27 Pages

RootsnPm1

Course: CPGL 0015, Fall 2009
School: East Los Angeles College
Rating:
 
 
 
 
 

Word Count: 7240

Document Preview

Verb-initial # grammars: A multilingual/parallel perspective # ESRC Project RES-000-23-0505 # Oxford University # Charles Randriamasimanana # Malagasy lexicon: # Malagasy Roots without a passive meaning: ESRC-OX-05-CR302. # These are roots without a passive meaning: A to H. # Unlike roots with a passive meaning (a closed class), roots without a passive meaning represent # an open-ended class and will usually...

Register Now

Unformatted Document Excerpt

Coursehero >> California >> East Los Angeles College >> CPGL 0015

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Verb-initial # grammars: A multilingual/parallel perspective # ESRC Project RES-000-23-0505 # Oxford University # Charles Randriamasimanana # Malagasy lexicon: # Malagasy Roots without a passive meaning: ESRC-OX-05-CR302. # These are roots without a passive meaning: A to H. # Unlike roots with a passive meaning (a closed class), roots without a passive meaning represent # an open-ended class and will usually take an affix, i.e. a prefix, a suffix or both. akatra # Root 'ascension' # Root akatra 'ascension'; manakatra # 'to reach'; # transitive verb manakatra m+an+akatra 'pres-an-root.akatra''to reach'; miakatra # 'to ascend'; # intransitive verb miakatra m+i+akatra 'pres-i-root.akatra''to ascend'; akaro # '(let-sth)-be-lifted-by.you' # passive 1 imperative akaro stem.akar+o '(let-sth)-be-lifted-by.you'; akarina # '(sth)-usually-be-lifted' or '(sth-is-being-lifted'; # passive 1 indicative akarina stem.akar+ina '(sth)-usually-be-lifted' or '(sth-is-being-lifted'; mampiakatra #'to lift (sth)'; # corresponding to the MANIPULATIVE causative mampiakatra m+amp+i+akatra 'pres-caus-i-root.akatra' #'to lift (sth)'; mampakatra # 'to marry'; # mampakatra m+amp+akatra 'pres-caus-akatra''to marry'; ampiakaro # '(let-sth)-be-lifted-by.you'; # causative passive 1 imperative for mampiakatra ampiakaro amp+i+akaro 'caus-prf-stem.akar(o)': # (let-sth)-be-lifted-by.you'; ampiakarina # '(sth-be)-usually-lifted' or '(sth-is)-being-lifted'; # causative passive 1 indicative for mampiakatra ampiakarina amp+i+akar+ina 'caus-prf-stem.akar-ina' #'(sth-be)-lifted'; ampakarina # '(is-being)-taken-as-a-spouse'; # causative passive 1 for mampakatra ampakarina amp+akar+ina '(is-being)-taken-as-a-spouse'; anakaro # '(let-an-instrument)-be-used-by.you-to-reach'; # passive 2 imperative for manakatra anakaro an+stem.akar+o '(let-an-instrument)-be-used-by.you- # to-reach'; anakarana # (sth/INSTRUMENT)-to-be-used-to-reach'; # passive 2 indicative for manakatra anakarana an+akar+ana 'prf-stem.akar-ana'(sth)-to-be- # used-to-reach'; ampiakarana # '(the-instrument-used)-to-lift something'; # causative passive 2 indicative ampiakarana amp+i+akar+ana 'caus-prf-stem.akar-ana' # '(the-instrument-used)-to-lift something'; ampakarana # '(the circumstances-in-which-s.one)-to-be-taken-as-a-spouse'; # causative passive 2 for mampakatra ampakarana # amp+akar+ana '(the circumstances-in-which-s.one)-to-be-taken-as-a-spouse'; tafakatra # '(has-been)-able-to-go-upstairs'; # tafakatra tafa+akatra 'intransitive.perfective.tafa-root.akatra'(has-been)-able-to-go-upstairs'; fampakarana # 'the action of taking upstairs, the action of espousing'; # fampakarana f+amp+akar+ana 'nominalizer.f-pref.amp-stem.akar-suffix.ana'; fiakarana # 'the action of going up, ascension'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the secondary prefix amp; # fiakarana f+i+akar+ana 'nominalizer.f-pref.i-stem.akar+suffix.ana''ascension'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the primary prefix I. anatra # N 'advice'; # Root anatra 'advice'; mananatra # 'to advise'; # transitive active mananatra m+an+root.anatra 'to advise'; anaro # '(let-s.one)-be-advised-by.you'; # passive 1 imperative anaro stem.anar+o 'anar-by.you''(let-s.one)-be-advised-by.you'; anarina # '(the-one-who)-be-usually-advised-with-only-the initial-step-implemented' # or '(the-one-who-is)-being-advised with-only-the initial-step-implemented'; # passive 1 indicative anarina a+anar+ina 'prf.a-anar-suffix.ina''(the-one-who)-be-usually # -advised-with-only-the initial-step-implemented' or '(the-one-who-is)-being-advised with-only- # the initial-step-implemented'--with simplification of sequence a+anar > anar; nanarina # '(the-one-who)-was-advised'; # passive 1 past indicative nanarina n+(a)+anar+ina 'past.active-(prf.a)-stem.anar-suffix.ina' # note the virtual presence of the prefix a and the form n for past tense; hanarina # '(the-one-who)-will-be-advised'; # passive 1 future indicative hanarina h+(a)+anar+ina 'future.active-(prf.a)-stem.anar-suffix.ina' # note the virtual presence of the prefix a and the form h for future tense; ananaro # '(let-sth)-be-used-by.you-to-advise'; # passive 2 imperative ananaro an+anar+o 'prf.an-stem.anar-by.you''(let-sth)-be-used-by.you-to-advise'; ananarana # '(that-which)-be-used-to-advise'; # passive 2 indicative ananarana an+anar+ana 'prf.an-stem.anar-suffix.ana''(that-which)-be-used- # to advise'; nananarana # '(sth)-was-used-by.you-to-advise'; # passive 2 past tense indicative nananarana n+an+anar+ana 'past.active-prf.an-stem.anar-suffix.ana' # '(that-which)-was-used-to advise'; hananarana # '(sth)-will-be-used-by.you-to-advise'; # passive 2 future tense indicative hananarana h+an+anar+ana 'future.active-prf.an-stem.anar-suffix.ana' # '(that-which)-will.be-used-to advise'. mianatra # 'to learn'; # Root anatra 'advice'; transitive or intransitive mianatra m+i+anatra 'pres-prf.i-root.anatra''to learn'; ianaro # '(let-sth)-be-learnt-by.you'; # passive 1 imperative ianaro i+anar+o 'prf.i-stem.anar-by.you''(let-sth)-be-learnt-by.you'; ianarana # '(that-which)-be-usually-learnt' or '(that-which-is)-being-learned' # passive 1 indicative ianarana i+anar+ana 'prf.i-stem.anar-suffix.ana''(that-which)-be- # usually-learnt' or '(that-which-is)-being-learned'; nianarana # 'was-learned'; # passive 1 past indicative nianarana n+i+anar+ana 'past.active-prf.i-stem.anar-suffix.ana' # 'was-learned'; hianarana # 'will.be-learned'; # passive 1 future indicative hianarana h+i+anar+ana 'future.active-prf.i-stem.anar-suffix.ana' # 'will.be-learned'; mampianatra # 'to teach'; # complex form mampianatra m+amp+i+anatra 'pres-prf.amp-prf-i-root.anatra''to teach'; ampianaro # '(let-s.one)-be-taught-by.you'; # complex causative passive 1 imperative ampianaro amp+i+anar+o 'prf.amp-prf.i-stem.anar-by.you' # '(let-s.one)-be-taught-by.you'; ampianarina # '(the-ones-who/that-which)-be-usually-taught' or '(the-one/s-who/that-which-is)-being-taught'; # complex causative passive 1 indicative ampianarina amp+i+anar+ina 'prf.amp-prf.i-anar-suffix.ina' # '(the-ones-who/that-which)-be-usually-taught' or '(the-one/s-who/that-which-is)-being-taught'; nampianarina # 'was-usually-taught' or 'was-being-taught'; # complex causative passive 1 past tense indicative nampianarina n+amp+i+anar+ina 'past.active- # prf.amp-prf.i-stem.anar-suffix.ina''was-usually-taught' or 'was-being-taught'; hampianarina # 'will.be-usually-taught'; # complex causative passive 1 future tense indicative hampianarina h+amp+i+anar+ina 'future.active # -prf.amp-prf.i-stem.anar-suffix.ina''will.be-usually-taught'; ampianarana # '(the-instrument/circumstances-under-which-sth)-be-usually-taught' or '(the-instrument/circumstances # under-which-sth)-is-being-taught';complex causative passive 2 indicative ampianarana amp+i+anar+ana # 'prf.amp-prf.i-anar-suffix.ana''(the-instrument/circumstances-under-which-sth)-be-usually-taught' or # '(the-instrument/circumstances-sth)-is-being-taught'; nampianarana # 'was-used-to-teach'; # complex causative passive 2 past tense indicative nampianarana n+amp+i+anar+ana 'past.active- # prf.amp-prf.i-stem.anar-suffix.ana''was-used-to-teach'; hampianarana # 'will.be-used-to-teach'; # complex causative passive 2 future tense indicative hampianarana h+amp+i+anar+ana 'future.active # -prf.amp-prf.i-stem.anar-suffix.ana''will.be-used-to-teach'; fianarana # 'school' # fianarana f+i+anar+ana 'nominaliser.f-prf.i-stem.anar-suffix.ana''school'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix I and the stem form; fianatra # 'the usual action/manner of learning'; # fianatra f+i+anatra 'nominaliser.f-prefix.i-root.anatra''the usual action/manner of learning'; # this form corresponds to what will be labelled 'Stative Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix I and the root form; fampianarana # 'teaching' # fampianarana f+amp+i+anar+ana 'nominaliser.f-prf.amp-prf.i-stem.anar-suffix.ana''teaching'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the