3 Pages

sol2

Course: STAT 426, Fall 2008
School: University of Illinois,...
Rating:
 
 
 
 
 

Word Count: 366

Document Preview

426 STAT HW2 2.5. a. Neither. "1.7 times more ..." would mean a relative risk of 2.7. b. Let 1 denote the probability of getting invasive breast cancer for the women taking the drug and let 2 denote the probability of getting invasive breast cancer for the women taking placebo. 1 2 It is given that = (1 - 0.45). (i) the relative risk for those taking the drug compared to those taking 1...

Register Now

Unformatted Document Excerpt

Coursehero >> Illinois >> University of Illinois, Urbana Champaign >> STAT 426

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
426 STAT HW2 2.5. a. Neither. "1.7 times more ..." would mean a relative risk of 2.7. b. Let 1 denote the probability of getting invasive breast cancer for the women taking the drug and let 2 denote the probability of getting invasive breast cancer for the women taking placebo. 1 2 It is given that = (1 - 0.45). (i) the relative risk for those taking the drug compared to those taking 1 placebo: 2 = 0.55 (ii) the relative risk for those taking placebo compared to those taking the drug: 2 1 = 1 0.55 = 1.82 2.7. a. Quoted interpretation is that of relative risk. The correct interpretation is "The odds of survival for females was 11.4 times as high as the odds for males." b. Let 1 denote the probability of survival for females and let 2 denote 1 that for males. It is given that (1-1 ) = 2.9. It follows that 1 = 0.744. 1 (1-2 ) In addition we know (1-1 )2 = 11.4. So we have 2.9(1-2 ) = 11.4 and 2 2 = 0.203. (i) the proportion of survival for females: 1 = 0.744 (ii) the proportion of survival for females: 2 = 0.203 c. R = 2.16. a. The response variable is whether or not lung cancer is present. The explanatory variable is whether or not the patient smoked. 1 1 2 = 0.744 0.203 = 3.7 b. a case-control study c. The data cannot be used to compare smokers with nonsmokers in terms of the proportion suffered who lung cancer. This is because the column totals are artificially fixed. d. The odds ratio is given by ^ 688 59 = 2.97. = 650 21 The odds of getting lung cancer for smokers are 2.794 times the odds of getting lung cancer for smokers. The confidence interval for the log of the odds ratio is log(2.794) 1.96 1 1 1 1 + + + = (0.52, 1.54). 688 59 650 21 Since 0 is not included, we can state with 95% confidence that the odds ratio is different from 1, meaning that there is a positive association between smoking and lung cancer. 2.20 Table 1: Stage of Breast Cancer at Diagnosis and Living Arrangement advanced local total 59 85 144 109 100 209 53 36 89 221 221 442 living alone living with spouse living with others total The null hypothesis is H0 : "stage of breas...

