4 Pages

Chodarr0165

Course: LIB 2771, Fall 2009
School: Sveriges...
Rating:
 
 
 
 
 

Word Count: 1293

Document Preview

EASTSIDE DOWNTOWN WOMEN'S CENTRE 44 East Cordova Street, Vancouver JANUARY 1995 I SUNDAY 2 HAPPY NEW YEAR! 12:OO Bingo 5:00 Circle MONDAY TUESDAY 3 1-3 Health nurse 1:30 Women's WEDNESDAY THURSDAY FRIDAY SATURDAY CENTRE CLOSED voice 5:00 Women Surviving Together 10 1-3 Health nurse 1:30 Women's l:00 Beading 3:00 educ. video 10:30 learning grp 1:3O Raffle 2 5 0 Video 1:30 Haircuts 2 3 0 Video 5 0 0...

Register Now

Unformatted Document Excerpt

Coursehero >> Other International >> Sveriges lantbruksuniversitet >> LIB 2771

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
EASTSIDE DOWNTOWN WOMEN'S CENTRE 44 East Cordova Street, Vancouver JANUARY 1995 I SUNDAY 2 HAPPY NEW YEAR! 12:OO Bingo 5:00 Circle MONDAY TUESDAY 3 1-3 Health nurse 1:30 Women's WEDNESDAY THURSDAY FRIDAY SATURDAY CENTRE CLOSED voice 5:00 Women Surviving Together 10 1-3 Health nurse 1:30 Women's l:00 Beading 3:00 educ. video 10:30 learning grp 1:3O Raffle 2 5 0 Video 1:30 Haircuts 2 3 0 Video 5 0 0 Circle 9 11:00 Spanish 2:00 Educ. video 2 3 0 Outing 5:00 Learning grp 1:30 Bingo 5:00 Circle 1 9 0 talk on "No I 22 1:00 Haircuts 1:30 Video 5:00 Circle Contact Orders" 5:00 learning grp 23 11:00 Spanish 1:30 talk on "Cus4ody & Access" 5:00 Learning grp Voice 5:00 Women Surviving Together 171-3 Health Nurse 1:30 Women's Voice 5:00 Women Surviving Together 24 1-3 Health nurse 1 3 0 Women's l:00 Beading 3:00 educ. video 10:30 Learning grp 1:00 Law student 1 3 0 Raffle 2:30 Video 18 1:00 Beading 3r00 educ. video 19 10:30 Learning 1:00 law student 5:00 Voi. dinner 20 1:30-4:30 Dreamcatchers Workshop 25 CHEQUE DAY 26 1:30 learning grp 1:00 law student 27 1:3O Raffle 2:30 Video Voice 5:00 Women Surviving Together 31 1-3 Health nurse i:30 'Womens -- I ?.9n m. :" .. .uv ulllyu 5:00 Circle Hours: Mon 10:30 5 Tues. iu:30 5 - - Voice 5:00 Women Surviving Together Weds. 11:SO 5Thurs. 10:30 5 Fri. 1090 - 5 Sun. 12:OO 5 - 1230 Lunch JANUARY NEWS Well 1995 has arrived! Christmas at the centre was great. We had six seatings of fifty five women per seating. So thankyou thankyou to all the wonderful volunteers who wrapped presents and helped with Christmas dinner. Staff News Welcome to Marion our new crisis counsellor. Marion is filling in for Carol while she is on maternity leave. Looks like we'll be doing another hiring. Catharine and Pam have officially resigned. The volunteer coordinator and programming positions are being reevaluated and we will be also looking to fill the new position of Victim assistance worker.. Patti and Kathleen will continue in the positions they have been doing until the end of January. So sad good-byes to Pam and Catharine. Uocomin~ January in We will be open on New Year's day and our first circle for addictions will be that evening. Our outing for January will be ice skating at Britannia on Monday January 9th. We can get skates at Britannia, so limber up and lets see some of those fancy triple sow cows and double axles. Julie will be doing another dream catchers workshop on Fri Jan. 20th. Jilie's workshops are always well attended and in great demand. The Volunteer dinner will be Thursday January 19th. Due to a lack of attendance and participation the newsletter committee has been canceled. WELL HERE'S TO A HAPPY 1995!!!! Legal Info & News -----I 3 MIDWIFERY ONE STEP CLOSER: Women in B.C. will soon have the option of a midwife-assisted birth. The