Unformatted Document Excerpt

Coursehero >> Pennsylvania >> Penn State >> AMS 88

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
There is no excerpt for this document.
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Penn State - AMS - 88
Dallas - EE - 3101
Experiment3: Techniques of Circuit Analysis1 ObjectivesThe objective of this experiment is to analyze resistive circuits in DC employing the node-voltage method, the mesh-current method, source transformations and the Thvenin and Norton equivalent
Dallas - CONSORTIUM - 06
Dallas - EE - 072000
Experiment3: Techniques of Circuit Analysis1 ObjectivesThe objective of this experiment is to analyze resistive circuits in DC employing the node-voltage method, the mesh-current method, source transformations and the Thvenin and Norton equivalent
Dallas - NXK - 019000
2. LabVIEW Programming EnvironmentLabVIEW constitutes a graphical programming environment that allows one to design and analyze a DSP system in a shorter time as compared to text-based programming environments. LabVIEW graphical programs are called
Dallas - POEC - 5319
ta a DGIS(Geographic Information Systems)M an ag em t enFundamentalsDr. Ronald BriggsSc ce ienThe University of Texas at Dallas Program in Geospatial Information Sciencesec Dons is ihttp:/www.utdallas.edu/~briggs/gisc6381.htmlPers
Dallas - POEC - 6383
Topics to be Covered Data Bases: Concepts and TypesOrganizing Information DBMSs in Organizations Traditional DBMS (data base management systems) flat files (in reality, no DBMS) navigational data bases Tomlinson Hierarchical & Network disc
Dallas - POEC - 6383
7#,#q#@*#+#u#V#V#2# #2#2#2#8#5#5#5#5#5#L#66#66#d#6#x#3P#f#7# # #72#:1#*#:[#2##:1#7H#:1#:1#?#2#:1#:1#:1#:1#:1#:1#GIS D DEVELOPMENT GUIDE: CONCEPTUAL DESIGN OF THE GIS PART 1 - DATA MODELING1 Introduction This guide describes data modeling in general
Dallas - NXK - 019000
1. IntroductionThe field of digital signal processing (DSP) has experienced a considerable growth in the last two decades primarily due to the availability and advancements in digital signal processors (also called DSPs). Nowadays, DSP systems such
Penn State - MATH - 250
Laplace Transformations Quiz - Solutions Please solve the following problems. If you need more space you may attach additional sheets. 1. Sketch the graph of the following function: g(t) = u1 (t) u2 (t) + u3 (t)sin(t 3) The graph is zero on the int
Penn State - CSE - 565
Algorithm Design and Analysis$ & ( $ $. $ $ $ & $ %! "# & $ & $'LECTURE 22Dynamic Programming RNA Secondary Structure Shortest Paths) *+ GUCGAUUGAGCGAAUGUAACAACGUGGCUACGGCGAGA" ! " ! ! ! ! ! " ! " $+ ," ,! ! " " ! " ! ! !Sofya Raskhod
Dallas - SXL - 029100
Academy of Management Review 2007, Vol. 32, No. 1, 257272.BANKRUPTCY LAW AND ENTREPRENEURSHIP DEVELOPMENT: A REAL OPTIONS PERSPECTIVESEUNG-HYUN LEE MIKE W. PENG University of Texas at Dallas JAY B. BARNEY The Ohio State UniversityWe develop a rea
Dallas - GSL - 072000
Differences in Fitts Law Task Performance Based on Environment ScalingGregory S. Lee and Bhavani ThuraisinghamDepartment of Computer Science University of Texas at Dallas 800 West Campbell Road Richardson, TX 75080 USA leegs@utdallas.edu, bhavani.t
Dallas - GSL - 072000
Anisotropies of Touch in Haptic Icon ExplorationGregory S. Lee and Blake Hannaford Department of Electrical Engineering University of Washington Box 352500 Seattle, WA 98195-2500 USA leegs@washington.edu, blake@u.washington.eduAbstract Handheld dev
Dallas - GSL - 072000
Preliminary Two Dimensional Haptic Thresholds and Task Performance EnhancementsGregory S. Lee and Blake Hannaford Department of Electrical Engineering University of Washington Box 352500 Seattle, WA 98195-2500AbstractMany tasks may be performed w
Dallas - LCK - 016000
Ken Foster September 29, 2006 PSCI 3351 Comparative Courts and LawThe United Kingdom Chapter 5Feldman, David 1988. "Judicial Review: A Way of Controlling Government?." Public Administration 66: 21-34.Many constitutional systems throughout the w