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

University of Illinois, Urbana Champaign - STAT - 426
STAT 426 HW3 1. (1) Pearsons chi-square test statistic is 42.745 and the p-value is less than 0.0001 Therefore, we reject the null hypothesis of the independence. (2) The p-value from the Cochran-Armitage test is less than 0.0001. Therefore, there is
University of Illinois, Urbana Champaign - STAT - 426
Statistics 426 Sample Exam PRINT your name here: Important Notes: There are a total of three problems. You need to complete all parts with enough detail in your solutions to receive full credit. This is a closed-book exam, but you may use any calcula
University of Illinois, Urbana Champaign - STAT - 426
Statistics 426 Homework #3 1. A study on the computer usage and age based on a random sample of 500 people gave the following results. Three age groups are used in the study: young (20-30 years old), middle age (30-50 years old) and senior (over 50).
University of Illinois, Urbana Champaign - STAT - 426
Statistics 426 Homework #4 1. In a 2 by 2 table with nij as the cell counts, the conditional distribution of n11 given the row totals (n1+ , n2+ ) and the column totals (n+1 , n+2 ) is hypergeometric under the assumption of no association. Derive the
University of Illinois, Urbana Champaign - CS - 173
CS173: Discrete Mathematical Structures Spring 2006 Homework #9 Due 03/30/06, 8am1) Express E[X2] in terms of E[X] and Var[X]. 2) Let E1,E2,.,EN be N events from finite sample space. prove by induction that P(1 2 . )>=P(E1)+P(E2)+.+P(EN )-(n-1). 3)
University of Illinois, Urbana Champaign - CS - 473
CS 473ug: AlgorithmsMahesh Viswanathan vmahesh@cs.uiuc.edu 3232 Siebel CenterUniversity of Illinois, Urbana-ChampaignSpring 2006ViswanathanCS473ugIntroduction Solving Linear Programs DualityPart I Introduction to Linear ProgrammingViswa
Cal Poly Pomona - PHY - 133
Cal Poly Pomona, Physics 133L FALL 2008 Instructor: Dr. Nina Abramzon Office: Building 8 Room 224 email:nabramzon@csupomona.edu Phone: 869-4021Office Hours: Mon, Tue, Wed 10:00-11:00 , or by appointmentText: 133 Lab Manual Class web page: http:/ww
Cal Poly Pomona - PHY - 121
Cal Poly Pomona, Physics 121L FALL 2008 Instructor: Dr. Nina Abramzon Office: Building 8 Room 224 email:nabramzon@csupomona.edu Phone: 869-4021Office Hours: Mon, Wed 11:00-12:00 , or by appointmentText: 121 Lab Manual Class web page: http:/www.csu
Cal Poly Pomona - PHY - 133
Cal Poly Pomona, Physics 133 FALL 2008 Instructor: Dr. Nina Abramzon email:nabramzon@csupomona.edu Office: Building 8 Room 224 Phone: 869-4021 Office Hours: Mon, Wed. 11:00-12:00, or by appointment Materials: Text: Physics for Scientists and Enginee
Cal Poly Pomona - PHY - 299
Cal Poly Pomona, Physics 133 Recitation FALL 2008 Instructor: Dr. Nina Abramzon email:nabramzon@csupomona.edu Office: Building 8 Room 224 Phone: 909-869-4021 Office Hours: Mon, Wed. 11:00-12:00, or by appointment Materials: Text: The materials will
Cal Poly Pomona - PHY - 133
Grade Histogram16 14 12 # of Students 10 8 6 4 2 0> 55> 50> 38> 31ABGradeCDFClass average: 43/62 ( 70/100)
Cal Poly Pomona - PHYS - 130
Exam1Exam2Exam311, 1213, 1416, 1719, 2022, 2324, 2511, 1213, 1415-1718-2024,255/17/2008 10:36 A A A A A B B B B B B C C C C C 89.0% 86.2% 85.3% 84.7% 84.6% 84.1% 83.9% 83.2% 79.0% 78.9% 75.7% 71.9% 71.7% 68.8% 64.6% 62.5%
Cal Poly Pomona - APM - 300
APM300C - N5 Intro to Business May 2005 Room 112A B C D F 5 3 3 2 0 13.6% Extra Curve Class GPA 2.79 # of Students Ch 3&4 (3 in class) Ch 4&5 (4 in class) 13Instructor: Steve Boddeker Westwood-Anaheim B-Plan Presentation4-Team Project (Name) 5, 6
Cal Poly Pomona - SG - 150
SG150C - N5 SOFTWARE DEVELOPMENT LIFE CYCLE Jan 2006 Room 223 Instructor: Steve Boddeker Westwood-AnaheimA B C D F # of Students 12 Final Project (90%)87Class GPA 3.13 5.7%MidTerm7627-Jan010-Mar Final010-Feb c8, c14aDaily Grade2
Cal Poly Pomona - HUM - 400