provincial government has announced that a college of midwives will be established in the spring of 1995 to "license and regulate the profession". Right now, until the college is set up, midwifery without supervision by a physician is illegal in B.C. An aboriginal midwifery committee will be set up within the college to (hopefully) recognize the cultural differences in the practice of midwifery among First Nations women. This will be followed by a number of pilot projects before women can easily access the services of a midwife. The B.C. Ministry of Health has stated that it "supports the principle of full public funding for midwifery services" but no details are available. Seeing is believing, no? 3 LEGAL AID UPDATE ON FAMILY LAW: Legal Aid is available to any woman on welfare who is in a situation that threatens the immediate safety of herself or her children. Emergencies include: if you or your children are at risk of abuse, if your child is "apprehended" by social services, if you need to get a family maintenance order, or when there is a dispute over custody or access to your children. Recently, were there some changes in the way that the Legal Services Society (legal aid) handles family law cases. In emergency cases, you will still be be for the specific entitled to a referral to a lawyer. But the referral will emergency that needs dealing with right now. After that, the lawyer will fill out a form telling Legal Services whether or not you still need herlhis legal assistance. And, unfortunately, if some other family law emergency comes up later, you will have to go back to Legal Aid and apply aqain. They can then refer you back to the same lawyer, or a different lawyer if you so choose. In any case, the Legal Services Society itself will now form part of the legal-client relationship. This means that you will have to agree to let the lawyer share any information about your case with Legal Services. Note: Even if your situation is NOT an emergency, you may still be able to get help from legal aid; for example, if there are no other services or information available, if you don't speak English very well, or you cannot understand hat to do next. Legal Aid offices are listed in the White Pages phonebook. FREE LAW CLASSES: The People's Law school offers classes all over Vancouver on such topics as Alternatives to Court, Custody & Access, Tenancy Laws, Welfare Rights, and many other topics. All you need to do is call ahead to reserve a space. Ask Sonia for a copy of the winter schedule and tel numbers. 3 3 RETURN OF THE LAW STUDENTS: Starting the second week of January, law students will be available at the centre on Thursdays at 1pm. For the last couple of years, U.B.C.'s Law Student Legal Assistance Program has generously provided us with students to assist women who have problems with welfare, landlords, ICBC, human rights or any other area of law. They were off for the month of December to write exams -- we're eager to welcome them back. An additional law student may also be available on Tuesdays andlor Wednesdays, but this has yet to be confirmed. Best to call us at 681-8480 before coming down to the centre. 3 LEGAL PROGRAMMING NOTES: Jan. 16th -- Ruth L. Taylor, a lawyer in private practice, will be giving a talk on NO CONTACT ORDERS. Have you ever identified yourself as a battered woman? Ever find yourself in a position where you have to choose between pressing charges of assault or getting a no-contact order? Do the cops ignore you...

