Register now to access 7 million high quality study materials (What's Course Hero?) Course Hero is the premier provider of high quality online educational resources. With millions of study documents, online tutors, digital flashcards and free courseware, Course Hero is helping students learn more efficiently and effectively. Whether you're interested in exploring new subjects or mastering key topics for your next exam, Course Hero has the tools you need to achieve your goals.
1 Page
phys130
Course: PHYS 130, Fall 2009School: Cal Poly Pomona
Rating:
Word Count: 208
Document Preview
12 13, Exam1 Exam2 Exam3 11, 14 16, 17 19, 20 22, 23 24, 25 11, 12 13, 14 15-17 18-20 24,25 5/17/2008 10:36 A A A A A B B B B B B C C C C C 89.0% 86.2% 85.3% 84.7% 84.6% 84.1% 83.9% 83.2% 79.0% 78.9% 75.7% 71.9% 71.7% 68.8% 64.6% 62.5% 92 d53 80 80 87 D 86 87 100 93 70 97 100 93 143 100 d45 D D D 100 75 100 50 100 88 100 100 88 96 75 91 91 D 93 89 90 95 D 76 80 85 90 90 85 90 100 67 100 100 87...
Unformatted Document Excerpt
Coursehero >> California >> Cal Poly Pomona >> PHYS 130Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
12
13, Exam1
Exam2
Exam3
11, 14
16, 17
19, 20
22, 23
24, 25
11, 12
13, 14
15-17
18-20
24,25
5/17/2008 10:36 A A A A A B B B B B B C C C C C 89.0% 86.2% 85.3% 84.7% 84.6% 84.1% 83.9% 83.2% 79.0% 78.9% 75.7% 71.9% 71.7% 68.8% 64.6% 62.5%
92 d53 80 80 87 D
86 87 100 93 70 97 100 93 143 100 d45 D D
D
100 75 100 50 100 88 100 100 88 96 75 91 91 D
93 89 90 95 D
76 80 85 90 90 85 90
100 67 100 100 87 80 79 80 D 92 93 93 93 D
90 93 100 87 127 100 100 100 100 100 50 D
100 100 100 100 95 90 d83 110 95 87 94 85 88 98 100 90 d76 92 85 85 80 90 74 88 87 95 88 93 80 75 85 70 85 80
87 86 100 88 93 d60 97 87 100 125 100 100 100 100 100 100 d88 d75 100 d88 100 95 d78 99 97 91 80 97 D
85 d80 87 93 93 87 100 93 100 93 90 100 d67 100 125 d83 100 100 d75 100 100 88 d50 100 88 100 90 d78 99 97 91 d80 97 85 88 87 95 88 93 81 85 83 78 65 80 77 80 73 87 73 d53 86 87 100 93 D 54 93 87 87 87 80 100 87 D D 97 87 93 143 100 d45 83 75 100 d75 100 d50 100 88 96 100 88 96 d75 91 91 81 93 89 90 95 96 d76 80 93 78 80 70 80 92 83 D 87 90 90 93 81 80 80 88 83 75
80 90 87 100 132 83 100 83 d75 100 d67 d63 75 100 88 100 100 87 97 83 92 D
d69 87 80 93 87 87 79 73 88 87 d70 93 80 87 127 100 100 100 100 100 d50 100 100 100 100 100 95 90 d83 110 95 d87 99 85 88 98 100 90 90 92 75 83 75 100 64 85 d53 93 100 87 87 100 93 100 93 90 97 d73 100 132 100 100 100 100 100 100 d88 d75 100 D 77 80 67 90 80 73 D 67 63 80 D 100 90 78 99 97 91 80 92 85 D 87 95 88 D 81 90 78 78 80 65
90 93 93 120 100 100 100 100 d86 d50 100 100 100 100 100 95 90 D
110 95 87 99 85 88 98 90 D
90 92 80 55 65 78 71
54 93 87 93 d53 87 86 87 100 93 70 100 60 D 87 54 47 67 D 80 50 D 80 25 53 0 60 47 60
d83 100 100 d75 100 100 88 d50 100 88 100 100 d78 99 D 0 D 100 D D
91 80 98 85 82 80 95 88 89 80 78 65 70 70 73 90 87 70 80 70 60 80 0 0 58 85 73 75 78 0 78 75 88 50 59
75 86 d50 100 75 75 100 100 70 81 83 108 92 94 94 d63 82 98 100 D D 86 60 0 75 75 100 100 65 81 D 108 D
90
77 87 73 63 67 67 d57 67 63 73 90 80 d60 67 113 83 D 54 67 67 47 53 D 100 100 87 D
94 63 82 54 70 80 D
0 90
43 53 50 93 70 87 67 87 125 d50 100 83 75 100 d67 100 75 d38 100 100 80 66 77 80 89 69 D 77 40 60 127 83 D d50 56 100 67 100 75 d38 100 100 D 50 d38 D 66 77 D
95 96 63 0 95
73 60 93 73 50 67 D D
89 69 91 70 80
0 63 87 60 70 48 63 75
46 93 40 53 67 60 14 73 D 62 D 47 60 D
60 83 40 67 105 50 100 83 75 100 75 D 0 60 113 D
100 95 66 77 D
89 69 81 70 80 90 90 96 d63 87 65 65 48 50 56 70 80 0 95 96 63 87 43 33 58 53 70
53 93 73 25 67 30 83
100 d50 56 100 67 100 75 D
100 100 95 D
77 80 89 69 D
74 82 77 81 79 74 80 80 73 83 67 89 68 8...