6.4, 6.9, 6Polit, 7masc, why, 7reli, 7treCh 1,2 Thinking Critically (70% skipMaC3,4-Solving/Perceiving(60% skip4.3)Ch 8, 9 - Relate-Report/InferCh 8-9 Problem StatementCh 1,2 Thinking Critically5.2-5.8-5Atomic-6PaintHUM400C - N5 Creativ
Cal Poly Pomona - MTH - 111
MTH111C - N5 Algebra II Mar 2008 Rm111 F 6-10pm Westwood-AnaheimB C D F + A AB+ B+ C+ D+ D+ D D 2 1 4 0 5 -1 99% 90% 87% 83% 78% 67% 66% 65% 63%Instructor: Steve BoddekerDaily AssignmentsA2Students 9Curve20.0%q 6.3, 6.4q 8.1, 8.2q
University of Illinois, Urbana Champaign - CS - 273
University of Illinois at Urbana-Champaign Department of Computer ScienceHomework Assignment 4CS 273 Introduction to Theoretical Computer Science Fall Semester, 2005Due: Thursday, November 3, at the beginning of classTo facilitate grading, plea
University of Illinois, Urbana Champaign - CS - 591
FARMER: Finding Interesting Rule Groups in Microarray DatasetsGao Cong, Anthony K. H. Tung , Xin Xu, Feng PanDept. of Computer Science Natl. University of Singapore{conggao,atung,xuxin,panfeng}@comp.nus.edu.sgJiong YangDept. of Computer Science
University of Illinois, Urbana Champaign - CS - 498
Combinatorial Pattern MatchingCS 498 SS Saurabh SinhaGenomic Repeats Example of repeats: ATGGTCTAGGTCCTAGTGGTC Motivation to find them: Genomic rearrangements are often associated with repeats Trace evolutionary secrets Many tumors are chara
University of Illinois, Urbana Champaign - CS - 329
Technical Metrics for OO Systems1Technical Metrics A Metrics Suite for Object Oriented Design, Shyam R. Chidamber and Chris F. Kemerer IEEE Transactions on Software Engineering, June 1994, pp 476-493 Chapter 4 of Hamlet and Maybe, especially 4.
Cal Poly Pomona - SCI - 400
BIOLOGY 122 GUIDESci 400 Fall 2007Star Williams1CELLCYCLEParts of the Cell Cycle:1) M-phase (Mitotic phase) a. Prophase b. Metaphase c. Anaphase d. Telophase 2) Interphase a. Gap 1 (first growth phase) normal processes in the cell resum
Cal Poly Pomona - SCI - 400
Tutoring and Active Listening Techniques or "How to Get Your Tutee to Talk More Than You" TEN SECOND RULE After asking a question or follow up question, or beginning a problem, allow at least ten seconds for the student to respond. This may seem like
Cal Poly Pomona - SCI - 400
Instructor: Marcia Murry, Ph.D. 909.869.3446mmewers@csupomona.eduCourse DescriptionThe course is designed for students who are currently working as Instructional Student Assistants (ISAs) in the MaSH Center (Math Student Help Center) and CML labs
Cal Poly Pomona - SCI - 400
Sydney Henderson Star William Monica Truelson Huma Malik Winter 2008 MaSH Project Summary There are four different learning styles that students possess. They are visual, auditory, kinesthetic, and tactile learning style. Knowing what learning style
Cal Poly Pomona - SCI - 400
CHEMISTRY 122MaSH Center ManualSci 400 Fall 2007Huma MalikIntroduction to EquilibriumTwo types of reactions: irreversible and reversible. Concept of equilibrium only applies to reversible reactions.A+BC + D (reversible) Equilibriu
Cal Poly Pomona - SCI - 400
Cal Poly Pomona - SCI - 400
fi
Cal Poly Pomona - SCI - 400
Suggestions for Projects in Spring QuarterWeek 4: Work in groups to outline projects. Write a group proposal outlining members of your group and a description of your proposed project. One proposal per group should be e-mailed before next class meet
Cal Poly Pomona - SCI - 400
Case 2: Tutee expects tutor to do his/her work We are going to act out a scenario when a tutee comes in and expects us to complete his or her work. We will show what we should do as good tutors.CASE 2.Student: I need help. Can anybody come to my r
Cal Poly Pomona - EGR - 403
Chapter 7 - Rate of Return AnalysisEGR 403 Capital Allocation Theory Dr. Phillip R. RosenkrantzIndustrial & Manufacturing Engineering Department Cal Poly PomonaClick here for Streaming Audio To Accompany PresentaEGR 403 - The Big Picture Frame
Cal Poly Pomona - CH - 301