secondary prefix amp; mpianatra # 'student'; # mpianatra mp+i+anatra 'pref.mp-prf.i-root.anatra''student'; # this form corresponds to what will be labelled 'AGENT MP nominalizer' in the # on-line document 'Nominals in Malagasy'; note the root form; mpampianatra # 'teacher'; # mpampianatra mp+amp+i+anatra 'pref.mp-causative.pref.amp-pref.i-root.anatra''teacher'; # this form corresponds to what will be labelled 'AGENT MP nominalizer' in the # on-line document 'Nominals in Malagasy'; note the root form; didy # N 'cut'; # Root didy 'cut'; mandidy # 'to cut'; # transitive mandidy m+an+root.didy 'to cut'; mididy # '(to-be-usually)-cut'; # intransitive mididy m+i+root.didy '(to-be-usually)-cut'; didio # (let-sth)-be-cut-by.you'; # passive 1 imperative didio stem.didi+o '(let-sth)-be-cut-by.you'; passive 1 indicative pronunciation # [di.di.na] / didi + ina /, but spelling = didiana! didiana # '(be-usually/habitually)-cut-up' or '(is)-being-cut-up; nodidiana # 'was-cut-up'; # Passive 1 past tense indicative nodidiana 'past.passive-stem.didi-suffix.ana''was-cut-up, deliberately # and punctually'; hodidiana # 'will.be-cut-up'; # passive 1 future tense indicative hodidiana 'future.passive-stem.didi-suffix.ana''will.be-cut-up'; andidio # '(let-a-portion-of-sth)-be-cut-by.you' or '(let-sth/instrument)-be-used-by.you-to-cut'; # passive 2 imperative andidio an+didi+o 'prf.an-stem.didi-by.you''(let-a-portion-of-sth)-be-cut-by.you' # or '(let-sth/instrument)-be-used-by.you-to-cut'; andidiana # (that-from-which-a-portion)-be-cut' or'(the-instrument/manner/circumstance-under-which-sth)-be-cut'; # passive 2 indicative andidiana an+didi+ana 'prf.an-stem.didi-suffix.ana'(that-from-which-a-portion)-be-cut' # or '(the-instrument/manner/circumstance-under-which-sth)-be-cut'; adidy # '(instrument/electric.knife)-be-used-to-cut'; # Alternative a.passive: adidy a+didy 'a.passive-root.didy'(instrument/electric.knife)-be-used-to-cut'; # this form cannot be used to describe the action of cutting with a non-electric knife! voadidy # '(has-been)-cut'; # voadidy voa+didy 'transitive.perfective.voa-root.didy''(has-been)-cut'; fandidiana # 'surgical operation'; # fandidiana f+an+didi+ana 'nominaliser.f-prf.an-stem.didi-suffix.ana''surgical operation'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; mpandidy # 'surgeon'; # mpandidy mp+an+didy 'pref.mp-pref.an-root.didy''surgeon'; # this form corresponds to what will be labelled 'AGENT MP nominalizer' in the # on-line document 'Nominals in Malagasy'; note the root form; dinika # N 'consultation'; # Root dinika 'consultation'; mandinika # 'to examine'; # transitive or intransitive mandinika m+an+root.dinika 'to examine'; midinika # 'to hold talks'; # intransitive midinika m+i+dinika 'pres-prf.i-root.dinika''to hold talks'; diniho # '(let-sth)-be-examined-by.you'; # passive 1 imperative diniho stem.dinih+o '(let-sth)-be-examined-by.you'; dinihina # '(the-one-who/that-which)-be-usually-examined' or '(the-one-who/that-which-is) # -being-examined'; passive 1 indicative dinihina dinih+ina 'stem.dinih-suffix.ina' # '(the-one-who/that-which)-be-usually-examined' or '(the-one-who/that-which-is) # -being-examined'; nodinihina # '(the-one-who/that-which)-was-deliberately & punctually-examined'; # passive 1 indicative nodinihina no+dinih+ina 'pref.no-stem.dinih-suffix.ina' # '(the-one-who/that-which)-was-deliberately & punctuallu-examined'; andiniho # '(let-sth/INSTRUMENT/circumstances)-be-used-by.you-to-examine'; # passive 2 imperative andiniho an+dinih+o 'prf.an-stem.dinih-by.you''(let-sth/INSTRUMENT/ # circumstances)-be-used-by.you-to-examine'; andinihana # '(sth/INSTRUMENT/circumstances)-be-used-to-examine'; # passive 2 indicative andinihana an+dinih+ana 'prf.an-stem.dinih-suffix.ana''(sth/INSTRUMENT/ # circumstances)-be-used-to-examine'; nifampidinika # 'to hold discussions'; # nifampidinika n+if+amp+i+dinika 'past.tense-reciprocal.if-pref.amp-pref.i-root.dinika' # 'to hold discussions'; voadinika # '(has-been)-discussed'; # voadinika voa+dinika 'transitive.perfective.voa-root.dinika''(has-been)-discussed'; fandinihana # 'examination, analysis'; # fandinihana f+an+dinih+ana 'nominaliser.f-prf.an-stem.dinih-suffix.ana''examination'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; fandinika # 'the usual action/manner of examining'; # fandinika f+an+dinika 'nominaliser.f-prefix.an-root.dinika''the usual action/manner of # examining'; # this form corresponds to what will be labelled 'Stative Nominalization' in the # on-line document 'Nominals in Malagasy'; note the root form involved here; mpandinika # 'analyst, observer'; # mpandinika mp+an+dinika 'pref.mp-pref.an-root.dinika''analyst, observer'; # this form corresponds to what will be labelled 'AGENT MP nominalizer' in the # on-line document 'Nominals in Malagasy'; note the root form; dio # Root 'cleanliness'; # Root dio 'cleanliness'; mandio # 'to clean up'; # transitive or intransitive mandio m+an+root.dio 'to clean up'; midio # "to clean oneself up'; # intransitive midio m+i+root.dio "to clean oneself up'; diovy # '(let-(s.one/sth)-be-cleaned-up-by.you'; # passive 1 imperative diovy stem.diov+y 'dio-epenthetic.v-by.you''(let-(s.one/sth)-be # -cleaned-up-by.you'; diovina # '(s.one/sth)-be-usually-cleaned-up' or '(s.one/sth-is)-being-cleaned-up'; # passive 1 indicative diovina stem.diov+ina 'dio-epenthetic.v-suffix.ina''(s.one/ # sth)-be-usually-cleaned-up' or '(s.one/sth-is)-being-cleaned-up'; nodiovina # '(s.one/sth)-was-deliberately & punctually--cleaned-up'; # passive 1 indicative nodiovina no+diov+ina 'passive.past-stem.diov-suffix.ina' # '(s.one/sth)-was-deliberately & punctually-cleaned-up'; andiovy # '(let-sth/INSTRUMENT/circumstances)-be-used-by.you-to-clean-up'; # passive 2 imperative andiovy an+diov+y 'prf.an-stem.diov-by.you''(let-sth/ # INSTRUMENT/circumstances)-be-used-by.you-to-clean-up'; andiovana # (intrument-with/circumstances-in-which-sth)-is-usually-cleaned-up' or '(instrument # -with/circumstances-in-which-sth-is)-being-cleaned-up'; # passive 2 indicative andiovana an+diov+ana 'pref.an-stem.diov-suffix.ana''(intrument-with/ # circumstances-in-which-sth)-is-usually-cleaned-up' or '(instrument-with/circumstances-in- # which-sth-is)-being-cleaned-up'; voadio # '(the-one-who/that-which)-has-been-successfully-cleaned'; # Root dio 'cleanliness'; voadio voa+dio 'transitive.perfective-root.dio''(the-one-who/that- # which)-has-been-successfully-cleaned'; fahadiovana # 'cleanliness' # fahadiovana f+aha+dio+v+ana 'nominaliser.f-prf.aha-stem.diov-suffix.ana'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AHA; fandiovana # 'the action of cleaning up'; # fandiovana f+an+dio+v+ana 'nominalizer.f-pref.an-stem.diov-suffix.ana''the action # of cleaning'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; madio # 'clean'; # madio ma+dio 'pref.ma-root.dio''clean'; doboka # N 'loud noise'; # Root doboka 'loud noise'; mandoboka # 'to make a loud noise'; # transitive mandoboka m+an+root.doboka 'to make a loud noise'; dobohy # '(let-sth)-be-used-to-make-a-loud-noise'; # passive 1 imperative dobohy stem.doboh+y '(let-sth)-be-used-to-make-a-loud-noise'; dobohina # '(that-who/which-be-usually)-made-a-loud-noise-out-of' or '(that-who/which-is-being)- # made-a-loud-noise-out-of'; dobohina 'stem.doboh-suffix.ina'; nodobohina # '(that-who/which-was-deliberately & punctually)-made-a-loud-noise-out-of'; # nodobohina 'passive.past-stem.doboh-suffix.ina'; adobohy # '(let-sth)-be-used-to-make-a-loud-noise'; # passive 1 imperative alternative adobohy adoboh+y '(let-sth)-be-used-to-make-a-loud-noise'; adoboka # '(that-which)-be-usually/habitually-used-to-make-a-loud-noise' or # '(that-which-is)-being-used-to-make-a-loud-noise'; # passive 1 indicative adoboka a+doboka 'a.passive-root.doboka''(that-which)-be-usually/ # habitually-used-to-make-a-loud-noise' or'(that-which-is)-being-used-to-make-a-loud-noise'; andobohana # '(the-instrument-used)-to-make-a-loud-nouse'; # andobohana an+doboh+ana 'pref.an-stem.doboh-suffix.ana'; fandobohana # 'the action of making a loud noise'; # fandobohana f+an+doboh+ana 'nominalizer.f-pref.an-stem.doboh-suffix.ana''the action of making a # loud noise'; note the prefix AN and the stem form; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN; fandrika # N 'trap'; # Root fandrika 'trap'; mamandrika # 'to trap'; # transitive mamandrika m+a(n>m)+root.