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more.
Course Hero has millions of course specific materials providing students with the best way to expand
their education.
Below is a small sample set of documents:
Below is a small sample set of documents:
Cal Poly Pomona - APM - 300
APM300C - N5 Intro to Business May 2005 Room 112A B C D F 5 3 3 2 0 13.6% Extra Curve Class GPA 2.79 # of Students Ch 3&4 (3 in class) Ch 4&5 (4 in class) 13Instructor: Steve Boddeker Westwood-Anaheim B-Plan Presentation4-Team Project (Name) 5, 6
Cal Poly Pomona - SG - 150
SG150C - N5 SOFTWARE DEVELOPMENT LIFE CYCLE Jan 2006 Room 223 Instructor: Steve Boddeker Westwood-AnaheimA B C D F # of Students 12 Final Project (90%)87Class GPA 3.13 5.7%MidTerm7627-Jan010-Mar Final010-Feb c8, c14aDaily Grade2
Cal Poly Pomona - HUM - 400
6.4, 6.9, 6Polit, 7masc, why, 7reli, 7treCh 1,2 Thinking Critically (70% skipMaC3,4-Solving/Perceiving(60% skip4.3)Ch 8, 9 - Relate-Report/InferCh 8-9 Problem StatementCh 1,2 Thinking Critically5.2-5.8-5Atomic-6PaintHUM400C - N5 Creativ
Cal Poly Pomona - MTH - 111
MTH111C - N5 Algebra II Mar 2008 Rm111 F 6-10pm Westwood-AnaheimB C D F + A AB+ B+ C+ D+ D+ D D 2 1 4 0 5 -1 99% 90% 87% 83% 78% 67% 66% 65% 63%Instructor: Steve BoddekerDaily AssignmentsA2Students 9Curve20.0%q 6.3, 6.4q 8.1, 8.2q
University of Illinois, Urbana Champaign - CS - 273
University of Illinois at Urbana-Champaign Department of Computer ScienceHomework Assignment 4CS 273 Introduction to Theoretical Computer Science Fall Semester, 2005Due: Thursday, November 3, at the beginning of classTo facilitate grading, plea
University of Illinois, Urbana Champaign - CS - 591
FARMER: Finding Interesting Rule Groups in Microarray DatasetsGao Cong, Anthony K. H. Tung , Xin Xu, Feng PanDept. of Computer Science Natl. University of Singapore{conggao,atung,xuxin,panfeng}@comp.nus.edu.sgJiong YangDept. of Computer Science
University of Illinois, Urbana Champaign - CS - 498
Combinatorial Pattern MatchingCS 498 SS Saurabh SinhaGenomic Repeats Example of repeats: ATGGTCTAGGTCCTAGTGGTC Motivation to find them: Genomic rearrangements are often associated with repeats Trace evolutionary secrets Many tumors are chara
University of Illinois, Urbana Champaign - CS - 329
Technical Metrics for OO Systems1Technical Metrics A Metrics Suite for Object Oriented Design, Shyam R. Chidamber and Chris F. Kemerer IEEE Transactions on Software Engineering, June 1994, pp 476-493 Chapter 4 of Hamlet and Maybe, especially 4.