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy phonetics/phonology & morphology:# Passive imperative ending in Malagasy: ESRC-OX-05-CR107.#
Sveriges lantbruksuniversitet - IR - 2773
DOWNTOWN EASTSIDE WOMEN'S CENTRE 44 East Cordova Street, Vancouver FEBRUARY 'II-SUNDAY1MONDAYTUESDAYWEDNESDAY1 1 3 Health nurse 1:00 Beading 3:00 educ. videoTHURSDAY2 1-3 MargaretlAlDS Vancouver 1030 learning grpFRIDAYSATURDAY
Sveriges lantbruksuniversitet - LIB - 2773
DOWNTOWN EASTSIDE WOMEN'S CENTRE 44 East Cordova Street, Vancouver FEBRUARY 'II-SUNDAY1MONDAYTUESDAYWEDNESDAY1 1 3 Health nurse 1:00 Beading 3:00 educ. videoTHURSDAY2 1-3 MargaretlAlDS Vancouver 1030 learning grpFRIDAYSATURDAY
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy lexicon:# Malagasy Roots without a passive meaning: ESRC-OX-05-CR302.# These are roots witho
Sveriges lantbruksuniversitet - IR - 2637
Creators of the CommonsHeather Morrison BC Electronic Library Network & The Imaginary Journal of Poetic EconomicsCopyright in Libraries: The Digital onundrum CLA Information Commons Interest Group Preconference to Canadian Library Association Conf
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Nominals in Malagasy - ESRC-OX-06-CR210.# Malagasy Nominals.testfile.
Sveriges lantbruksuniversitet - IR - 3580
Wecandos o r n e t h i n a -People d o not end up o n the streets by accident. Public policy and urban development trends can either contribute to poverty and homelessness or prevent it. Vancouver is at a turning point; w e n o w have
Sveriges lantbruksuniversitet - LIB - 3580
Wecandos o r n e t h i n a -People d o not end up o n the streets by accident. Public policy and urban development trends can either contribute to poverty and homelessness or prevent it. Vancouver is at a turning point; w e n o w have
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Malagasy Coordination - ESRC-OX-06-CR208.# Malagasy Coordination.testf
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Grammatical functions, roots and stems in Malagasy - ESRC-OX-06-CR209.# Gr
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Malagasy verbs of saying - - ESRC-OX-05-CR205.# This document will explor
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax & semantics:# Malagasy Causatives & CONTROL: ESRC-OX-05-CR202.# Causative prefixes amp(
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Malagasy Pronouns - ESRC-OX-05-CR206.# In addition to the basic process
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Malagasy Prepositions - ESRC-OX-05-CR207.# Malagasy Prepositions.testfi
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax & semantics:# Malagasy simple sentences Case-marking & NPs: ESRC-OX-05-CR101/201.#
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy lexicon:# Malagasy Roots with a passive meaning: ESRC-OX-05-CR301.# There exist in Malagasy
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax & semantics:# Passive affixes in Malagasy - ESRC-OX-05-CR106/204.# As outlined in Randr
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax & semantics:# Malagasy Passives: ina/ana alternation. ESRC-OX-05-CR105/203.# Malagasy
Allan Hancock College - TIB - 2009360
QueenslandTelecommunicationsInterception Bill 2009 QueenslandTelecommunications Interception Bill2009Contents
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Adjectives & Adverbs in Malagasy - ESRC-OX-06-CR211# Adjectives & Adverb
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Grammatical functions, roots and stems in Malagasy - ESRC-OX-06-CR209.# G
Mt. Holyoke - PH - 256
Igneous Tourmaline HS#2356 Black Tourmaline 18mil 8/27/92 512 0 0 0 1 0 0 0 0 0 0.000000E+00 300.000 3.907231E+07 2.009
Cal Poly - INF - 6900
PC/Mikes Word Documents/Writing a paper.docHow to Write a PaperMike Ashby, Engineering Department, University of Cambridge, Cambridge CB2 1PZ, UK Version 5, January, 2000This brief manual gives guidance in writing a paper about your research. M
UC Davis - LOG - 0804
Sveriges lantbruksuniversitet - IR - 104
Open Access: Basics and Benefits"Open Access" has emerged in recent years as a major development in the world of scholarly communication. It may have the potential to greatly alter the university publishing environment and change the ways in which e
Sveriges lantbruksuniversitet - LIB - 104
Open Access: Basics and Benefits"Open Access" has emerged in recent years as a major development in the world of scholarly communication. It may have the potential to greatly alter the university publishing environment and change the ways in which e