(f)andrika 'to trap'; fandriho # '(let-s.one/sth)-be-trapped-by.you'; # passive 1 imperative fandriho stem.fandrih+o '(let-s.one/sth)-be-trapped-by.you'; fandrihana # '(the-one-who/that-which)-be-usually-trapped' or '(the-one-who/that-which- # is)-being-trapped'; # passive 1 indicative fandrihana fandrih+ana 'stem.fandrih-suffix.ana''(the-one-who/ # that-which)-be-usually-trapped' or '(the-one-who/that-which- # is)-being-trapped'; nofandrihana # '(the-one-who/that-which)-was-deliberately & punctually-trapped'; # passive 1 indicative nofandrihana no+fandrih+ana 'passive.past.no-stem.fandrih-suffix.ana' # '(the-one-who/that-which)-was-deliberately & punctually-trapped'; amandriho # '(let-sth/INSTRUMENT/circumstances)-be-used-by.you-to-trap'; # passive 2 imperative amandriho a(n>m)+stem.(f)andrih+o '(let-sth/INSTRUMENT/circum- # stances)-be-used-by.you-to-trap'; amandrihana # '(sth/INSTRUMENT/circumstances)-be-used-to-trap'; # passive 2 indicative amandrihana a(n>m)+stem.(f)andrih+ana 'prf.an-stem.fandrih-suffix.ana' # '(sth/INSTRUMENT/circumstances)-be-used-to-trap'; voafandrika # '(who/which)-has-been-successfully-trapped'; # Root fandrika 'trap'; voafandrika voa+root.fandrika 'transitive.perfective-fandrika' # '(who/which)-has-been-successfully-trapped'; famandrihana # subscription'; # famandrihana f+a(n>m)+(f)andrih+ana 'nominaliser.f-prf.an-stem.fandrih-suffix.ana' #'the trapping'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; mpamandrika # 'subscriber'; # mpamandrika mp+a(n>m)+(f)andrika 'pref.mp-pref.an-root.fandrika''subscriber'; # this form corresponds to what will be labelled 'AGENT MP nominalizer' in the # on-line document 'Nominals in Malagasy'; note the root form; fantsika # N 'nail'; # Root fantsika 'nail'; mamantsika # 'to nail'; # transitive mamantsika m+a(n>m)+(f)antsika 'pres-pref.an-root.fantsika''to nail'; fantsiho # '(let-sth)-be-nailed-by.you'; # passive 1 imperative fantsiho fantsih+o 'stem.fantsih-by.you''(let-sth)-be-nailed-by.you'; fantsihana # '(that-which)-be-usually-nailed' or '(that-which-is)-being-nailed'; # passive 1 indicative fantsihana fantsih+ana 'stem.fantsih-suffix.ana''(that-which)-be-usually-nailed' # or '(that-which-is)-being-nailed'; nofantsihana # '(that-which)-was-deliberately & punctually-nailed'; # passive 1 indicative fantsihana nofantsih+ana 'passive.past-stem.fantsih-suffix.ana' # '(that-which)-was-deliberately & punctually-nailed'; amantsiho # '(let-sth/INSTRUMENT/circumstances)-be-used-by.you-to-nail'; # passive 2 immperative amantsiho an+(f)antsih+o 'prf.an-stem.fantsih-by.you''(let-sth/ # INSTRUMENT/circumstances)-be-used-by.you-to-nail'; voafantsika # '(which-has-been)-successfully-nailed'; # Root fantsika 'nail'; voafantsika voa+root.fantsika 'transitive.perfective-fantsika''(which-has- # been)-successfully-nailed'; famatsihana # 'the (usual) action of nailing'; # famantsihana f+a(n>m)+(f)antsih+ana 'prf.f-prf.an-stem.fatsih-suffix.ana''the action of nailing'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; faritra # N 'limit'; # Root faritra 'limit'; mamaritra # 'to limit'; # transitive mamaritra m+a(n>m)+(f)aritra 'pres-prefix.an-root.faritra''to limit'; mifaritra # 'to-be-well-delimited'; # intransitive mifaritra m+i+faritra 'to-be-well-delimited'; farito # '(let-sth)-be-delimited-by.you'; # passive 1 imperative farito stem.farit+o '(let-sth)-be-delimited-by.you'; faritana # '(sth)-be-usually-delimited' or '(sth-is)-being-delimited'; # passive 1 indicative faritana farit+ana 'stem.farit-suffix.ana''(sth)-be-usually-delimited' # or '(sth-is)-being-delimited'; nofaritana # '(sth)-was-deliberately & punctually-delimited'; # passive 1 indicative nofaritana no+farit+ana 'passive.past-stem.farit-suffix.ana' # '(sth)-was-deliberately & punctually-delimited'; amarito # '(let-sth/INSTRUMENT/circumstances)-be-used-by.you-to-delimit'; # passive 2 imperative amarito a(n>m)+(f)arit+o 'prf.an-stem.farit-by.you' # '(let-sth/INSTRUMENT/circumstances)-be-used-by.you-to-delimit'; voafaritra # '(sth)-has-been-successfully-delimited'; # Root faritra 'limit'; voafaritra voa+faritra 'transitive.perfective-root.faritra''(sth)-has-been- # successfully-delimited'; famaritana # 'delimitation'; # famaritana f+a(n>m)+(f)arit+ana 'prf.f-prf.an-stem.farit-suffix.ana''delimitation'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; mpamaritra # 'delimiter'; # mpamaritra mp+a(n>m)+(f)aritra 'pref.mp-pref.an-root.faritra''delimiter'; # this form corresponds to what will be labelled 'AGENT MP nominalizer' in the # on-line document 'Nominals in Malagasy'; note the root form; faty # N 'corpse'; ## Root faty 'corpse'; mahafaty # 'dangerous'; # mahafaty m+aha+faty 'pres-causative.prf.aha-root.faty''dangerous'; fahafatesana # 'death'; # fahafatesana f+aha+fati+s+ana 'nominalizer.f-prf.aha-stem.fates-suffix.ana''death', # where syllabification yields fa.ha.fa.ti.sa.na > fa.ha.fa.tis.a.na > fa.ha.fa.tes.a.na > # fa.ha.fa.te.sa.na with vowel lowering with a closed syllable like tis; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the default prefix AHA; ahafatesana # '(the circumstances-under-which-s.one)-dies'; # ahafatesana aha+fati+s+ana 'prefix.aha-stem.fates-suffix.ana''(the circumstances- # under-which-s.one)-dies'; nahafatesana # '(the circumstances-under-which-s.one)-died'; # nahafatesana aha+fati+s+ana 'past.tense-prefix.aha-stem.fates-suffix.ana''(the circumstances- # under-which-s.one)-died'; gaina # Root 'disappointed'; # Root gaina 'disappointed'; mangaina # 'to be disappointed'; # intransitive mangaina m+an+gaina 'to be disappointed'; no passive 1 imperative; # no passive 2 imperative. halatra # N 'theft'; # Root halatra 'theft'; mangalatra # 'to steal'; # transitive or intransitive mangalatra m+an+root.(h>g)alatra 'to steal'; angalaro # '(let-sth)-be-stolen-by.you'; # passive 1 imperative angalaro an+(h>g)alar+o 'prf.an-stem.halar-by.you''(let-sth)-be-stolen-by.you'; angalarina # '(the-one-who/that-which)-be-usually-stolen' or '(the-one-who/that-which-is)-being-stolen'; # passive 1 indicative angalarina an+(h>g)alar+ina 'prf.an-stem.galar-suffix.ina''(the-one-who/that- # which)-be-usually-stolen' or '(the-one-who/that-which-is)-being-stolen'; nangalarina # 'was stolen'; # passive 1 past tense indicative nangalarina n+an+(h>g)alar+ina 'past.tense.active-prf.an-stem.galar # -suffix.ina'; hangalarina # 'wille-be-stolen'; # passive 1 future # tense indicative hangalarina h+an+(h>g)alar+ina 'future.tense.active-prf.an-stem.galar-suffix.ina'; angalarana # '(a-portion-of-sth)-be-stolen' or 'the-manner/circumstances-in-which-sth)-be-stolen'; # passive 2 indicative angalarana an+(h>g)alar+ana 'prf.an-stem.galar-suffix.ana''(a-portion-of-sth)- # be-stolen' or 'the-manner/circumstances-in-which-sth)-be-stolen'; nangalarana # 'was-used-to-steal'; # passive 2 past indicative nangalarana n+an+(h>g)alar+ana 'past.tense.active-prf.an.DURATIVE-halar # -suffix.ana''(a-portion-of-sth)-was-stolen' or 'the-manner/circumstances-in-which-sth)-was-stolen'; hangalarana # 'will-be-used-tosteal['; # passive 2 future indicative hangalarana h+an+(h>g)alar+ana 'future.tense.active-prf.an.DURATIVE- # galar-suffix.ana''(a-portion-of-sth)- will.be-stolen' or 'the-manner/circumstances-in-which-sth) # -will.be-stolen'; fangalarana # 'the (usual) action of stealing'; # fangalarana f+an+(h>g)alar+ana 'prf.f-prf.an-stem.halar-suffix.ana''the (usual) action of stealing'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; mpangalatra # 'thief'; # mpangalatra mp+an+(h>g)alatra 'pref.mp-pref.an-root.halatra''thief'; # this form corresponds to what will be labelled 'AGENT MP nominalizer' in the # on-line document 'Nominals in Malagasy'; note the root form; harona # Root 'searching'; # Root harona 'searching'; mangarona # 'to search with an instrument'; # transitive mangarona m+an+(h>g)arona 'to search with an instrument'; harony # '(let-sth)-be-searched-by.you'; # passive 1 imperative harony stem.haron+y 'haron-by.you''(let-sth)-be-searched-by.you'; haronina # '(that-which)-be-usually-searched' or 'that-which-is)-being-searched'; # passive 1 indicative haronina haron+ina 'stem.haron-suffix.ina''(that-which)-be-usually- # searched' or 'that-which-is)-being-searched'; angarony # '(let-sth)-be-used-by.you-to-search'; # passive 2 imperative angarony an+(h>g)aron+y > an+stem.garon+y 'prefix.an- # garon-by.you''(let-sth)-be-used-by.you-to-search'; angaronana # '(that-which)-be-usually-used-to-search' or '(that-which-is)-being-used-to-search'; # passive 2 indicative angaronana an+(h>g)aron+ana > an+garon+ana 'prf.an-stem.garon-suffix.ana' # '(that-which)-be-usually-used-to-search' or '(that-which-is)-being-used-to-search'; voaharona # '(which)-bas-been-successfully-searched'; # Root harona 'searching'; voaharona voa+root.harona 'transitive.perfective-harona''(which)- # bas-been-successfully-searched'; fangaronana # 'the (usual) action of searching, probing'; # fangaronana f+an+(h>g)aron+ana 'prf.f-prf.an-stem.haron-suffix.ana''the action of searching, probing'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; mpangarona # 'the individual who does the probing'(with a negative connotation); # mpangarona mp+an+(h>g)arona .pref.mp-pref.an-root.harona''the individual who does the probing'; # this form corresponds to what will be labelled 'AGENT MP nominalizer' in the # on-line document 'Nominals in Malagasy'; note the root form; hataka # Root 'request' # Root hataka 'request'; mangataka # 'to request'; # transitive mangataka m+an+root.