Cal Poly Pomona - SCI - 400
BIOLOGY 122 GUIDESci 400 Fall 2007Star Williams1CELLCYCLEParts of the Cell Cycle:1) M-phase (Mitotic phase) a. Prophase b. Metaphase c. Anaphase d. Telophase 2) Interphase a. Gap 1 (first growth phase) normal processes in the cell resum
Cal Poly Pomona - SCI - 400
Tutoring and Active Listening Techniques or "How to Get Your Tutee to Talk More Than You" TEN SECOND RULE After asking a question or follow up question, or beginning a problem, allow at least ten seconds for the student to respond. This may seem like
Cal Poly Pomona - SCI - 400
Instructor: Marcia Murry, Ph.D. 909.869.3446mmewers@csupomona.eduCourse DescriptionThe course is designed for students who are currently working as Instructional Student Assistants (ISAs) in the MaSH Center (Math Student Help Center) and CML labs
Cal Poly Pomona - SCI - 400
Sydney Henderson Star William Monica Truelson Huma Malik Winter 2008 MaSH Project Summary There are four different learning styles that students possess. They are visual, auditory, kinesthetic, and tactile learning style. Knowing what learning style
Cal Poly Pomona - SCI - 400
CHEMISTRY 122MaSH Center ManualSci 400 Fall 2007Huma MalikIntroduction to EquilibriumTwo types of reactions: irreversible and reversible. Concept of equilibrium only applies to reversible reactions.A+BC + D (reversible) Equilibriu
Cal Poly Pomona - SCI - 400
Cal Poly Pomona - SCI - 400
Suggestions for Projects in Spring QuarterWeek 4: Work in groups to outline projects. Write a group proposal outlining members of your group and a description of your proposed project. One proposal per group should be e-mailed before next class meet
Cal Poly Pomona - SCI - 400
Case 2: Tutee expects tutor to do his/her work We are going to act out a scenario when a tutee comes in and expects us to complete his or her work. We will show what we should do as good tutors.CASE 2.Student: I need help. Can anybody come to my r
Cal Poly Pomona - EGR - 403
Chapter 7 - Rate of Return AnalysisEGR 403 Capital Allocation Theory Dr. Phillip R. RosenkrantzIndustrial & Manufacturing Engineering Department Cal Poly PomonaClick here for Streaming Audio To Accompany PresentaEGR 403 - The Big Picture Frame
Cal Poly Pomona - CH - 301
6The Manager as a Decision MakerIrwin/McGraw-Hill6-1The McGraw-Hill Companies, Inc., 20006-2Managerial Decision MakingDecisionmaking: the process by which managers respond to opportunities and threats by analyzing options, and making dec
Cal Poly Pomona - CIS - 466
Cal Poly Pomona - CIS - 466
Requirements Matrix (Report 1 version)Implemented Req. # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 Requirement Administrator, Agent, and Staff Username/password. Audit trail of Log-in / Failed Password Entry User-Session Establishment Dynamic
Cal Poly Pomona - CIS - 466
Business Rulesis linked toDollar/Unit Accounthas aFIN ID - Financial CodeA Dollar/Unit Account can be linked to one or more Financial Codes.is linked/unlinked toCustomerhas a A Customer can be linked/unlinked to one or more Bill To.Bil
Cal Poly Pomona - CIS - 466
Requirements Matrix (Final Report)Req. # A 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 Implemented Requirement Initial Design GUI Layout Administrator, Agent, and Staff Username/password. Audit trail of Log-in / Failed Password Entry User-Sessio
Cal Poly Pomona - CIS - 466
Establishing the Business ProblemBusiness Context STAR (Strategic Tool for Analysis and Reporting) is a client/server application specifically developed for the Home Video Finance group at Universal. They use the system to forecast the revenue and
Cal Poly Pomona - CIS - 466
Christina Phancklphan@gmail.com Creative, skilled IT technician with excellent analytical and problem solving skills, able to work unsupervised, meet deadlines and handled several projects simultaneously.EDUCATIONCalifornia Polytechnic University
Cal Poly Pomona - CIS - 466
JIANG DUcalpoly04@gmail.com OBJECTIVE EDUCATION SKILLS A full time or part time position related to information technology California State Polytechnic University, Pomona Expected Graduation:Bachelor of Science, Business Administration: Computer In
Cal Poly Pomona - CIS - 466
Western Regional Collegiate Cyber Defense Competition (WRCCDC) Team Packet Version 1 8/20/2007 2008 Western Regional Collegiate Cyber Defense Competition Team Packet Version 1.0 2007 California State Polytechnic
Cal Poly Pomona - CIS - 466