6The Manager as a Decision MakerIrwin/McGraw-Hill6-1The McGraw-Hill Companies, Inc., 20006-2Managerial Decision MakingDecisionmaking: the process by which managers respond to opportunities and threats by analyzing options, and making dec
Cal Poly Pomona - CIS - 466
Cal Poly Pomona - CIS - 466
Requirements Matrix (Report 1 version)Implemented Req. # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 Requirement Administrator, Agent, and Staff Username/password. Audit trail of Log-in / Failed Password Entry User-Session Establishment Dynamic
Cal Poly Pomona - CIS - 466
Business Rulesis linked toDollar/Unit Accounthas aFIN ID - Financial CodeA Dollar/Unit Account can be linked to one or more Financial Codes.is linked/unlinked toCustomerhas a A Customer can be linked/unlinked to one or more Bill To.Bil
Cal Poly Pomona - CIS - 466
Requirements Matrix (Final Report)Req. # A 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 Implemented Requirement Initial Design GUI Layout Administrator, Agent, and Staff Username/password. Audit trail of Log-in / Failed Password Entry User-Sessio
Cal Poly Pomona - CIS - 466
Establishing the Business ProblemBusiness Context STAR (Strategic Tool for Analysis and Reporting) is a client/server application specifically developed for the Home Video Finance group at Universal. They use the system to forecast the revenue and
Cal Poly Pomona - CIS - 466
Figure 6: Logical Data ModelFigure 7: Physical Data Model
Cal Poly Pomona - CIS - 466
Christina Phancklphan@gmail.com Creative, skilled IT technician with excellent analytical and problem solving skills, able to work unsupervised, meet deadlines and handled several projects simultaneously.EDUCATIONCalifornia Polytechnic University
Cal Poly Pomona - CIS - 466
JIANG DUcalpoly04@gmail.com OBJECTIVE EDUCATION SKILLS A full time or part time position related to information technology California State Polytechnic University, Pomona Expected Graduation:Bachelor of Science, Business Administration: Computer In
Cal Poly Pomona - CIS - 466
Western Regional Collegiate Cyber Defense Competition (WRCCDC) Team Packet Version 1 8/20/2007 2008 Western Regional Collegiate Cyber Defense Competition Team Packet Version 1.0 2007 California State Polytechnic
Cal Poly Pomona - CIS - 466
Team Members Hours Spent The following is a breakdown of the total number of hours that each team member spent on this project within each phase.Andy Total Hours Spent (6/26 7/28) = 53 Total Hours Spent (7/29/07 9/1/07) = 44Anthony Total
Cal Poly Pomona - CIS - 466
Derrick Ung7330 Teresa Ave, Rosemead, Ca 91770 Cellular 626-228-5117 Home 626-307-4292 Frozensnakes@gmail.comOBJECTIVETo obtain a position that will utilize my skills to the fullest. Offering skills and knowledge in computers such as MS word,
Cal Poly Pomona - CIS - 466
Team Norms Project is to be completed as a team and no free-riders will be tolerated Members will cover up for each other to get the job done and not try to create trouble for one another Meeting times will be followed as close as possible and discre
Cal Poly Pomona - CIS - 466
Project Requirements Matrix Requirement Number 1Requirement Review available hardware equipment Build a networkDescription Verify all boxes contain all necessary components Network has to consist of at least 10 computers with different operati
Cal Poly Pomona - CIS - 466
Cost and estimates Software Web space for website . Free MS Windows 2000 Professional. Free MS Windows XP Professional.. Free MS Windows 2000 Server . Free MS Windows 2003 Server . Free MS Exchange 2003 .. Free Ubuntu Operating System. Free Fedora Op
Cal Poly Pomona - CIS - 466
Project Requirements Matrix Requirement Number 1 Requirement Review available hardware equipment Build a network 2 Obtain and install necessary software Promote CCDC 4 Find sponsors 5 Communicate with east coast participants Build a website for CCDC
Cal Poly Pomona - CIS - 466