(h>g)ataka 'to request'; angataho # '(let-sth)-be-requested-by.you'; # passive 1 imperative angataho an+(h>g)atah+o 'prf.an-stem.gatah-by.you''(let-sth) # -be-requested-by.you'; angatahina # '(that-which)-be-usually-requested' or'(that-which-is)-being-requested'; # passive 1 indicative angatahina an+(h>g)atah+ina 'prf.an-stem.gatah-suffix.ina' # '(that-which)-be-usually-requested' or '(that-which-is)-being-requested'; angataho # '(let-sth)-be-requested-by.you'; # passive 2 imperative angataho an+(h>g)atah+o 'prf.an-stem.gatah-o''(let-sth)-be # -requested-by.you'; angatahana # '(the-manner/circumstances-in-which-sth)-be-usually-requested' or (the- # manner/circumstances-in-which-sth-is)-being-requested'; # passive 2 indicative angatahana an+(h>g)atah+ana 'prf.ana-stem.gatah-suffix.ana' # '(the-manner/circumstances # -in-which-sth)-be-usually-requested' or (the-manner/circumstances-in-which # -sth-is)-being-requested'; fangatahana # 'request'; # fangatahana f+an+(h>g)atah+ana 'nominaliser.f-prf.an-stem.gatah-suffix.ana''request'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; mpangataka # 'beggar'; # mpangataka mp+an+(h>g)ataka 'pref.mp-pref.an-stem.gataka''beggar'; # this form corresponds to what will be labelled 'AGENT MP nominalizer' in the # on-line document 'Nominals in Malagasy'; note the root form; hemotra # Root 'retreat'; # Root hemotra 'retreat'; manemotra # 'to put off'; # transitive manemotra m+an+root.(h)emotra 'to put off'; hemory # '(let-sth)-be-put-off-by.you'; # passive 1 imperative hemory hemor+y 'stem.hemor-by.you''(let-sth)-be-put-off-by.you'; hemorina # '(date-sth)-be-usually-put-off' or '(date-sth-is)-being-put-off'; # passive 1 indicative hemorina hemor+ina 'stem.hemor-suffix.ina''(date)-be-usually-put-off' # '(date-sth-is)-being-put-off'; or ahemory # '(let-sth)-be-put-off'; # alternative passive 1 imperative ahemory a+hemor+y 'a.passive-stem.hemor-by.you' # 'take-initial-step-to-put-off'; ahemotra # '(date-sth)-be-usually-put-off' or '(date-sth-is)-being-put-off'; # alternative passive 1 indicative ahemotra a+hemotra'a.passive-root.hemotra''(date)-be- # usually-put-off' or '(date-sth-is)-being-put-off'; anemory # '(let-sth)-be-used-to-put-off'; # passive 2 imperative anemory an+(h)emor+y 'prf.an-stem.hemor-by.you' '(let-sth)-be-used-to-put-off'; anemorana # '(sth)-be-usually-used-to-put-off' or '(sth-is)-being-used-to-put-off'; # passive 2 indicative anemorana an+(h)emor+ana 'prf.an-stem.hemor-suffix.ana'(sth)-be- # usually-used-to-put-off' or '(sth-is)-being-used-to-put-off'. mihemotra # 'to retreat'; # Root hemotra 'retreat'; intransitive mihemotra m+i+hemotra 'pres-prf.i-root.hemotra' # 'to retreat'; fihemorana # 'the action of stepping backwards'; # fihemorana f+i+hemor+ana 'nominaliser.f-prf.i-stem.hemor-suffix.ana''the action of # stepping backwards'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix I and the stem form; fanemorana # 'the action of putting something off'; # fanemorana f+an+(h)emor+ana 'nominaliser.f-prf.an-stem.hemor-suffix.ana''the action # of putting off'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; henjana # Adj 'stretched' # Root henjana 'stretched'; manenjana # 'to stretch'; # transitive manenjana m+an+root.(h)enjana 'to stretch'; henjano # '(let-sth)-be-stretched-by.you'; # passive 1 imperative henjano henjan+o 'stem.henjan-by.you''(let-sth)-be-stretched-by.you'; henjanina # '(that-which)-be-usually-stretched' or '(that-which-is)-being-stretched'; # passive 1 indicative henjanina henjan+ina 'stem.henjan-suffix.ina''(that-which)-be-usually # -stretched' or '(that-which-is)-being-stretched'; nohenjanina # 'was-stretched'; # alternative passive 1 indicative nohenjanina no+henjan+ina # 'past.passive.nonDURATIVE-stem.henjan-suffix.ina''was-stretched'; ahenjano # '(let-sth)-be-stretched-by-you-at-least-the-initial-step'; # alternative passive 1 imperative ahenjano a+henjan+o 'a.passive-stem.henjan-by.you' # '(let-sth)-be-stretched-by-you-at-least-the-initial-step'; ahenjana # '(that-which)-be-usually-stretched-at-least-the-initial-step' # or '(that-which-is)-being-stretched-at-least-the-initial-step'; # alternative passive 1 indicative ahenjana a+henjana #'a.passive-root.henjana''(that-which)-be-usually-stretched-at-least-the-initial-step' # or '(that-which-is)-being-stretched-at-least-the-initial-step'; anenjano # '(let-sth/instrument)-be-used-by.you-to-stretch'; # passive 2 imperative anenjano an+(h)enjan+o 'prf.an-stem.(h)enjan-by.you' # '(let-sth/instrument)-be-used-by.you-to-stretch'; anenjanana # '(that-which/instrument)-be-usually-used-to-stretch'; # passive 2 indicative anenjanana an+(h)enjan+ana 'prf.an-stem.(h)enjan-suffix.ana' # '(that-which/instrument)-be-usually-used-to-stretch'; nanenjanana # '(that-which/instrument)-was-used-to-stretch'; # alternative passive 2 indicative past tense nanenjanana n+an+stem.(h)enjan+ana # 'past.active.voice-prf.an-stem.(h)enjan-suffix.ana' # '(that-which/instrument)-was-used-to-stretch'; mihenjana # 'to stretch'; # Root henjana 'stretched'; intransitive mihenjana m+i+henjana 'pres-prf.i-root.henjana' # 'to stretch'; voahenjana # '(which-has-been)-successfully-stretched'; # voahenjana voa+henjana 'transitive.perfective-root.henjana''(which-has-been)- # successfully-stretched'; fihenjanana # 'the action of getting harsher, harder'; # fihenjanana f+i+henjan+ana 'nominaliser.f-prf.i-stem.henjan-suffix.ana' # 'the action of getting harsher'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix I and the stem form; fanenjanana # 'the action of stretching'; # fanenjanana f+an+(h)enjan+ana 'nominaliser.f-prf.an-stem.henjan-suffix.ana''to stretch'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; hetsika # N 'action'; # Root hetsika 'action'; manetsika # 'to move (sth)'; # transitive manetsika m+an+root.(h)etsika 'to move (sth)'; hetseho # '(let-sth)-be-moved-by.you'; # passive 1 imperative hetseho hets(i>e)(k>h)+o 'stem.hetseh-by.you''(let-sth)-be-moved-by.you'; hetsehina # '(sth)-be-usually-moved' or '(sth-is)-being-moved'; # passive 1 indicative hetsehina hetseh+ina 'stem.hetseh+suffix.ina''(sth)-be-usually-moved' or # '(sth-is)-being-moved'; nohetsehina # 'was-deliberately & punctually (but thoroughly)-moved'; # past tense passive indicative nohetsehina no+hetseh+ina 'past.passive-stem.hetseh-suffix.ina' # 'was-deliberately-moved & was thoroughly affected'; hohetsehina # 'will.be-deliberately-moved'; # future tense passive indicative hohetsehina ho+hetseh+ina 'future.passive-stem.hetseh # -suffix.ina''will.be-deliberately-moved'; anetseho # '(let-sth/INSTRUMENT)-be-used-by.you-to-move'; # passive 2 imperative anetseho an+(h)etseh+o 'prf.an-stem.(h)etseh-by.you''(let-sth)-be-used # -by.you-to-move'; anetsehana # '(the-instrument)-be-used-to-move'; # passive 2 indicative anetsehana an+(h)etseh+ana 'prf.an-stem.(h)etseh-suffix.ana''(the-instrument) # -be-used-to-move'; nanetsehana # '(the-instrument)-was-used-to-move'; # past tense indicative nanetsehana n+an+(h)etseh+ana 'past.active-prf.an-stem.(h)etseh-suffix.ana' # '(the-instrument)-was-used-to-move'; hanetsehana # '(the-instrument)-will.be-used-to-move'; # future tense indicative hanetsehana h+an+(h)etseh+ana 'future.active-prf.an-stem.