Penn State - IE - 310
Homework Set #1 Solutions Problem 1.31 Strain hardening occurs when dislocations interfere with each other and with grain boundaries. When a metal is cold worked, a large number of dislocations are generated and interfere with each other. With ever i
Penn State - IE - 310
IE 310 PRINCIPLES OF DEFORMATION PROCESSESLecture: 103 Leonhard, M,W 8:00 am 8:50 am Lab: 106 Leonhard Section 2: T, 10:10 am 12:05 pm Section 4: H, 10:10 am 12:05 pm Instructor: Prof. Edward C. De Meter, 217 Leonhard Phone: 863-7291 Email: ecd3@p
Penn State - ME - 450
ME 450 - Introduction to Computer Aided Analysis of Machine Dynamics Fall 2003Instructor: Office: Phone: Fax: Email: Office Hours: Edward C. De Meter, 217 Leonhard Building 863-7291 863-4745 ecd3@psu.edu M,W: 9:00 am - 10:30 am M, W, F 12:20 - 1:10
Penn State - ME - 450
ME 450 Computer Aided Analysis of Machine Dynamics Homework Set 4: Due 11-10-2003Fall 2003Problem 9: An inverted slider along with its accompanying vector loop diagram is shown below. The inertia properties of the various links are provided as we
Penn State - IE - 430
INDUSTRIAL ENGINEERING 430 MANUFACTURE/DESIGN TEAM PROJECTS SPRING 2002 Instructor: Office: Phone: Fax: Email: Office Hours: Edward C. De Meter, 217 Leonhard Building 863-7291 863-4745 ecd3@psu.edu T, H 9:00 am 10:00 amClass Schedule: T, H 1:00 pm
Penn State - IE - 430
INDUSTRIAL ENGINEERING 430 MANUFACTURE/DESIGN TEAM PROJECTS SPRING 2002 Instructor: Office: Phone: Fax: Email: Office Hours: Edward C. De Meter, 217 Leonhard Building 863-7291 863-4745 ecd3@psu.edu T, H 9:00 am 10:00 amClass Schedule: T, H 1:00 pm
Penn State - ME - 450
Problem 8Position of Slider for a Drag-Link Mecahnism 43.53 r6 (meters)2.521.51 0 2 4 6 8 Time (seconds) 10 12 14Velocity of Slider for a Drag-Link Mecahnism 0.50 r6dot (meters/s) -0.5 -1 0 2 4 6 8 Time (seconds) 10 12 14%DRAG_LINK
Penn State - IE - 310
IE 310 Principles of Deformation Processes Homework Set #2 Due: 10-8-03 Problem 1 An orthogonal machining process is executed on a workpiece specimen. The workpiece width is 0.05 cm, the undeformed chip thickness is 0.1 mm, and the cutting speed is 3
Penn State - ME - 450
Problem 1 The drag-link is a compound mechanism made up of a four bar linkage and a slider-crank. The vector loop diagrams for both mechanisms are shown below:R5y 5 5,4 4 R1 2 R4 R2R3R5 R7 R6x7y 5 x3Four Bar Mechanism R1 : r1 fixed1
Penn State - IE - 310
IE 310 Principles of Deformation Processes Homework Set #3 Due: 10-20-03 Problem 1 Consider an orthogonal machining operation for which the specific cutting stress is estimated to be 750 N/mm2. Assuming that the tool rake angle is 20 and the workpiec
Penn State - ME - 450
ME 450 Computer Aided Analysis of Machine Dynamics Homework Set 6: Problem 12: An inverted slider is shown below along with its link parameters. Link 2 is driven by a motor attached to ground. The motor exerts a torque, 1,2. Assume that all joints (e
Penn State - ME - 450
Problem 5The drag link has four possible assemblies. For 2 = 3/2, the four solutions to the position analysis equations are shown below:yR5 R7R6? 5,4 = /2 R1R4 R3x yR5? 2 = 3/2R2 First SolutionxyR5 R5y? 5,4 = /2 R1R4 R3xR
Penn State - ME - 450
ME 450 Computer Aided Analysis of Machine Dynamics Homework Set 5: Due 11-11-2002Fall 2002Problem 11: An inverted slider along with its accompanying vector loop diagram, vector chain diagram, and free body diagrams are shown on the following page
Penn State - ME - 450
Exam 3 SolutionPart 1: Dynamics Model Development The vector loop diagrams for the double crank are shown below along with the values of all pertinent link parameters:R7 Y R5 5,4 R4 R2 R3 vector loop diagram for double crank component r1 = .5 m, 1
Penn State - ME - 450
