Bioinformatics Genomics, & Medicine
(http://cmgm.stanford.edu/bmi234/)
BioMedical Informatics 234 January 14, 2002
Doug Brutlag Professor of Biochemistry & Medicine (by courtesy) Stanford University School of Medicine
Doug Brutlag, 2002
Related Courses
Biochemistry 218 & BioMedical Informatics 231:
Computational Molecular Biology
(http://cmgm.stanford.edu/biochem218/) BioMedical Informatics 214 & Computer Science 274:
Representations and Algorithms for Computational Molecular Biology
(http://www.smi.stanford.edu/projects/helix/bmi214/) BioMedical Informatics 345 & Computer Science 545:
Genome Databases Seminar
(http://www.db.stanford.edu/dbseminar/seminar.html) Structural Biology 228:
Protein Architecture, Dynamics & Structure Prediction
(http://csb.stanford.edu/class/)
Doug Brutlag, 2002
Genetics 211: Genomics
A Primer of Genome Science
Doug Brutlag, 2002
Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins
Doug Brutlag, 2002
Bioinformatics: Sequence and Genome Analysis
Doug Brutlag, 2002
Biological Sequence Analysis
Doug Brutlag, 2002
Leveraging Genomic Information
Novel Diagnostics
Microchips & Microarrays - DNA Gene Expression - mRNA -cDNA Proteomics - protein modification
Novel Therapeutics
Drug Target Discovery Rational Drug Design Molecular Docking Gene Therapy
Understanding Disease
Inherited Diseases - OMIM Infectious Diseases
Pathogenic Bacteria Doug Brutlag, 2002 Viruses
Central Paradigm of Medicine
DNA
RNA
Protein
Symptoms (Phenotype)
Opinions
Doug Brutlag, 2002
National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov)
Doug Brutlag, 2002
NCBI Genes & Diseases
(http://www.ncbi.nlm.nih.gov/disease/)
Doug Brutlag, 2002
NCBI: Online Mendelian Inheritance in Man
(http://www.ncbi.nlm.nih.gov/omim/)
Doug Brutlag, 2002
Diagnosis Using DNA Arrays
(http://www.affymetrix.com/)
Doug Brutlag, 2002
Diagnosis of Cystic Fibrosis
Doug Brutlag, 2002
Affymetrix M. tuberculosis Chip
(courtesy Tom Gingeras, Affymetrix)
M. tuberculosis (H37Rv) Array
M. tuberculosis
(H37Rv)
Interrogates 4706 genome loci - 3983 Genes
4,411,529 bp
S.T. Cole, etal (1998) Nature 393 : 537
Doug Brutlag, 2002
Single Nucleotide Polymorphisms (SNPs)
(http://www.ncbi.nlm.nih.gov/SNP/)
GCTGTATGACTAGAAGATCGAT GCTGTATGACGAGAAGATCGAT
Individual's genomes differ from each other by 0.1% There are 3 million polymorphic sites in the human genome SNPs an be used for identification SNPs can be used for diagnosis of disease
Doug Brutlag, 2002
Single Nucleotide Polymorphisms (SNPs)
(http://www.ncbi.nlm.nih.gov/SNP/) Most SNPs are genetically neutral
Used in DNA fingerprints Forensic medicine Paternity Immigration in the United Kingdom
Some SNPs reflect distinguishing characteristics
Often the basis for discrimination or other stigma
Some SNPs cause disease (very rare) SNPs can serve as genetic markers for other traits
SNPs can be correlated with a predisposition disease to Clinical trials correlate SNPs with drug efficacy Clinical trials correlate SNPs adverse drug reactions
Doug Brutlag, 2002
Microarrayer in Pat Brown's Lab
(http://cmgm.stanford.edu/pbrown/)
Doug Brutlag, 2002
DNA Microarrays Measure Gene Expression (mRNA)
Doug Brutlag, 2002
Breast Cancers Classified by 456 Gene Expression Assays
(Srlie et al., PNAS 98, 10869-10874 (2001))
Doug Brutlag, 2002
Breast Cancers Classified by 456 Gene Expression Assays
(Srlie et al., PNAS 98, 10869-10874 (2001))
Doug Brutlag, 2002
Diagnostics Using Protein Gel Electrophoresis
(http://www.expasy.ch/ch2d/) (Prof. Denis Hochstrasser)
Doug Brutlag, 2002
Renal Cell Carcinoma
(Sarto C. et al, Electrophoresis 1997, 18, 599-604)
Normal
RCC
Normal
RCC
Doug Brutlag, 2002
Protease Mutations in Multidrug-Resistant HIV-1 Isolates from Heavily Treated Patients
(Bob Shafer & Tom Merigan)
54 48
82 10 63 71
Red: Mutations in Substrate Cleft Purple: "Accessory changes"
Doug Brutlag, 2002
Diagnosis of Drug Resistance in HIV Protease and Reverse Transcriptase
Doug Brutlag, 2002
Genomic & Bioinformatics Resources
DNA
Genome Sequences On Line Mendelian Inheritance in Man Inherited Disease Single-Nucleotide Polymorphisms (SNPs)
RNA
mRNA Expression Level Gene Expression Microarrays Disease Correlations
Proteins
Proteomics Structural Genomics Protein Ligand Docking
Doug Brutlag, 2002
Current Technical Challenges Using Genomic Information in Medicine
Genome is not complete; all genes are not yet identified
There are 100,000 gaps in public and private genomes We do not have mRNA libraries from all tissues and developmental stages Proteins, their locations and their modifications must be cataloged
Disease genes are not identified and charac...