(h)etseh-suffix.ana' # '(the-instrument)-will.be-used-to-move'; mihetsika # 'to move'; # Root hetsika 'action'; intrans mihetsika m+i+root.hetsika 'to move'; ahetsika # '(that-which-is)-usually/habitually-moved-at-least-the-initial-step'; # passive 1 indicative ahetsika a+hetsika 'prf.a.passive-root.hetsika''(that-which-is)-usually/ # habitually-moved'; nahetsika # 'was-moved'; # past tense indicative nahetsika n+a+hetsika 'past.active-prf.a-root.hetsika''was-moved'; hahetsika # 'will.be-moved'; # future tense indicative hahetsika h+a+hetsika 'future.active-prf.a-root.hetsika''will.be-moved'; ihetseho # (let-sth)-be.used-by.you-to-move'; # passive 2 imperative ihetseho i+hetseh+o 'prf.i-stem.hetseh-by.you'(let-sth)-be.used- by.you-to-move'; ihetsehana # '(the-circumstances-under-which-sth)-be-used-to-move'; # passive 2 indicative ihetsehana i+hetseh+ana 'prf.i-stem.hetseh-suffix.ana''(the-circumstances- # under-which-sth)-be-used-to-move'; nihetsehana # '(the-circumstances-under-which-sth)-was-used-to-move'; # past tense indicative nihetsehana n+i+hetseh+ana 'past.active-prf.i-stem.hetseh-suffix.ana' # '(the-circumstances-under-which-sth)-was-used-to-move'; hihetsehana # '(the-circumstances-under-which-sth)-will.be-used-to-move'; # future tense indicative hihetsehana h+i+hetseh+ana # 'future.active-prf.i-stem.hetseh-suffix.ana''(the-circumstances-under-which-sth)-will.be-used-to-move'; mahahetsika # '(be)-capable-of-moving'; # Root hetsika 'action'; mahahetsika m+aha+root.hetsika 'pres-prf.aha-hetsika''(be)-capable-of-moving'; voahetsika # 'was-managed-to-be-moved' or 'was-inadvertently/accidentally-moved'; # voahetsika voa+hetsika 'transitive.perfective-root.hetsika''was-managed-to-be-moved' or # 'was-inadvertently/accidentally-moved'; tafahetsika # 'was-able-to-move-on-its-own'; # tafahetsika tafa+hetsika 'intransitive.perfective-root.hetsika'''was-able-to-move-on-its-own'; fihetsika # '(habitual) action'; # fihetsika f+i+hetsika 'prf.f-prf.i-root.hetsika''(habitual) action'; # this form corresponds to what will be labelled 'Stative Nominalization' in the # on-line document 'Nominals in Malagasy'; note the root form and the prefix I; fanetsehana # 'the action of stirring up, of moving'; # fanetsehana f+an+(he)tseh+ana 'prf.f-prf.an-stem.hetseh-suffix.ana''the action of stirring up'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; hety # N 'scissors'; # Root hety 'scissors'; manety # 'to cut with scissors'; # transitive manety m+an+root.(h)ety 'to cut with scissors'; hetezo # '(let.s.one/sth)-be-given-a-haircut-by.you'; # passive 1 imperative hetezo het(i>e)+z+o 'stem.hetez-by.you''(let.s.one/sth)-be-given # -a-haircut-by.you'; hetezana # '(s.one/sth)-be-usually-given-a-haircut' or '(s.one/sth-is)-being-given-a-haircut'; # passive 1 indicative hetezana het(i>e)+z+ana 'stem.hetez-suffix.ana''(s.one/sth)- # be-usually-given-a-haircut' or '(s.one/sth-is)-being-given-a-haircut'; nohetezana # '(s.one/sth)-was-given-a-haircut'; # alternative passive 1 indicative nohetezana no+het(i>e)+z+ana 'past.passive-stem.hetez # -suffix.ana'(s.one/sth)-was-given-a-haircut'; anetezo # '(let-a-portion-of-sth)-be-cut-with scissors'; # passive 2 imperative anetezo an+(h)et(i>e)+z+o 'prf.an-stem.hetez-by.you' # '(let-a-portion-of-sth)-be-cut-with scissors'; anetezana # '(that-which)-be-usually-partly-cut-with-scissors' or '(that-which-is)-being- # cut-with-scissors'; passive 2 indicative anetezana an+(h)et(i>e)+z+ana 'prf.an-stem.hetez # -suffix.ana''(that-which)-be-usually-partly-cut-with-scissors' or # '(that-which-is)-being-cut-with-scissors'; mihety # 'to (usually) have a haircut'; # Root hety 'scissors'; intrans mihety m+i+hety 'pres-prf.i-root.hety''to (usually) have a haircut'; voahety # '(sth)-has-been-successfully-cut-with-scissors'; # voahety voa+hety 'transitive.perfective-root.hety''(sth)-has-been-successfully-cut-with- # scissors'; fihetezana # 'the manner or usual place of getting a haircut'; # fihetezana f+i+hetez+ana 'prf.f-prf.i-stem.hetez-suffix.ana' # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix I and the stem form; fanetezana # 'the action of giving a haircut'; # fanetezana f+an+(h)etez+ana 'prf.f-prf.an-stem.hetez-suffix.ana''the action of giving a haircut'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; mpanety # 'hair-cutter'; # mpanety mp+an+(h)ety 'pref.mp-pref.an-root.hety''hair-cutter'; # this form corresponds to what will be labelled 'AGENT MP nominalizer' in the # on-line document 'Nominals in Malagasy'; note the root form; hidy # N 'lock'; # Rood hidy 'lock'; manidy # 'to lock up'; # transitive manidy m+an+root.(h)idy 'to lock up'; hidio # '(let-sth)-be-locked-by.you'; # passive 1 imperative hidio stem.hidi+o 'hidi-by.you''(let-sth)-be-locked-by.you'; hidiana # '(that-which)-be-usually-locked-up' or '(that-which-is)-being-locked-up'; # passive 1 indicative hidiana = pronounce as hi.di.na 'hidi+ina''stem.hidi-suffix.ina' # '(that-which)-be-usually-locked-up' or '(that-which-is)-being-locked-up'; anidio # '(let-instrument)-be-used-by.you-to-lock-up'; # passive 2 imperative anidio an+(h)idi+o 'prf.an-stem.hidi-by.you''(let-instrument)-be # -used-by.you-to-lock-up'; anidiana # '(the-instrument/circumstances-under-which)-be-locked-up'; # passive 2 indicative anidiana an+(h)idi+ana 'prf.an-stem.hidi-suffix.ana''(the-instrument/ # circumstances-under-which)-be-locked-up'; fanidiana # 'the action of locking up'; # fanidiana f+an+(h)di+ana 'nominaliser.f-prf.an-stem.hidi-suffix.ana''the action of locking up'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; mpanidy # 'someone who (usually) closes (doors and windows)'; # mpanidy mp+an+(h)idy 'pref.mp-pref.an-root.hidy''someone who (usually) closes doors and windows'; # this form corresponds to what will be labelled 'AGENT MP nominalizer' in the # on-line document 'Nominals in Malagasy'; note the root form; hintsana # Root 'shaking'; # Root hintsana 'shaking'; manintsana # 'to shake off'; # transitive manintsana m+an+root.(h)intsana 'to shake off'; mihintsana # intransitive mihintsana m+i+root.hintsana 'to fall off'; ahintsano # '(let-sth)-be-shaken-off-by.you'; # passive 1 imperative ahintsano a+hintsan+o 'a.passive-stem.hintsan-by.you'(let-sth)-be-shaken-off-by.you'; ahintsana # '(that-which) be-usually-shaken-off' or '(that-which-is)-being-shaken-off'; # passive 1 indicative ahintsana a+root.hintsana > ahintsana '(that-which) be-usually-shaken-off' or # '(that-which-is)-being-shaken-off'; anintsano # '(let-a-portion-of-sth)-be-shaken-off' or '(let-sth/instrument)-be-used-by.you-to-shake-off'; # passive 2 imperative anintsano an+stem.(h)intsan+o '(let-a-portion-of-sth)-be-shaken-off' or # '(let-sth/instrument)-be-used-by.you-to-shake-off'; anintsanana # '(sth/instrument)-be-used-to-shake-off' or '(let-a-portion-of-sth)-be-shaken-off'; # passive 2 indicative anintsanana an+(h)intsan+ana 'prf.an-stem.hintsan-suffix.ana''(sth/ # instrument)-be-used-to-shake-off' or '(let-a-portion-of-sth)-be-shaken-off'; fanintsanana # 'the action of shaking up'; # fanintsanana f+an+(h)intsan+ana 'prf.f-prf.an-stem.hintsan+suffix.ana''the action of shaking up'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; hitsaka # Root 'treading upon'; # Root hitsaka 'treading upon'; manitsaka # 'to tread upon'; # transitive manitsaka m+an+root.(h)itsaka 'pres-pref.an-root.hitsaka''to tread upon'; hitsaho # '(let-s.one/sth)-be-tread-upon-by.you'; # passive 1 imperative hitsaho stem.hitsah+o 'hitsa(k>h)-by.you''(let-s.one/sth)-be-tread-upon-by.you'; hitsahina # '(the-one-who/that-which)-be-usually-trodden-upon' or'(the-one-who/that-which-is)-being # -trodden-upon'; passive 1 indicative hitsahina hitsah+ina 'stem.hitsah+suffix.ina''(the-one-who/ # that-which)-be-usually-trodden-upon' or '(the-one-who/that-which-is)-being-trodden-upon'; nitsahana # '(the-one-who/that-which)-was-trodden-upon'; # passive 1 past tense indicative nitsahana no+(h)itsah+ana 'past.passive-stem.(h)itsah-suffix.ana' # '(the-one-who/that-which)-was-trodden-upon'; hitsahana # '(the-one-who/that-which)-will.be-trodden-upon'; # passive 1 future tense indicative hitsahana ho+(h)itsah+ana 'future.passive-stem.(h)itsah-suffix.ana' #'(the-one-who/that-which)-will.be-trodden-upon'; anitsaho # '(let-sth)-be-used-by.you-to-tread-upon'; # passive 2 imperative anitsaho an+(h)itsah+o prf.an-stem.(h)itsah-by.you''(let-sth)-be-used-by.you- # to-tread-upon'; anitsahana # '(that-which)-be-used-to-tread-upon'; # passive 2 indicative anitsahana an+(h)itsah+ana 'prf.an-stem.(h)itsah-suffix.ana''(that-which)-be # -used-to-tread-upon'; ahitsaka # '(be)-hidden'[innovation]; # alternative passive 1 indicative ahitsaka a+hitsaka 'a.passive-root.hitsaka''(be)-hidden'[innovation]; voahitsaka # '(who/which)-has-been-successfully/accidentally-trodden-upon'. # Root hitsaka 'treading upon'; voahitsaka voa+hitsaka 'trans.perfective-root.hitsaka''(who/which)- # has-been-successfully/accidentally-trodden-upon'; fanitsahana # 'the action of treading'; # fanitsahana f+an+(h)itsah+ana 'prf.f-prf.an-stem.hitsah-suffix.ana''action of treading'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; mpanitsaka # 'someone who (usually) treads upon'; # mpanitsaka mp+an+(h)itsaka 'pref.mp-pref.an-root.hitsaka''someone who (usually) treads upon'; # this form corresponds to what will be labelled 'AGENT MP nominalizer' in the # on-line document 'Nominals in Malagasy'; note the root form; hoatra # Root 'that-which-surpasses'; manoatra # 'to surpass, to exceed'; # Root hoatra 'that-which-surpasses'; transitive manoatra m+an+(h)oatra 'to surpass, to exceed'; mihoatra # 'to exceed'; # intransitive mihoatra m+i+hoatra 'pres-prf.i-root.hoatra''to exceed'; ihoaro ihoary # '(let-s.one/sth)-be-surpassed-by.you'; # passive 1 imperative ihoaro i+hoa(tr>r)+o or ihoary i+hoa(tr>r)+y 'prf.i-stem.hoar-by.you''(let-s.one/sth) # -be-surpassed-by.you'; ihoarana # '(s.one/sth)-be-surpassed'; # passive 1 indicative ihoarana i+hoa(tr>r)+ana 'prefix.i-stem.hoar-suffix.ana' '(sth)-be-made-to surpass'; fihoarana # 'the action of surpassing'; # fihoarana f+i+hoar+ana 'nominaliser.f-prefix.i-stem.hoar-suffix.ana''the action of surpassing'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix I and the stem form; hodina # Root 'turn around'; # Root hodina 'turn around'; manodina # 'to turn sth around'; # transitive manodina m+an+root.