ME 450 Computer Aided Analysis of Machine Dynamics Exam 1NO UNAUTHORIZED AID ON THIS EXAMFall 2001PRINTED NAME: _I acknowledge that I have neither given nor received unauthorized aid on this exam. SIGNATURE: _Problem 1 (30 pts): For the cam-
Penn State - IE - 328
PROCESS PLANPart Number: 1 Part Name: Prismatic Part Quantity: 1 Created by: E. C. De Meter Date of Last Revision: 2-24-02TABLE OF CONTENTSPROCESS SUMMARY PROCESS DESCRIPTION Set Up 20: Face Mill Set Up 20 Description Process 20 Description Set
Penn State - ME - 450
ME 450 Computer Aided Analysis of Machine Dynamics Exam 2NO UNAUTHORIZED AID ON THIS EXAM OR YOU WILL BE VERY SAD!Fall 2001PRINTED NAME: _I acknowledge that I have neither given nor received unauthorized aid on this exam. SIGNATURE: _Problem
Penn State - IE - 328
IE328 SP03REC #2IE 328 SPRING 03 SOLUTION TO RECITATION #2Answers to each problem are typed in Bold Italic Font1. What do the following statements accomplish in a CNC program: a) T3 M06; b) S1500 M03; c) G90 G54 G00 X0.0 Y0.0; : Change the tool
Penn State - IE - 328
.005MMA C B.500.750.500.002 4 X .250 .002 THRU C.50012 2.000 .0051.000 4 3.003 BA .500 .005 .250 .002 .005 M B3.000 .008 .003 A .003 A30 1.000 .005A 4.000 .004III. GO/NO-GO PLUG GAGE DESIGNGONO-GO__ _ _
Penn State - IE - 328
Solution: Project 1 Part A2 Step 1: Design No-Cut Blank Cross Sections The dimensions of the no-cut cross sections are the following: Cross Section 1 2 3 Dimensions 2.000 .001 in. x 3.500 .002 in. 6.000 .005 in. x 3.500 .002 in. 2.000 .001 in. x
Dallas - SXS - 025500
'$Applications of Large Random Matrices and Free Probability Theory in Wireless CommunicationsShahab SanayeiMultimedia and Communications LaboratoryUniversity of Texas at Dallas&August 20041Multimedia Communications Laboratory UT-Dalla
Dallas - CHEM - 051000
Published on Web 07/17/2004A Minimum Free Energy Reaction Path for the E2 Reaction between Fluoro Ethane and a Fluoride IonBernd Ensing,*, Alessandro Laio, Francesco L. Gervasio, Michele Parrinello, and Michael L. KleinCenter for Molecular Modeli
Dallas - CHEM - 3411
Published on Web 07/17/2004A Minimum Free Energy Reaction Path for the E2 Reaction between Fluoro Ethane and a Fluoride IonBernd Ensing,*, Alessandro Laio, Francesco L. Gervasio, Michele Parrinello, and Michael L. KleinCenter for Molecular Modeli
Dallas - XXG - 061000
Free-Form Deformations1Deformation2/28Deformation3/28Deformation ApplicationsToy Story Disney / Pixar 4/28Challenges in DeformationLarge meshes millions of polygons Need efficient techniques for computing and specifying the deforma
Dallas - NATS - 015000
NATS 1311 - From the Cosmos to EarthExamples: Pulling a table cloth out from under a table setting The reaction of coffee in a cup when accelerating or decelerating in a car Tightening of a hammerhead by banging hammer on the ground Getting ketchup
Dallas - NATS - 100208
NATS 1311 - From the Cosmos to EarthExamples: Pulling a table cloth out from under a table setting The reaction of coffee in a cup when accelerating or decelerating in a car Tightening of a hammerhead by banging hammer on the ground Getting ketchup
Dallas - PHYS - 3380
PHYS 3380 - AstronomyHomework Set #10 11/20/08 Due 12/2/08 Chapter 13 Review Questions 2, 6, 7,11 Problems 1, 5 Chapter 14 Review Question 1 Problems 5, 9PHYS 3380 - AstronomyRecurrent NovaeMost novae are recurrent on time scales ranging from
Dallas - PHYS - 101408
PHYS-3380 AstronomyHomework #6 10/14/08 Due 10/21/08Chapter 8 Review Questions 4 and 12 Discussion question 2 Problem 7 Learning to look 2PHYS-3380 AstronomyRadio InterferometryThe Very Large Array (VLA): 27 dishes are combined to simulate
Dallas - PHYS - 3380
PHYS-3380 AstronomyHomework #6 10/14/08 Due 10/21/08Chapter 8 Review Questions 4 and 12 Discussion question 2 Problem 7 Learning to look 2PHYS-3380 AstronomyRadio InterferometryThe Very Large Array (VLA): 27 dishes are combined to simulate
Penn State - CJN - 5012
Climate Analysis and Observations For Reykjavik, IcelandChris Nowotarski Matthew Popek Alex Matus Alex KourakosMeteo 300December 15, 2006Introduction and Geography The city of Reykjavik is located on the southwestern part of the island Iceland
Penn State - SSA - 117
Sarah S. AllisRhode Island School of Design1998 -2003Design PortfolioStudio: Heritage Equestrian Center Project: Heritage Equestrian Center,East Greenwich, RIThe goal in this studio was to design an equestrian center on a predetermined site
Penn State - SAH - 6
Could such an innocent child turn into the man we all know?At Still Creek DamCirca 1947Judy, Tom and Sally in Penbrook, Pa.In Carnegie Building, 1978Circa 2002Berner and Bailey at Garner Street houseThat tortured phrase, chiseled in sto
Penn State - ITL - 05
The SunRisers: Making the Case ProjectExecutive SummaryDeveloping Successful Advocates to Promote Technology in Teaching and LearningLeadership development is an organizational asset. Institutes of higher education need instructional technology l
Penn State - ITL - 133
The SunRisers: Making the Case ProjectExecutive SummaryDeveloping Successful Advocates to Promote Technology in Teaching and LearningLeadership development is an organizational asset. Institutes of higher education need instructional technology l
Penn State - SFF - 3
Penn State - SAD - 9
STUDENT EMPLOYEE BOOK LOAN PROGRAMGENERAL INFORMATION1. The Book Loan Program was developed to benefit the wage payroll student employee (full time employees are not eligible) and to assistHospitality Services during difficult staffing periods o
Dallas - HXM - 025000
Course Professor Term MeetingsEE 6352 501: Digital Communications Systems Hlaing Minn Fall 2008 MW 5:30-6:45 PM, ECSN 2.120Professor's Contact Information Office Phone 972 883 2889 Office Location ECSN 4.204 Email Address hlaing.minn@utdallas.edu
Dallas - SXB - 027100
Fall 2007-Spring 2008ROBOT MOTION PLANNING EFFICIENCY ANALYSIS AND SOFTWARE IMPLEMENTATIONDavid Urrabazo Jr Arie Litosky Mindy FengSergey BeregComputer Science Undergraduate ProjectCONTENTS PAGE Nos. Project Description3 Specific Questions/
Dallas - PA - 5309
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>8995dfc67ba26aba89eea8040b01a90b9795e045.doc</Key><RequestId>F E1C5CCBF49B4B39</RequestId><HostId>UMc8RV78tzJkKNuFS0vzxj9alkp
Dallas - PA - 5309
PA 5309, Fall 2006 Instructor: Yoonhwan ParkPractice Questions for The FinalYoonhwan set up his theory that monthly rent would be determined by education years of household head and single mother family. "singmom" is dummy variable, so it is 1 if
Penn State - STAT - 100
Hardest questions from rst three midtermsThe following 12 questions were answered correctly by fewer than 60% of the people taking the exam. Question 1. (Exam 1, 33% correct) Suppose an observational study nds that people who use public transportati
Penn State - STAT - 100
Oct. 5 Statistic for the day: Percent of people over 5 in the US who spoke a language other than English in their home in 1990: 14% In 2000: 18%Exercise: Follow the 4 steps and answer the Research Question: Is there a statistically significant diff
Penn State - STAT - 100
Oct. 17 Statistic for the Day: In1996, the percentages of 16-24 yr old high school finishers enrolled in college were 49% for lower income families 63% for middle income families 78% for higher income familiesAssignment: Review for Exam #2, Wednesda
Penn State - STAT - 100
Feb. 18 Statistic for the day: Average annual beer consumption of American college students: Almost 4 billion cans Estimated percentage of freshman class nationwide that will drop out for alcoholrelated reasons: 7%Assignment: Read Chapter 12 pp. 235
Penn State - STAT - 100
Oct. 3 Statistic for the day: In 2000, Americans ate 30 pounds of French fries on average per year.Assignment: Read Chapter 13 Do the exercise on the last slide of this lecture. (Answers will be given in Wednesday lecture.)Arbys sandwiches (rememb