TimesheetFor period beginning: Ending: Name: Andy Chiu Title: Project Leader 6/24/07 6/30/07DateStart Time 6:00PMEnd Time 7:00PMMS Project Task # 7Task Notes Bring computers and equipments to room Check what equipment team needs Online mee
Cal Poly Pomona - CIS - 466
Cost and estimates Software Web space for website . Free MS Windows 2000 Professional. Free MS Windows XP Professional.. Free MS Windows 2000 Server . Free MS Windows 2003 Server . Free MS Exchange 2003 .. Free Ubuntu Operating System. Free Fedora Op
Cal Poly Pomona - CIS - 466
- Forwarded message -From: Christina Phan <cklphan@gmail.com> Date: Jul 22, 2007 2:14 PM Subject: CCDC - Student from Cal Poly Pomona To: Spengler@morainevalley.edu Erich Spengler, I was wondering if you receive my email. The email contains questions
Cal Poly Pomona - CIS - 466
Cal Poly Pomona Computer Information Systems 3801 W. Temple Ave. Pomona, CA 91768 To: Dr. Dan Manson CC: Director of Projects Subject: Senior Project: Blue Team Computer Set for CCDC Dear Dr. Manson, This letter is to give you an update of our curren
Cal Poly Pomona - CIS - 466
Team Norms Project is to be completed as a team and no free-riders will be tolerated Members will cover up for each other to get the job done and not try to create trouble for one another Meeting times will be followed as close as possible and discre
Cal Poly Pomona - CIS - 466
TimesheetFor period beginning: Ending: Name: Andy Chiu Title: Project Leader 7/1/07 7/7/07DateStart Time 9:00PMEnd Time 12:00AMMS Project Task # 17Task Notes(%) Complete 100Actual Hours 4Estimated Hours 4Diff.7/2/07Compile repo
Cal Poly Pomona - CIS - 466
Project Requirements Matrix Requirement Number 1 Requirement Review available hardware equipment Build a network 2 Obtain and install necessary software Promote CCDC 4 Find sponsors 5 Communicate with east coast participants Build a website for CCDC
Cal Poly Pomona - CIS - 466
Software Needed1. Windows 2000 Professional 2. Windows XP Professional 3. Windows 2000 Server 4. Windows 2003 Server 5. Exchange 2003 6. Ubuntu Operating System 7. Fedora Operating System 8. Solaris Operating System 9. MySQL 10. osCommerce 11. PHP
Cal Poly Pomona - CIS - 466
Anthony Darren ChuEmail: anthonychu1985@gmail.comOBJECTIVE To obtain a full-time job in which I can utilize my multimedia, database, and web development skills. EDUCATION California State Polytechnic University, Pomona Bachelor of Science in Busin
Cal Poly Pomona - CIS - 466
Equipment Inventory Items Computer Boxes Monitors Keyboards Mice 2-Port KVM Set of 512MB Ram Set of 1GB Ram Cisco 2900 Series XL Switch RJ45 Cables For This Project 10 5 5 5 5 9 1 1 10 On-Hand 10 5 5 5 1 9 1 1 2 On-Order 0 0 0 0 4 0 0 0 8WestCoastR
Cal Poly Pomona - CIS - 466
Project Proposal For Cal Poly Pomona to host the CCDC, the Computer Information Systems (CIS) department needs to expand on the competition equipments inventory by adding an additional set of blue team computer systems. Furthermore, the CIS departm
Cal Poly Pomona - CIS - 466
Flyer Sample 1West Coast Regional Cyber Defense Competition Page 12 West Coast Regional Cyber Defense Competition Page 13 Flyer Sample 2Flyer FrontWest Coast Regional Cyber Defense Competition Page 14
Cal Poly Pomona - CIS - 466
Flyer Printing The digital files for our flyers and postcards are located on our server under: 134.71.196.41/files/Photoshop Files For printing of flyers and postcards, we have determined that the two best choices would be Gas Creative Group, which
Cal Poly Pomona - CIS - 466
Project Proposal For Cal Poly Pomona to host the CCDC, the Computer Information Systems (CIS) department needs to expand on the competition equipments inventory by adding an additional set of blue team computer systems. Furthermore, the CIS departmen
Cal Poly Pomona - CIS - 466
Business ContextCalifornia State Polytechnic University, Pomona is one of the 23 Cal State campuses, as well as, one of the few polytechnic universities nationwide. Dr. Dan Manson, a professor in the field of Computer Information Systems is interes