(h)odina 'to turn sth around'; mihodina # intransitive mihodina m+i+hodina 'pres-pref.i-root.hodina''to turn round'; ahodino # '(let-sth)-be-turned-around-by.you'; # passive 1 imperative ahodino a+hodin+o 'a.passive-stem.hodin-by.you''(let-sth) # -be-turned-around-by.you'; ahodina # '(that-which)-be-usually-turned-around' or '(that-which-is)-being-turned-around'; # passive 1 indicative ahodina a+hodina 'prf.a-root.hodina''(that-which)-be-usually-turned # -around' or'(that-which-is)-being-turned-around'; anodino # '(let-sth/instrument)-be-used-by.you-to-turn-around'; # passive 2 imperative anodino an+(h)odin+o 'prf.an-stem.hodin-by.you''(let-sth/instrument) # -be-used-by.you-to-turn-around'; anodinana # '(sth/instrument)-be-used-to-turn-sth-around'; # passive 2 indicative anodinana an+(h)odin+ana 'prf.ana-stem.hodin-suffix.ana''(sth/ # instrument)-be-used-to-turn-around'; voahodina # '(which)-has-been-successfully-turned-around'; # Root hodina 'turn around'; voahodina voa+hodina 'transitive.perfective-root.hodina''(which)- # has-been-successfully-turned-around'; tafahodina # '(who/which)-has-successfully/inadvertently-turned-around-on-its-own'; # tafahodina tafa+hodina 'intransitive.perfective-root.hodina''(who/which)-has-successfully # -turned-around-on-its-own'; fanodinana # 'the (habitual) action of turning sth around'; # fanodinana f+an+(h)odin+ana 'nominaliser.f-prefix.an-stem.hodin-suffix.ana''the action of # turning sth around'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; hodidina # Root 'tour, contour, surrounding'; # Root hodidina 'tour, contour, surrounding'; manodidina # 'to surround'; # transitive manodidina m+an+(h)odidina 'pres-pref.an-root.hodidina''to surround'; mihodidina # 'to be surrounded'; # intransitive mihodidina m+i+hodidina 'pres-pref.i-root.hodidina'to be surrounded'; hodidino # '(let-sone/sth)-be surrounded-by.you'; # passive 1 imperative hodidino stem.hodidin+o '(let-s.one/sth)-be surrounded-by.you'; hodidinina # '(who/which-is)-surrounded'; # hodidinina hodidin+ina 'stem.hodidin+suffix.ina''(who/which-is)-surrounded'; ahodidina # '(that-which-is)-used-to-surround'; # alternative passive 1 ahodidina a.passive+root.hodidina '(that-which-is)-used-to-surround'; voadidina # '(has-been-successfully)-surrounded'; # voadidina voa+(h)odidina 'transitive.perfective-root.hodidina''(has-been-successfully)-surrounded'; # voa+(h)odidina > vo.o.di.di.na > vo.di.di.na where voa = /vo/ after h-drop and simplification of # vo+o to vo.; fihodidinana # 'the action of going around'; # fihodidina f+i+hodidin+na 'nominaliser.f-prefix.i-stem.hodidin-suff.ana''the action of going around'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix I and the stem form; hofa # N 'rent'; # Root hofa 'rent'; manofa # 'to rent sth'; # transitive manofa m+an+(h)ofa 'pres-pref.an-root.hofa''to rent sth'; mampanofa # 'to rent sth out'; # mampanofa m+amp+an+(h)ofa 'pres-causative.prefix.amp-prefix.an-root.hofa''to rent sth out'; mihofa # '(to-be-usually)-rented'; # intransitive mihofa m+i+hofa 'pres-pref.i-root.hofa''(to-be-usually)-rented'; hofay hofao # '(let-sth)-be-rented-by.you'; # passive 1 imperative hofay hofa+y or hofao stem.hofa+o '(let-sth)-be-rented-by.you'; hofaina hofana # '(that-which-is)-usually-rented' or '(that-which-is)-being-rented'; # passive 1 indicative hofaina hofa+ina 'stem.hofa-suffix.ina' or hofana hofa+ana 'stem.hofa+suffix.ana' # (that-which-is)-usually-rented' or '(that-which-is)-being-rented'; nohofaina nohofana # '(that-which)-was-deliberately & punctually-rented'; # passive 1 indicative nohofaina no+hofa+ina 'passive.past-stem.hofa-suffix.ina' or nohofana # no+hofa+ana 'passive.past-hofa+suffix.ana''(that-which)-was-rented'; ahofao # (let-sth)-be-rented.out-by.you'; # alternative passive 1 imperative ahofao a+hofa+o 'a.passive-stem.hofa-by.you''(let-sth)-be-rented.out-by.you'; ahofa # '(that-which-is)-usually-rented.out' or '(that-which-is-being-rented.out'; # alternative passive 1 indicative ahofa a+hofa 'a.passive-root.hofa''(that-which-is)-usually-rented.out' # or '(that-which-is-being-rented.out'; anofao anofay # '(let-sth/INSTRUMENT/CIRCUMSTANCES)-be-used.by.you-to-rent'; # passive 2 imperative anofao an+(h)ofa+o 'prf.an-stem.hofa-by.you' or anofay an+(h)ofa+y 'prf.an-stem.hofa-by.you' # '(let-sth/INSTRUMENT/CIRCUMSTANCES)-be-used.by.you-to-rent'; anofana # '(the-circumstances)-usually.used-to-rent'; # passive 2 indicative anofao an+(h)ofa+ana 'prf.an-stem.hofa-suffix.ana' # an+(h)ofa+ana 'prf.an-stem.hofa-suffix.ana''(let-sth/the-circumstances)-usually.used-to-rent'; voahofa # '(has-been)-successfully-rented'; # voahofa voa+hofa 'transitive.perfective-root.hofa''(has-been)-successfully-rented'; fanofana # 'the (usual) action of renting sth'; # fanofana f+an+(h)ofa+ana 'nominalizer.f-pref.an-stem.hofa-suffix.ana' 'the (usual) action of renting sth'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; mpanofa # 'renter'; # mpanofa mp+an+(h)ofa 'prefix.mp-pref.an-root.hofa''renter'; # this form corresponds to what will be labelled 'AGENT MP nominalizer' in the # on-line document 'Nominals in Malagasy'; note the root form; mpampanofa # 'one who (usually) rents sth out'; # mpampanofa mp+an+(h)ofa 'prefix.mp-prefix.an-root.hofa''one who (usually) rents sth out'; hosotra # N 'anointment'; # Root hosotra 'anointment'; manosotra # 'to anoint'; # transitive manosotra m+an+root.(h)osotra 'to anoint'; mihosotra # '(to-be)-anointed/covered-with'; # intransitive mihosotra m+i+hosotra 'pres-pref.i-root.hosotra''(to-be)-anointed/covered-with'; hosory # '(let-s.one/sth/PATIENT)-be-anointed-by.you'; # passive 1 imperative hosory hosor+y 'stem.hosor-by.you''(let-s.one/sth/PATIENT)-be-anointed-by.you'; hosorana # '(s.one/sth/PATIENT)-usually-be-anointed' or '(s.one/sth/PATIENT-is)-being-anointed'; # passive 1 indicative hosorana hosor+ana 'stem.hosor-suffix.ana''(s.one/sth/PATIENT)-usually-be-anointed' # or '(s.one/sth/PATIENT-is)-being-anointed'; ahosotra # 'a.passive-hosotra''(that-which)-is-usually-rubbed-with, i.e. SOME LIQUID/OIL,...' or # '(INGREDIENT/that-which-is)-being-rubbed-with'; # alternative passive 1 indicative ahosotra a+hosotra 'a.passive-root.hosotra''(that-which)- # is-usually-rubbed-with, i.e. SOME LIQUID/OIL,...' or '(that-which-is)-being-rubbed-with'; anosory # passive 2 imperative anosory an+(h)osor+y 'prf.an-stem.hosor-by.you''(let-sth/INSTRUMENT)- # be-actively-used-by.you-to-anoint'; anosorana # passive 2 indicative anosorana an+(h)sor+ana 'prf.an-stem.hosor-suffix.ana' # '(sth/instrument/circumstance)-be-used-to-anoint'; ihosory # '(let-LOCATION)-be-anointed-by.you'; # alternative passive 2 imperative ihosory i+hosor+y 'prf.i-stem.hosor-by.you''(let-LOCATION)-be-anointed-by.you'; ihosorana # '(LOCATION)-be-rubbed-with'; # passive 2 indicative ihosorana i+hosor+ana 'prf.i-stem.hosor-suffix.ana''(LOCATION)-be-rubbed-with'; Nohosoran'i Jeanne menaka ny tongony. # No- hosor-an' i Jeanne menaka ny tongo-(tra)/ny. # past.passive-hosor-suffix.ana.by D.sg Jeanne oil Det.unspec foot/feet-of-hers # 'Jeanne rubbed her foot/feet with oil'. Nahosotr'i Jeanne ny tongony ilay menaka. # N- a- hosotr' i Jeanne ny tongo-(tra)/ny ilay menaka. # past.active-prf.a.passive-hosotra-by D.sg Jeanne Det.unspec foot/feet-of-hers DX.sg oil # 'Jeanne rubbed the (previously mentioned) oil on her feet'. Nanosoran'i Jeanne menaka ny tongony ilay fitaovana. # N-an-(h)osor-an'i Jeanne menaka ny tongo-(tra)/ny ilay fitaovana. # 'Jeanne used the (previous mention) instrument to rub oil on her feet'. voahosotra # '(who/which)-has-been-successfully-rubbed-with"; # Root hosotra 'anointment'; voohositra voa+hositra 'transitive.perfective-root.hositra''(which)-has-been- # successfully-rubbed-with"; fihosorana # 'the action of getting anointed'; # fihosorana f+i+hosor+ana 'nominalizer.f-prf.i-stem.hosor-suffix.ana''the action of getting anointed'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix I and the stem form; fanosorana # 'the action of anointing'; # fanosorana f+an+(h)sor+ana 'nominalizer.f-prf.an-stem.hosor-suffix.ana''the action of anointing'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; mpanosotra # 'someone who (usually) anoints'; # mpanosotra mp+an+(h)osotra 'prefix.mp-prefix.an-root.hosotra''someone who anoints'; # this form corresponds to what will be labelled 'AGENT MP nominalizer' in the # on-line document 'Nominals in Malagasy'; note the root form; hosy # Root 'trampling' # Root hosy 'trampling'; manosy # 'to trample'; # transitive manosy m+an+root.