israel. If someone is extradited for crime A, you can't extradite him for crime B. d. US v. Alvarez-Machain (1394) i. FACTS: Alvarez-Machain was a doctor in Mexico. He allegedly worked with group of drug dealers who had kidnapped and tortured a drug agent in Mexico. Alvarez-Machain helped revived the agent ever time he passed out so the drug lords could continue to torture him for information. US gov't let it be known that if he was brought to US, the deliverer would be paid $50K. He was brought to US. 1. Alvarez-Machain's claims: a. US couldn't try him because of the manner in which he was brought to US, i.e., kidnapping. b. US court had no jurisdiction since the kidnapping violated the extradition treaty i. There wasn't a provision in the extradition treaty that said one can't be tried if he is brought into the jurisdiction by means other than those listed. He argued it's implied that a country can't do things that are not consistent with the treaty. 1. Not true Mexico could have deported him, which is also inconsistent with the treaty. 2. Model extradition provision: the states could have included a provision in the extradition treaty that jurisdiction will not be valid if obtained by bringing an alleged offender into the territory illegally a. No country has ever included such a provision. US not willing to create this exception to extradition treaties. US wants jurisdiction and doesn't want to restrict the means by which US courts can obtain jurisdiction. 2. US and Mexico had an extradition treaty. Why did Mexico just extradite him? a. Because the state isn't required to extradite its own nationals (this is a common provision in such a treaty. US does extradite its own nationals; Mexico does not) b. US didn't trust the Mexican courts to prosecute Alvarez itself (lots of corruption) ii. It was a violation of IL to kidnap Alvarez-Machain 1. What is the remedy for that violation? It isn't necessarily to deprive the court of jurisdiction. There is a rule of IL that says how a person is captured does not determine the power of the court to adjudicate his guilt or innocence. 2. The court, here, held the method of capture and right to adjudicate are different creatures and it has power to hear the case since what Alvarez-Machain did was, in fact, a crime (universal basis). XIII. Law of Sea 41
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Yeshiva - LAW - 7680
Part I Intro to International Law Making _ 2Chapter 1 Tracing the Evolution of International Law Thru Two Problems: _ 2I. The Chad-Libya War over the Aouzou Strip __ 2 II. The Rainbow Warrior Affair _ 2Chapter 2 Making Law in a Decentralized S
Yeshiva - LAW - 7680
BASIC RULES OF TAXATION - US persons are taxed on world-wide income - US persons are entitled to foreign tax credit - Foreigners are taxed on income that is effectively connected with a trade or business in the US (ECI) - Foreigners are taxed on inco
Yeshiva - LAW - 7601
This document contains the supplemental readings for Professor Zelinsky's Fed Tax course (Spring 2007). The following materials are not included: Assn #: 8 2006 TNT 248-1 20 68 F.3d 41 23 ILM 200603025 23 2006 TNT 14-12 28 ILM 200608038 28 2006 TNT 3
Yeshiva - LAW - 7601
Fed tax outline: I) Definition of the tax base: what is gross income? 1) text 1-13(1-13), 17-24(16-24), 32-38(32-38), 70-72(69-71) Code Section 61 Glenshaw Glass what is income? Punitive damages are income 1) accession to wealth, 2) clearly realize
Yeshiva - LAW - 7601
www.swapnotes.comElan Weinreb September 10, 2001 Federal Courts Rudenstine Federal Courts Outline The exam: There are no midterms and no papers. The final grade in this course is based upon the final exam. The exam this year will be open book. You
Yeshiva - LAW - 7601
Analyze: Horizontal equity Ts w/ similar ability should pay the same Vertical equity Ts w/ higher ability should pay more=FED TAX OUTLINE 1. Sources of Federal Taxation a. Criteria for evaluating these possibilities 2. Cash Accounting vs. Accrual
Yeshiva - LAW - 7601
Federal Income Tax 2000www.swapnotes.comFEDERAL TAX - ENGLER I. Introduction A. 2 fundamental Questions 1. What is the treatment of a particular item? 2. What should be the treatment under an ideal tax system? B. Critique of Tax Systems 1. 3 Basi
Yeshiva - LAW - 7601
GROSS INCOME www.swapnotes.comBasic Structure of the Tax System - (1) Gross Income (61) - Deductions (162, 212) = AGI (62) - (2) AGI (62) - Itemized Deductions = Taxable Income (63)Definition of Gross Income - GI includes all income (wages, inter
UCSD - CSE - 182
Biological Data Analysis (CSE 182) : Assignment 4LogisticsSubmit a hard copy containing the code and results. Create a compressed file containing the code and output as separate files, and email Julio. Do not deviate significantly from the suggest
UCSD - CSE - 182
CSE 182 Home PageFall06: CSE/BIMM/BENG 182: Biological Data AnalysisInstructor: Vineet Bafna TA: Julio Ng Lectures: TR 2:00-3:20pm. SOLIS 111 Discussion:M3:00-3:50pm. CENTR201 Office hours: Vineet Bafna: TR 3:30-4:30pm EBU3b(CSE building) 4218 TA
UCSD - CSE - 182
http:/cs.ucsd.edu/classes/fa06/cse182/hw/A2/a1p5.txtSequence 1: ttgtttgtttttgtttttgtttgagatggagtttcgctcttattgcccaggctggagtgc agtggcgtgatttcggctcactgcaacctccccttcctgcattcaagcgattctcctgccSequence 2: atggtgcattttactgctgaggagaaggctgccgtcactagcctgtgga
UCSD - CSE - 182
L15:Microarray analysis (Classification)The Biological Problem Two conditions that need to be differentiated, (Have different treatments). EX: ALL (Acute Lymphocytic Leukemia) & AML (Acute Myelogenous Leukima) Possibly, the set of genes over-ex
UCSD - CSE - 182
CSE182 lecture 2 questionsVineet Bafna September 26, 2006The questions are open ended, but should help you understand lectures better. Do these questions make sense? Are they helpful in following the lecture? Constructive feedback is appreciated. 1
UCSD - CSE - 182
CSE182 lecture 4 notes &questionsVineet Bafna October 5, 20061NotesRecall that we are interested in computing local alignments of a query string of length n against a subsequence from database. Certainly, we can apply the smith waterman (local
UCSD - CSE - 182
CSE182 Lecture 7 questionsVineet Bafna October 23, 2006The questions are open ended, but should help you understand lectures better. Do these questions make sense? Are they helpful in following the lecture? Constructive feedback is appreciated. 1.
UCSD - CSE - 182
CSE182 Lecture 8,9 questionsVineet Bafna October 23, 2006The questions are open ended, but should help you understand lectures better. Do these questions make sense? Are they helpful in following the lecture? Constructive feedback is appreciated. 1
UCSD - CSE - 182
CSE182-L18Population GeneticsPerfect Phylogeny Assume an evolutionary model in which no recombination takes place, only mutation. The evolutionary history is explained by a tree in which every mutation is on an edge of the tree. All the species
UCSD - CSE - 182
CSE182-L17Clustering Population Genetics: BasicsUnsupervised Clustering Given a set of points (in ndimensions), and k, compute the k "best clusters". In k-means, clustering is done by choosing k centers (means). Each point is assigned to the cl
UCSD - CSE - 182
L16: Micro-array analysisDimension reduction Unsupervised clusteringPCA: motivating example Consider the expression values of 2 genes over 6 samples. Clearly, the expression of g1 is not informative, and it suffices to look at g2 values. Dimens