Team Members Hours Spent The following is a breakdown of the total number of hours that each team member spent on this project within each phase.Andy Total Hours Spent (6/26 7/28) = 53 Total Hours Spent (7/29/07 9/1/07) = 44Anthony Total
Cal Poly Pomona - CIS - 466
Derrick Ung7330 Teresa Ave, Rosemead, Ca 91770 Cellular 626-228-5117 Home 626-307-4292 Frozensnakes@gmail.comOBJECTIVETo obtain a position that will utilize my skills to the fullest. Offering skills and knowledge in computers such as MS word,
Cal Poly Pomona - CIS - 466
Team Norms Project is to be completed as a team and no free-riders will be tolerated Members will cover up for each other to get the job done and not try to create trouble for one another Meeting times will be followed as close as possible and discre
Cal Poly Pomona - CIS - 466
Project Requirements Matrix Requirement Number 1Requirement Review available hardware equipment Build a networkDescription Verify all boxes contain all necessary components Network has to consist of at least 10 computers with different operati
Cal Poly Pomona - CIS - 466
Cost and estimates Software Web space for website . Free MS Windows 2000 Professional. Free MS Windows XP Professional.. Free MS Windows 2000 Server . Free MS Windows 2003 Server . Free MS Exchange 2003 .. Free Ubuntu Operating System. Free Fedora Op
Cal Poly Pomona - CIS - 466
Project Requirements Matrix Requirement Number 1 Requirement Review available hardware equipment Build a network 2 Obtain and install necessary software Promote CCDC 4 Find sponsors 5 Communicate with east coast participants Build a website for CCDC
Cal Poly Pomona - CIS - 466
TimesheetFor period beginning: Ending: Name: Andy Chiu Title: Project Leader 6/24/07 6/30/07DateStart Time 6:00PMEnd Time 7:00PMMS Project Task # 7Task Notes Bring computers and equipments to room Check what equipment team needs Online mee
Cal Poly Pomona - CIS - 466
Cost and estimates Software Web space for website . Free MS Windows 2000 Professional. Free MS Windows XP Professional.. Free MS Windows 2000 Server . Free MS Windows 2003 Server . Free MS Exchange 2003 .. Free Ubuntu Operating System. Free Fedora Op
Cal Poly Pomona - CIS - 466
- Forwarded message -From: Christina Phan <cklphan@gmail.com> Date: Jul 22, 2007 2:14 PM Subject: CCDC - Student from Cal Poly Pomona To: Spengler@morainevalley.edu Erich Spengler, I was wondering if you receive my email. The email contains questions
Cal Poly Pomona - CIS - 466
Cal Poly Pomona Computer Information Systems 3801 W. Temple Ave. Pomona, CA 91768 To: Dr. Dan Manson CC: Director of Projects Subject: Senior Project: Blue Team Computer Set for CCDC Dear Dr. Manson, This letter is to give you an update of our curren
Cal Poly Pomona - CIS - 466
Team Norms Project is to be completed as a team and no free-riders will be tolerated Members will cover up for each other to get the job done and not try to create trouble for one another Meeting times will be followed as close as possible and discre
Cal Poly Pomona - CIS - 466
TimesheetFor period beginning: Ending: Name: Andy Chiu Title: Project Leader 7/1/07 7/7/07DateStart Time 9:00PMEnd Time 12:00AMMS Project Task # 17Task Notes(%) Complete 100Actual Hours 4Estimated Hours 4Diff.7/2/07Compile repo
Cal Poly Pomona - CIS - 466
Project Requirements Matrix Requirement Number 1 Requirement Review available hardware equipment Build a network 2 Obtain and install necessary software Promote CCDC 4 Find sponsors 5 Communicate with east coast participants Build a website for CCDC
Cal Poly Pomona - CIS - 466
Software Needed1. Windows 2000 Professional 2. Windows XP Professional 3. Windows 2000 Server 4. Windows 2003 Server 5. Exchange 2003 6. Ubuntu Operating System 7. Fedora Operating System 8. Solaris Operating System 9. MySQL 10. osCommerce 11. PHP
Cal Poly Pomona - CIS - 466
Anthony Darren ChuEmail: anthonychu1985@gmail.comOBJECTIVE To obtain a full-time job in which I can utilize my multimedia, database, and web development skills. EDUCATION California State Polytechnic University, Pomona Bachelor of Science in Busin
Cal Poly Pomona - CIS - 466
Equipment Inventory Items Computer Boxes Monitors Keyboards Mice 2-Port KVM Set of 512MB Ram Set of 1GB Ram Cisco 2900 Series XL Switch RJ45 Cables For This Project 10 5 5 5 5 9 1 1 10 On-Hand 10 5 5 5 1 9 1 1 2 On-Order 0 0 0 0 4 0 0 0 8WestCoastR
Cal Poly Pomona - CIS - 466