(h)osy 'pres-prf.an-hosy''to trample'; mihosy # '(to-be-covered)-with-dirt-(from-trampling)'; # intransitive mihosy m+i+hosy 'pres-prf.i-root.hosy''(to-be-covered)-with-dirt-(from-trampling)'; hoseo # '(let-s.one/sth)-be-trampled-by.you'; # passive 1 imperative hoseo hose+o 'stem.hose-by.you''(let-s.one/sth)-be-trampled-by.you'; hosena # '(the-one/that-which-is)-usually-trampled' or '(the-one/that-which-is)-being-trampled'; # passive 1 indicative hosena hose+ina 'stem.hose-suffix.ina''(the-one/that-which-is)-usually-trampled' # or '(the-one/that-which-is)-being-trampled'; anoseo # '(let-sth/INSTRUMENT)-be-used-by.you-to-trample'; # passive 2 imperative anoseo an+(h)ose+o 'prf.an-stem.hose+by.you''(let-sth)-be-used-by.you-to-trample'; anosena # '(sth/INSTRUMENT)-used-to-trample'; # passive 2 indicative anosena an+(h)ose+ana 'prf.an-stem.hose-suffix.ana''(sth/INSTRUMENT)-used-to-trample'; voahosy # '(the-one/that-which)-has-been-successfully-trampled'; # Root hosy 'trampling'; voahosy voa+hosy 'transitive.perfective-root.hosy''(the-one/that-which)-has-been- # successfully-trampled'; fanosena # 'the action of trampling on s.one/sth'; # fanosena f+an+(h)ose+ana 'nominalized.f-pref.an-stem.hose-suff.ana''the action of trampling on s.one/sth'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; fihosena # 'the action of trampling in mud'; # fihosena f+i+hose+ana 'nominalizer.f-prefix.i-stem.hose-suffix.ana''the action of trampling in mud'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix I and the stem form; hovitra # N 'shake'; # Root hovitra 'shake'; mangovitra # 'to shake, to tremble'; # intransitive mangovitra m+an+root.(h>g)ovitra 'to shake, to tremble'; no passive 1 imperative; # no passive 2 imperative. Mangovitry ny hatsiaka aho. # M- an- (h)ovitra/y ny hatsiaka aho. # pres-prf.an-hovitra-by/because-of det.unspec cold I # 'I shake because of the cold'. hozohozo # N 'weakness'; # Root hozohozo 'weakness'; mangozohozo # 'to be weak (from illness or old age)'; # intransitive mangozohozo m+an+root.(h>g)ozohozo 'to be weak (from illness or old age)'; mihozohozo # 'to be in a habitual state of being weak (from illness or old age)'; # intransitive mihozohozo m+i+root.hozohozo 'to be in a habitual state of being weak (from # illness or old age)'; no passive 1 imperative; no passive 2 imperative; fangozohozoana # 'physical symptoms of weakness, debility'; # fangozohozoana f+an+(h>g)ozohozo+ana 'nominalizer.f-prefix.an-stem.hozohozo-suffix.ana''weakness, debility'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix AN and the stem form; fihozohozoana # 'the state of being weak, debility'; # fihozohozoana f+i+hozohozo+ana 'nominalizer.f-prefix.i-stem.hozohozo-suffix.ana''weakness, debility'; # this form corresponds to what will be labelled 'Action Nominalization' in the # on-line document 'Nominals in Malagasy'; note the prefix I and the stem form;
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Sveriges lantbruksuniversitet - IR - 2637
Creators of the CommonsHeather Morrison BC Electronic Library Network & The Imaginary Journal of Poetic EconomicsCopyright in Libraries: The Digital onundrum CLA Information Commons Interest Group Preconference to Canadian Library Association Conf
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Nominals in Malagasy - ESRC-OX-06-CR210.# Malagasy Nominals.testfile.
Sveriges lantbruksuniversitet - IR - 3580
Wecandos o r n e t h i n a -People d o not end up o n the streets by accident. Public policy and urban development trends can either contribute to poverty and homelessness or prevent it. Vancouver is at a turning point; w e n o w have
Sveriges lantbruksuniversitet - LIB - 3580
Wecandos o r n e t h i n a -People d o not end up o n the streets by accident. Public policy and urban development trends can either contribute to poverty and homelessness or prevent it. Vancouver is at a turning point; w e n o w have
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Malagasy Coordination - ESRC-OX-06-CR208.# Malagasy Coordination.testf
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Grammatical functions, roots and stems in Malagasy - ESRC-OX-06-CR209.# Gr
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Malagasy verbs of saying - - ESRC-OX-05-CR205.# This document will explor
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax & semantics:# Malagasy Causatives & CONTROL: ESRC-OX-05-CR202.# Causative prefixes amp(
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Malagasy Pronouns - ESRC-OX-05-CR206.# In addition to the basic process
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Malagasy Prepositions - ESRC-OX-05-CR207.# Malagasy Prepositions.testfi
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax & semantics:# Malagasy simple sentences Case-marking & NPs: ESRC-OX-05-CR101/201.#
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy lexicon:# Malagasy Roots with a passive meaning: ESRC-OX-05-CR301.# There exist in Malagasy
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax & semantics:# Passive affixes in Malagasy - ESRC-OX-05-CR106/204.# As outlined in Randr
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax & semantics:# Malagasy Passives: ina/ana alternation. ESRC-OX-05-CR105/203.# Malagasy
Allan Hancock College - TIB - 2009360
QueenslandTelecommunicationsInterception Bill 2009 QueenslandTelecommunications Interception Bill2009Contents
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Adjectives & Adverbs in Malagasy - ESRC-OX-06-CR211# Adjectives & Adverb
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Grammatical functions, roots and stems in Malagasy - ESRC-OX-06-CR209.# G
Mt. Holyoke - PH - 256
Igneous Tourmaline HS#2356 Black Tourmaline 18mil 8/27/92 512 0 0 0 1 0 0 0 0 0 0.000000E+00 300.000 3.907231E+07 2.009
Cal Poly - INF - 6900
PC/Mikes Word Documents/Writing a paper.docHow to Write a PaperMike Ashby, Engineering Department, University of Cambridge, Cambridge CB2 1PZ, UK Version 5, January, 2000This brief manual gives guidance in writing a paper about your research. M
UC Davis - LOG - 0804
Sveriges lantbruksuniversitet - IR - 104
Open Access: Basics and Benefits"Open Access" has emerged in recent years as a major development in the world of scholarly communication. It may have the potential to greatly alter the university publishing environment and change the ways in which e
Sveriges lantbruksuniversitet - LIB - 104
Open Access: Basics and Benefits"Open Access" has emerged in recent years as a major development in the world of scholarly communication. It may have the potential to greatly alter the university publishing environment and change the ways in which e
Sveriges lantbruksuniversitet - IR - 1589
Frame and Metaphor in Political GamesIan BogostGeorgia Institute of Technology School of Literature Communication and Culture 686 Cherry St. Atlanta, GA 30332 USA +1 (404) 894-1160 ian.bogost@lcc.gatech.edu ABSTRACT This paper offers an approach to
Sveriges lantbruksuniversitet - LIB - 1589
Frame and Metaphor in Political GamesIan BogostGeorgia Institute of Technology School of Literature Communication and Culture 686 Cherry St. Atlanta, GA 30332 USA +1 (404) 894-1160 ian.bogost@lcc.gatech.edu ABSTRACT This paper offers an approach to
Sveriges lantbruksuniversitet - IR - 1618
1Architecting Scalability for Massively Multiplayer Online Gaming ExperiencesRui GilCISUC, University of Coimbra Polo II Universidade de Coimbra, 3030-290 Coimbra, Portugal +351-23979000 rgil@dei.uc.ptJos Pedro TavaresCISUC, University of Coi
Sveriges lantbruksuniversitet - IR - 1605
Designing Puzzles for Collaborative Gaming Experience CASE: eScapeTony ManninenUniversity of Oulu, Department of Information Processing Science LudoCraft Game Design and Research Unit PO Box 3000, FIN-90014 OULUN YLIOPISTO tony.manninen@oulu.fiT
East Los Angeles College - MAGD - 2649
The easiest way for CompScis to access Oxford University exam results without using the VPN=NOTE: You follow these instructions at your own risk!1. On Linux or Mac, type this at a command prompt:ssh -D 1080 yourusername@ecs.ox.ac.uk On Win
East Los Angeles College - MERT - 2255