UCSD - CSE - 182
CSE182-L12Mass Spectrometry Peptide identificationFa 06CSE182Ion mass computations Amino-acids are linked into peptide chains, by forming peptide bonds Residue mass Res.Mass(aa) = Mol.Mass(aa)18 (loss of water)Fa 06CSE182Peptide cha
UCSD - CSE - 182
CSE182-L11Protein sequencing and Mass SpectrometryFa 06CSE182Whole genome shotgun Input: Shotgun sequence fragments (reads) Mate pairs Output: A single sequence created by consensus of overlapping readsFirst generation of assemble
UCSD - CSE - 182
CSE182-L7Protein Sequence Analysis using HMMs, Gene FindingDomain analysis via profiles Given a database of profiles of known domains/families, we can query our sequence against each of them, and choose the high scoring ones to functionally chara
UCSD - CSE - 182
CSE182-L8Gene FindingProjectInputOutput EST clustering and assembly Given a collection of EST (3'/5') sequences, your goal is to cluster all ESTs from the same gene, and produce a consensus. Note that all the 3' ESTs should line up at
UCSD - CSE - 182
CSE182-L9Gene Finding (DNA signals) Genome Sequencing and assemblyAn HMM for Gene structureGene Finding via HMMs Gene finding can be interpreted as a d.p. approach that threads genomic sequence through the states of a `gene' HMM. Einit, Efin,
UCSD - CSE - 182
CSE182-L10LW statistics/AssemblyWhole Genome Shotgun Break up the entire genome into pieces Sequence ends, and assemble using a computer LW statistics & Repeats argue against the success of such an approachAlternative: build a roadmap of the
UCSD - CSE - 182
Biological Data Analysis (CSE 182) : Assignment 3LogisticsSubmit a hard copy containing the code and results. Create a compressed file containing the code and output as separate files, and email Julio Ng.Sequence Alignment and Gap penalties1. B
UCSD - CSE - 182
Biological Data Analysis (CSE 182) : Assignment 2LogisticsSubmit a hard copy containing the code and results. Create a compressed file containing the code and output as separate files, and email Julio Ng. Do not deviate significantly from the sugg
UCSD - CSE - 190A
Hand GeometryApplications November 18, 2004 Port of Rotterdam Relies on Recognition Systems Biometric HandReaders for Transportation Worker Identity Credential October 27, 2004 Prestigious Wisconsin Private School Selects Recognition Systems Biom
UCSD - CSE - 182
Biological Data Analysis (CSE 182) : Assignment 1September 20, 2006LogisticsYou should submit a written report containing the source code and the output of each program.Perl basicsYou are free to use any programming language to do this assign
Yeshiva - LAW - 7601
Engler/Spring 2002www.swapnotes.comKohn1FEDERAL INCOME TAX OUTLINEINTRODUCTIONSOURCES OF FEDERAL TAXATION - Consumption tax: Tax what people spend. Very simple to administer, as one rate would apply (probably in the form of a sales tax). E
UCSD - CSE - 190A
Announcements HW1 due today Most of last lecture was on the blackboard. Gather hand data set today.Linear Discriminant Functions (Sections 5.1-5.2)CSE190a Fall 06Linear discriminant functions and decisions surfacesDefinitionIt is a func
UCSD - CSE - 190A
How are people identified?Introduction-cont Pattern classificationBiometrics CSE 190-a Lecture 2 People are identified by three basic means: Something they have (identity document or token) Something they know (password, PIN) Something they a
UCSD - CSE - 190A
IntroductionBiometrics CSE 190-a Lecture 1Who are you?CSE190a Fall 06CSE190a Fall 06How are people identified?Person Identification Identifying fellow human beings has been crucial to the fabric of human society People are identified by
UCSD - CSE - 190A
BIOMETRICSFall 2006 Homework 4: Finding the Candy Man Using Fingerprint Recognition Due: December 1, 2006 The purpose of this lab is to implement a component of minutiae-based fingerprint recognition. The input to your program will be a set of minut
Yeshiva - LAW - 7601
FEDERAL TAX OUTLINEwww.swapnotes.com FALL 2002PROF ZELINSKYINCOME61 Commissioner v. Glenshaw Glass (pg 90) Are punitive damages income? Glenshaw Glass was awarded punitive damages but reported only non-punitive damages Holding: Taxpayer looses
Yeshiva - LAW - 7601
www.swapnotes.comFederal Income Taxation OutlineSpring 2003 Professor EnglerCHAPTER 1. IntroductionCriteria for Tax Regimes Vertical fairness: those with a higher ability to pay should pay more. Horizontal fairness: those in similar situations s
Yeshiva - LAW - 7574
Cunningh@yu.edu Federal Income Tax Policy o Tax is designed to raise revenue. Income Tax is the largest way for the government to collect revenue. o Why Income Tax? A head tax would have no basis on how much people are able to pay and an income tax
UCSD - CSE - 182
ON-GOING PROJECTS IN THE MACAGNO LABORATORY AT UCSDHIRUDO MEDICINALIS GENOMICS, DEVELOPMENT, NEURAL STRUCTURE AND NEURAL FUNCTIONThe leech CNS is comprised of a head ganglion, 21 midbody segmental ganglia and a tail ganglion. Each midbody ganglion
UCSD - CSE - 182
CSE 182-L2:Blast & variants IDynamic Programmingwww.cse.ucsd.edu/classes/fa05/cse182 www.cse.ucsd.edu/~vbafnaFA05CSE182Searching Sequence databaseshttp:/www.ncbi.nlm.nih.gov/BLAST/FA05CSE182Query:>gi|26339572|dbj|BAC33457.1| unnamed
UCSD - CSE - 182
L3: Blast: Local Alignment and other flavorsFa05CSE 182An ExampleTCATT G CAA A1 T CAT T G CAA A2 Align s=TCAT with t=TGCAA Match Score = 1 Mismatch score = -1, Indel Score = -1 Score A1?, Score A2?Fa05CSE 182Sequence Alignment Rec
UCSD - CSE - 182
http:/cs.ucsd.edu/classes/fa06/cse182/hw/A4/data21 01010011000010101011001010100000000110000011010000010001000000010000000 2 00000100011000100001000001001100100000011000001100001001000100101001111 3 1000110000010000000100100100000000000001100000110
UCSD - CSE - 182
http:/cs.ucsd.edu/classes/fa06/cse182/hw/A4/data11 11001000000010000000010100010001001000 2 01001000000010001000010100010000001000 3 01001001000010000001010100010000001010 4 00010100010000000000001001000100000000 5 000101000100000000000010000001000
Yeshiva - LAW - 7601
www.swapnotes.comFederal Income Tax Outline CHAPTER 1 I. Introduction a. Themes i. What is the actual result under tax law? ii. From a policy standpoint, what should the law be? b. Possible Types of Taxation i. Head Tax flat rate for each person ii
Yeshiva - LAW - 7601
www.swapnotes.comI.IntroductionA. What is the Main Source of Federal Taxation and What are the Other Options? INCOME TAX is the main source.1. Consumption tax. Encourages savings not consumption. Lacking in fairness b/c the rich can save and
UCSD - CSE - 182
CSE182-L13Mass Spectrometry Quantitation and other applicationsFa 06CSE182What happens to the spectrum upon modification? Consider the peptide MSTYER. Either S,T, or Y (one or more) can be phosphorylated Upon phosphorylation, the b-, and y-
UCSD - CSE - 182
CSE182-L4: Keyword matchingFa05CSE 182Backward scoring Defin Sb[i,j] : Best scoring alignment of the suffixes s[i+1.n] and t[j+1.m] Q: What is the score of the best alignment of the two strings s and t? HW: Write the recurrences for SbFa05
UCSD - CSE - 182
CSE182-L5: Scoring matrices Dictionary MatchingFa05CSE 182Scoring DNAQuickTimeTM and a TIFF (LZW) decompressor are needed to see this picture. DNA has structure.Fa05 CSE 182DNA scoring matrices So far, we considered a simple match/mism
UCSD - CSE - 182
CSE182-L6Protein sequence analysisFa 06CSE182Possible domain queries Case 1: You have a collection of sequences that belong to a family (contain a functional domain). Given an `orphan' sequence, does it belong to the family? There are diff
Yeshiva - LAW - 7574
Subject Matter 35 USC 101 - Inventions patentable: Patent must have: utility, novelty (there is not 1 piece of prior art that is equal to that invention) 102, & un-obviousness (there are not several prior art inventions that add up to the current inv
UCSD - CSE - 182
CSE182 Lecture 10 questionsVineet Bafna October 31, 2006The questions are open ended, but should help you understand lectures better. Do these questions make sense? Are they helpful in following the lecture? Constructive feedback is appreciated.L
UCSD - CSE - 182
Whole Genome Assembly Microarray analysisMate Pairs Mate-pairs allow you to merge islands (contigs) into super-contigsSuper-contigs are quite large Make clones of truly predictable length. EX: 3 sets can be used: 2Kb, 10Kb and 50Kb. The varia
UCSD - CSE - 190A
FaceFace Recognition: Dimensionality Reduction Biometrics CSE 190-a Lecture 12CSE190a Fall 06CSE190a Fall 06Face Recognition Face is the most common biometric used by humans Applications range from static, mug-shot verification to a dynamic
UCSD - CSE - 166
CSE166 Image Processing Midterm Instructor: Prof. Serge Belongie http:/www-cse.ucsd.edu/classes/fa06/cse166 11:00am-12:20pm Tuesday Oct. 31, 2006. On this exam you are allowed to use a calculator and one 8.5" by 11" sheet of notes. The total number
UCSD - CSE - 166
CSE166 Image Processing Final Instructor: Prof. Serge Belongie http:/www-cse.ucsd.edu/classes/fa06/cse166 11:30am-2:30pm Tue. Dec. 5, 2006. On this exam you are allowed to use a calculator and two 8.5" by 11" sheets of notes. The total number of po
UCSD - CSE - 166
Proof of the Convolution TheoremWritten up by Josh Wills January 21, 2002f (x) h(x) g(x)F (u)H(u) 1 MM -1(1) (2)=f (k)h(x - k)x=0Perform a Fourier Transform on each side of the equation: 1 1 MMM -1 x=0 M -1G(u)=f (k)h(x - k)
UCSD - CSE - 166
CSE166 Image Processing Homework #7 Instructor: Prof. Serge Belongie http:/www-cse.ucsd.edu/classes/fa06/cse166 Due (in class) 11:00am Thursday Nov. 30, 2006. General Homework Guidelines Use the Cover Sheet provided. Please attach all code that y
UCSD - CSE - 166
CSE166 Image Processing Homework #4 Instructor: Prof. Serge Belongie http:/www-cse.ucsd.edu/classes/fa06/cse166 Due (in class) 11:00am Thursday Oct. 26, 2006. Reading GW 6.0-6.2. General Homework Guidelines Use the Cover Sheet provided. Please a
UCSD - CSE - 166
CSE166 Image Processing Homework #1 Instructor: Prof. Serge Belongie http:/www-cse.ucsd.edu/classes/fa06/cse166 Due (in class) 11:00am Thursday Oct. 5, 2006. Reading Skim GW Ch. 1 and 2. GW 2.6, 3.5, 3.6.03.6.1, 3.7.03.7.1 Review Material, "A Br
UCSD - CSE - 166
Showing a System is Linear and Shift Invariant Prepared by: Piotr Dollar1Showing LinearityTo show a system H is linear, we need to show that for all functions f1 and f2 , H satisfies the following equation: H[f1 (x) + f2 (x)] = H[f1 (x)] + H[f2
UCSD - CSE - 166
CSE166 Image Processing Homework #6 Instructor: Prof. Serge Belongie http:/www-cse.ucsd.edu/classes/fa06/cse166 Due (in class) 11:00am Tuesday Nov. 21, 2006. General Homework Guidelines Use the Cover Sheet provided. Please attach all code that yo
UCSD - CSE - 166
CSE166 Image Processing Homework #3 Instructor: Prof. Serge Belongie http:/www-cse.ucsd.edu/classes/fa06/cse166 Due (in class) 11:00am Thursday Oct. 19, 2006. Reading GW 4.3-4.4, 4.6. General Homework Guidelines Use the Cover Sheet provided. Ple