Project Proposal For Cal Poly Pomona to host the CCDC, the Computer Information Systems (CIS) department needs to expand on the competition equipments inventory by adding an additional set of blue team computer systems. Furthermore, the CIS departm
Cal Poly Pomona - CIS - 466
Flyer Sample 1West Coast Regional Cyber Defense Competition Page 12 West Coast Regional Cyber Defense Competition Page 13 Flyer Sample 2Flyer FrontWest Coast Regional Cyber Defense Competition Page 14
Cal Poly Pomona - CIS - 466
Flyer Printing The digital files for our flyers and postcards are located on our server under: 134.71.196.41/files/Photoshop Files For printing of flyers and postcards, we have determined that the two best choices would be Gas Creative Group, which
Cal Poly Pomona - CIS - 466
Project Proposal For Cal Poly Pomona to host the CCDC, the Computer Information Systems (CIS) department needs to expand on the competition equipments inventory by adding an additional set of blue team computer systems. Furthermore, the CIS departmen
Cal Poly Pomona - CIS - 466
Business ContextCalifornia State Polytechnic University, Pomona is one of the 23 Cal State campuses, as well as, one of the few polytechnic universities nationwide. Dr. Dan Manson, a professor in the field of Computer Information Systems is interes
Cal Poly Pomona - CIS - 406
Michigan State University - NCERA - 125
NCERA125 Illinois Report 2005 2006 1) Project title: Effects of commercially available surfactants on the survival and infectivity of the entomopathogenic nematodes, Steinernema feltiae (Nematoda: Steinernematidae) and Heterorhabditis indica (Nemato
University of Illinois, Urbana Champaign - ECON - 302
MID-TERM I ECON302, 9:30AM (YELLOW) Name: E-mail:February 23, 2006All questions must be answered on this test form! The answers in the boxes count. For each question you must show your work and (or) provide a clear argument. All graphs must be ac
Cal Poly Pomona - URP - 337
URP 337 Planning public infrastructure Lecture 2 28 March 2001Public goodsIntroductionPlanning draws on many other fields. No planner can become expert in all these fields, but most planners need some familiarity with a number of fields. Most im
Cal Poly Pomona - MHR - 452
FA ST E S T G R O W I N GEARNINGS-PERSHARE GROWTHThree-yr. annual rates2004REVENUE GROWTHThree-yr. annual rateTOTAL RETURNThree-yr. annual rate (color=beat S&P 500)*RANKNET INCOMEpast four quarters (millions)RANKREVENUEpast four
University of Illinois, Urbana Champaign - CS - 476
Program Verication: Lecture 21Jos Meseguer eComputer Science Department University of Illinois at Urbana-Champaign1Membership Equational LogicMembership equational logic generalizes order-sorted equational logic. This generalization is expl
University of Illinois, Urbana Champaign - CS - 476
Program Verification: Lecture 19Jos Meseguer eComputer Science Department University of Illinois at Urbana-Champaign1Verification of Concurrent ProgramsWe will begin considering the topic of verification of concurrent programs. As for seque
University of Illinois, Urbana Champaign - CS - 476
Program Verification: Lecture 9Jos Meseguer eComputer Science Department University of Illinois at Urbana-Champaign1Structural Induction We have already observed how the ITP supports inductive proofs in three cases: natural number induction,
University of Illinois, Urbana Champaign - CS - 476
Program Verification: Lecture 4Jos Meseguer eComputer Science Department University of Illinois at Urbana-Champaign1Equational Deduction How can we prove that a given equation e is a theorem of an equational theory T ? We can do so by giving
University of Illinois, Urbana Champaign - CS - 438
The Big Picture00010001 11001001 00011101you are hereCS/ECE 338 Robin Kravets, UIUC - Spring 20071InternetworkingDealing with simple heterogeneity issues Defining a service model Defining a global namespace Structuring the namesp
University of Illinois, Urbana Champaign - CS - 476
Program Verification: Lecture 5Jos Meseguer eComputer Science Department University of Illinois at Urbana-Champaign1The E -Equality RelationNote that provable equality with -equations E defines a binary relation t X t between terms t, t T(
Cal Poly Pomona - B - 211
BIO 211 Test Pacs =2 (Xn i =1iX)2n 1SS = DFThe sample varianceVersion 11.0Revision Date: July 2004David J. Moriarty Biological Sciences Department California State Polytechnic UniversityBIO 211 Test PacVersion 11.0Page