Sveriges lantbruksuniversitet - IR - 1589
Frame and Metaphor in Political GamesIan BogostGeorgia Institute of Technology School of Literature Communication and Culture 686 Cherry St. Atlanta, GA 30332 USA +1 (404) 894-1160 ian.bogost@lcc.gatech.edu ABSTRACT This paper offers an approach to
Sveriges lantbruksuniversitet - LIB - 1589
Frame and Metaphor in Political GamesIan BogostGeorgia Institute of Technology School of Literature Communication and Culture 686 Cherry St. Atlanta, GA 30332 USA +1 (404) 894-1160 ian.bogost@lcc.gatech.edu ABSTRACT This paper offers an approach to
Sveriges lantbruksuniversitet - IR - 1618
1Architecting Scalability for Massively Multiplayer Online Gaming ExperiencesRui GilCISUC, University of Coimbra Polo II Universidade de Coimbra, 3030-290 Coimbra, Portugal +351-23979000 rgil@dei.uc.ptJos Pedro TavaresCISUC, University of Coi
Sveriges lantbruksuniversitet - IR - 1605
Designing Puzzles for Collaborative Gaming Experience CASE: eScapeTony ManninenUniversity of Oulu, Department of Information Processing Science LudoCraft Game Design and Research Unit PO Box 3000, FIN-90014 OULUN YLIOPISTO tony.manninen@oulu.fiT
East Los Angeles College - MAGD - 2649
The easiest way for CompScis to access Oxford University exam results without using the VPN=NOTE: You follow these instructions at your own risk!1. On Linux or Mac, type this at a command prompt:ssh -D 1080 yourusername@ecs.ox.ac.uk On Win
East Los Angeles College - MERT - 2255
2628 July 28 July 28 July 30 July 1 Aug 36 Aug 69 AugNP, PWDerigging camp: carried gear up from camp to 480m on rst day; derigged out from camp to 480m on second day. Helped NP and PW with derigging from camp. Finished derigging Pozo Chicago. Der
East Los Angeles College - MERT - 2255
Entrance P36 P42 Meandro del Guaje P5 P7 Siniestro Parcial (P57)No hay Cristal! (P60)C6P8 El Jardinet (P50) P6 P6 P17 Pozu Acrobatico (P67) El fet diferencial P15 P22 P14 P12 P16 Pous Electrics P6 P4 P6 P10 P7 P4 P80 P7 P5 P4 P15 P9La Pica (P25
East Los Angeles College - MERT - 2255
BYU - IT - 104
TransformersNo, this has nothing to do with that movie!XAdmin Applications Power-line networking Lab feedback? Too many missing labs Looking for a Webmaster for IT ExperienceLearning outcomes Describe mutual induction State ideal Xf
Sveriges lantbruksuniversitet - BUS - 312
Liquidity RatiosNet Working Capital = Net Working Capital as a % of Total Assets Current Assets Current Liabilities=Net Working Capital Total AssetsCurrent Ratio =Current Assets Current LiabilitiesCash + Marketable Securities + Receivables
BYU - BIO - 465
Structure PredictionTertiary protein structure: protein foldingThree main approaches: [1] experimental determination (X-ray crystallography, NMR) [2] Comparative modeling (based on homology) [3] Ab initio (de novo) prediction (Dr. Ingo Ruczinski a
Sveriges lantbruksuniversitet - ENGL - 20022
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ENGL 205-3 E01 TITLE: 17TH/18TH C. LITS. SEMESTER: 2002-2 LOCATION: SFU SECTION TYPE: LEC ENROL: 24= PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown
BYU - PHYSICS - 321
Physics 321 Take-home Test 6 Problem 1. A lamina is in the shape of a right triangle with the two sides (not the hypotenuse) with lengths a = 6.0 cm and b = 4.5 cm. The mass of the traingle is 250 g and the density is uniform. We choose the x-axis of
BYU - PHYSICS - 321
Physics 321 Homework 2 Due at midnight on the day of Hour 3. This homework is intended to help you understand how Maple can arrive at the solution of complicated differential equations numerically. The basic idea is that we can start with initial con
BYU - INBIO - 465
[starts PAUP]begin paup;setautoclose [closes the status window automatically]nowarntree [turns off the feature that prompts you to save trees in memory]nowarnreset [turns off feature that asks "do you really want to reset the data file
BYU - DAM - 465
[starts PAUP]begin paup;setautoclose [closes the status window automatically]nowarntree [turns off the feature that prompts you to save trees in memory]nowarnreset [turns off feature that asks "do you really want to reset the data file
BYU - WEEK - 465
[starts PAUP]begin paup;setautoclose [closes the status window automatically]nowarntree [turns off the feature that prompts you to save trees in memory]nowarnreset [turns off feature that asks "do you really want to reset the data file
BYU - INBIO - 465
newsRival demands sink genome alliance plansLondonSecret talks between rival teams racing to complete the sequencing of the human genome have failed, dashing hopes of collaboration and leaving a trail of recriminations. The two teams - the publi
BYU - DAM - 465
newsRival demands sink genome alliance plansLondonSecret talks between rival teams racing to complete the sequencing of the human genome have failed, dashing hopes of collaboration and leaving a trail of recriminations. The two teams - the publi
BYU - WEEK - 465
newsRival demands sink genome alliance plansLondonSecret talks between rival teams racing to complete the sequencing of the human genome have failed, dashing hopes of collaboration and leaving a trail of recriminations. The two teams - the publi
BYU - INBIO - 465
#NEXUSBEGIN DATA;DIMENSIONS NTAX=15 NCHAR=315;FORMAT DATATYPE=DNA GAP=- MISSING=?;MATRIXseq1CATTACACGCCAGACACCTCAACTGCTTTCTCATCAGTCGCACACATCTGCCGAGACGTCAACTGAGGACAAATATCATTCTGAGGCGCAACCGTCATCACCAACCTCTTATCAGCAATCCCTTATATCGGCACTACCTTAGTCGAAT
BYU - DAM - 465
#NEXUSBEGIN DATA;DIMENSIONS NTAX=15 NCHAR=315;FORMAT DATATYPE=DNA GAP=- MISSING=?;MATRIXseq1CATTACACGCCAGACACCTCAACTGCTTTCTCATCAGTCGCACACATCTGCCGAGACGTCAACTGAGGACAAATATCATTCTGAGGCGCAACCGTCATCACCAACCTCTTATCAGCAATCCCTTATATCGGCACTACCTTAGTCGAAT
BYU - WEEK - 465
#NEXUSBEGIN DATA;DIMENSIONS NTAX=15 NCHAR=315;FORMAT DATATYPE=DNA GAP=- MISSING=?;MATRIXseq1CATTACACGCCAGACACCTCAACTGCTTTCTCATCAGTCGCACACATCTGCCGAGACGTCAACTGAGGACAAATATCATTCTGAGGCGCAACCGTCATCACCAACCTCTTATCAGCAATCCCTTATATCGGCACTACCTTAGTCGAAT
East Los Angeles College - MAGD - 1129
ConsCiousness and Timeedinburgh university 1-3 april 2008abden House, Pollock HallsabstractsTuesday 1st april 3.455.00 Consciousness takes time: evidence from sequence learning, conditioning, and action studies. Prof axel Cleeremans (Cognitive
East Los Angeles College - MAGD - 1129
EXPERIENCE AND TIME: ABSTRACTWe are no less directly acquainted with the temporal structure of the world than with its spatial structure. We hear one word succeeding another; feel two taps as simultaneous; or see the glow of a firework persisting
Allan Hancock College - DDA - 1992264
[pic]Disability Discrimination Act 1992Act No. 135 of 1992 as amendedThis compilation was prepared on 27 March 2006taking into account amendments up to Act No. 86 of 2005and SLI 2006 No. 50The text of any of those amendments not in forceo
East Los Angeles College - PATH - 0116
AutoMACS User GuideThe autoMACS allows biomagnetic cell sorting of cells labelled with MACS microbeads. The MACS products are sold by Miltenyi Biotec (on-line catalogue at www.miltenyibiotec.com). The Dunn School autoMACS is located in Rm. 41, wher
Sveriges lantbruksuniversitet - ENGL - 20022
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ENGL 199-3 D01 LOCATION: SFU TITLE: INTRO UNIV. WRITING SECTION TYPE: SEM SEMESTER: 2002-2 ENROL: 18 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown
Sveriges lantbruksuniversitet - ARTS - 20022
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: SA 325-4 D01 LOCATION: SFU TITLE: POLITICAL SOCIOLOGY SECTION TYPE: SEM SEMESTER: 2002-2 ENROL: 28 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown s
Sveriges lantbruksuniversitet - ENGL - 20022
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ENGL 371-4 H01 LOCATION: DOW TITLE: WRITING:THEORY/PRAC SECTION TYPE: SEC SEMESTER: 2002-2 ENROL: 18 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown
Sveriges lantbruksuniversitet - POL - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: POL 422-4 D01 LOCATION: SFU TITLE: CAN.INTL.SECURITY SECTION TYPE: SEM SEMESTER: 2000-1 ENROL: 8 = PROGRAM OF STUDENT (Top 5 programs reported in each category) -Approved Intended Approved Certs, Majo
Sveriges lantbruksuniversitet - ARCH - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ARCH 340-5 D01 LOCATION: SFU TITLE: ZOOARCHAEOLOGY SECTION TYPE: LEC SEMESTER: 2000-1 ENROL: 23 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown sepa
BYU - ECE - 320
Clock and SynchronizationRTL Hardware Design by P. ChuChapter 161Outline1. 2. 3. 4. Why synchronous? Clock distribution network and skew Multiple-clock system Meta-stability and synchronization failure 5. SynchronizerRTL Hardware Design by
Sveriges lantbruksuniversitet - PSYC - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: PSYC 461-5 D01 LOCATION: SFU TITLE: ST-SOCIAL COGNITION SECTION TYPE: SEM SEMESTER: 2000-1 ENROL: 12 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown
Sveriges lantbruksuniversitet - CHEM - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: CHEM 122-2 D01 LOCATION: SFU TITLE: GENERAL CHEMISTRY II SECTION TYPE: LEC SEMESTER: 2000-1 ENROL: 300 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not sho