2628 July 28 July 28 July 30 July 1 Aug 36 Aug 69 AugNP, PWDerigging camp: carried gear up from camp to 480m on rst day; derigged out from camp to 480m on second day. Helped NP and PW with derigging from camp. Finished derigging Pozo Chicago. Der
East Los Angeles College - MERT - 2255
Entrance P36 P42 Meandro del Guaje P5 P7 Siniestro Parcial (P57)No hay Cristal! (P60)C6P8 El Jardinet (P50) P6 P6 P17 Pozu Acrobatico (P67) El fet diferencial P15 P22 P14 P12 P16 Pous Electrics P6 P4 P6 P10 P7 P4 P80 P7 P5 P4 P15 P9La Pica (P25
East Los Angeles College - MERT - 2255
BYU - IT - 104
TransformersNo, this has nothing to do with that movie!XAdmin Applications Power-line networking Lab feedback? Too many missing labs Looking for a Webmaster for IT ExperienceLearning outcomes Describe mutual induction State ideal Xf
Sveriges lantbruksuniversitet - BUS - 312
Liquidity RatiosNet Working Capital = Net Working Capital as a % of Total Assets Current Assets Current Liabilities=Net Working Capital Total AssetsCurrent Ratio =Current Assets Current LiabilitiesCash + Marketable Securities + Receivables
BYU - BIO - 465
Structure PredictionTertiary protein structure: protein foldingThree main approaches: [1] experimental determination (X-ray crystallography, NMR) [2] Comparative modeling (based on homology) [3] Ab initio (de novo) prediction (Dr. Ingo Ruczinski a
Sveriges lantbruksuniversitet - ENGL - 20022
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ENGL 205-3 E01 TITLE: 17TH/18TH C. LITS. SEMESTER: 2002-2 LOCATION: SFU SECTION TYPE: LEC ENROL: 24= PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown
BYU - PHYSICS - 321
Physics 321 Take-home Test 6 Problem 1. A lamina is in the shape of a right triangle with the two sides (not the hypotenuse) with lengths a = 6.0 cm and b = 4.5 cm. The mass of the traingle is 250 g and the density is uniform. We choose the x-axis of
BYU - PHYSICS - 321
Physics 321 Homework 2 Due at midnight on the day of Hour 3. This homework is intended to help you understand how Maple can arrive at the solution of complicated differential equations numerically. The basic idea is that we can start with initial con
BYU - INBIO - 465
[starts PAUP]begin paup;setautoclose [closes the status window automatically]nowarntree [turns off the feature that prompts you to save trees in memory]nowarnreset [turns off feature that asks "do you really want to reset the data file
BYU - DAM - 465
[starts PAUP]begin paup;setautoclose [closes the status window automatically]nowarntree [turns off the feature that prompts you to save trees in memory]nowarnreset [turns off feature that asks "do you really want to reset the data file
BYU - WEEK - 465
[starts PAUP]begin paup;setautoclose [closes the status window automatically]nowarntree [turns off the feature that prompts you to save trees in memory]nowarnreset [turns off feature that asks "do you really want to reset the data file
BYU - INBIO - 465
newsRival demands sink genome alliance plansLondonSecret talks between rival teams racing to complete the sequencing of the human genome have failed, dashing hopes of collaboration and leaving a trail of recriminations. The two teams - the publi
BYU - DAM - 465
newsRival demands sink genome alliance plansLondonSecret talks between rival teams racing to complete the sequencing of the human genome have failed, dashing hopes of collaboration and leaving a trail of recriminations. The two teams - the publi
BYU - WEEK - 465
newsRival demands sink genome alliance plansLondonSecret talks between rival teams racing to complete the sequencing of the human genome have failed, dashing hopes of collaboration and leaving a trail of recriminations. The two teams - the publi
BYU - INBIO - 465
#NEXUSBEGIN DATA;DIMENSIONS NTAX=15 NCHAR=315;FORMAT DATATYPE=DNA GAP=- MISSING=?;MATRIXseq1CATTACACGCCAGACACCTCAACTGCTTTCTCATCAGTCGCACACATCTGCCGAGACGTCAACTGAGGACAAATATCATTCTGAGGCGCAACCGTCATCACCAACCTCTTATCAGCAATCCCTTATATCGGCACTACCTTAGTCGAAT
BYU - DAM - 465
#NEXUSBEGIN DATA;DIMENSIONS NTAX=15 NCHAR=315;FORMAT DATATYPE=DNA GAP=- MISSING=?;MATRIXseq1CATTACACGCCAGACACCTCAACTGCTTTCTCATCAGTCGCACACATCTGCCGAGACGTCAACTGAGGACAAATATCATTCTGAGGCGCAACCGTCATCACCAACCTCTTATCAGCAATCCCTTATATCGGCACTACCTTAGTCGAAT
BYU - WEEK - 465
#NEXUSBEGIN DATA;DIMENSIONS NTAX=15 NCHAR=315;FORMAT DATATYPE=DNA GAP=- MISSING=?;MATRIXseq1CATTACACGCCAGACACCTCAACTGCTTTCTCATCAGTCGCACACATCTGCCGAGACGTCAACTGAGGACAAATATCATTCTGAGGCGCAACCGTCATCACCAACCTCTTATCAGCAATCCCTTATATCGGCACTACCTTAGTCGAAT
East Los Angeles College - MAGD - 1129
ConsCiousness and Timeedinburgh university 1-3 april 2008abden House, Pollock HallsabstractsTuesday 1st april 3.455.00 Consciousness takes time: evidence from sequence learning, conditioning, and action studies. Prof axel Cleeremans (Cognitive
East Los Angeles College - MAGD - 1129
EXPERIENCE AND TIME: ABSTRACTWe are no less directly acquainted with the temporal structure of the world than with its spatial structure. We hear one word succeeding another; feel two taps as simultaneous; or see the glow of a firework persisting
Allan Hancock College - DDA - 1992264
[pic]Disability Discrimination Act 1992Act No. 135 of 1992 as amendedThis compilation was prepared on 27 March 2006taking into account amendments up to Act No. 86 of 2005and SLI 2006 No. 50The text of any of those amendments not in forceo
East Los Angeles College - PATH - 0116
AutoMACS User GuideThe autoMACS allows biomagnetic cell sorting of cells labelled with MACS microbeads. The MACS products are sold by Miltenyi Biotec (on-line catalogue at www.miltenyibiotec.com). The Dunn School autoMACS is located in Rm. 41, wher
Sveriges lantbruksuniversitet - ENGL - 20022
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ENGL 199-3 D01 LOCATION: SFU TITLE: INTRO UNIV. WRITING SECTION TYPE: SEM SEMESTER: 2002-2 ENROL: 18 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown
Sveriges lantbruksuniversitet - ARTS - 20022
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: SA 325-4 D01 LOCATION: SFU TITLE: POLITICAL SOCIOLOGY SECTION TYPE: SEM SEMESTER: 2002-2 ENROL: 28 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown s
Sveriges lantbruksuniversitet - ENGL - 20022
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ENGL 371-4 H01 LOCATION: DOW TITLE: WRITING:THEORY/PRAC SECTION TYPE: SEC SEMESTER: 2002-2 ENROL: 18 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown
Sveriges lantbruksuniversitet - POL - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: POL 422-4 D01 LOCATION: SFU TITLE: CAN.INTL.SECURITY SECTION TYPE: SEM SEMESTER: 2000-1 ENROL: 8 = PROGRAM OF STUDENT (Top 5 programs reported in each category) -Approved Intended Approved Certs, Majo
Sveriges lantbruksuniversitet - ARCH - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ARCH 340-5 D01 LOCATION: SFU TITLE: ZOOARCHAEOLOGY SECTION TYPE: LEC SEMESTER: 2000-1 ENROL: 23 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown sepa
BYU - ECE - 320
Clock and SynchronizationRTL Hardware Design by P. ChuChapter 161Outline1. 2. 3. 4. Why synchronous? Clock distribution network and skew Multiple-clock system Meta-stability and synchronization failure 5. SynchronizerRTL Hardware Design by
Sveriges lantbruksuniversitet - PSYC - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: PSYC 461-5 D01 LOCATION: SFU TITLE: ST-SOCIAL COGNITION SECTION TYPE: SEM SEMESTER: 2000-1 ENROL: 12 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown
Sveriges lantbruksuniversitet - CHEM - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: CHEM 122-2 D01 LOCATION: SFU TITLE: GENERAL CHEMISTRY II SECTION TYPE: LEC SEMESTER: 2000-1 ENROL: 300 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not sho
Sveriges lantbruksuniversitet - PHIL - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: PHIL 110-3 D01 LOCATION: SFU TITLE: LOGIC AND REASONING SECTION TYPE: LEC SEMESTER: 2000-1 ENROL: 143 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not show
Sveriges lantbruksuniversitet - ARTS - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: WS 102-3 C01 LOCATION: SFU TITLE: WESTERN FEMINISM SECTION TYPE: SEC SEMESTER: 2000-1 ENROL: 45 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown sepa
Sveriges lantbruksuniversitet - PSYC - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: PSYC 201-4 C01 LOCATION: SFU TITLE: RESEARCH METHODS SECTION TYPE: SEC SEMESTER: 2000-1 ENROL: 38 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown se
Sveriges lantbruksuniversitet - BUS - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: BUS 466-3 D01 LOCATION: SFU TITLE: MANAGING DATA CMNS SECTION TYPE: SEM SEMESTER: 2000-1 ENROL: 37 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown s