13 Pages

case.syntax-testfile

Course: CPGL 0015, Fall 2009
School: East Los Angeles College
Rating:
 
 
 
 
 

Word Count: 4487

Document Preview

Verb-initial # grammars: A multilingual/parallel perspective # ESRC Project RES-000-23-0505 # Oxford University # Charles Randriamasimanana # Malagasy syntax & semantics: # Malagasy simple sentences Case-marking & NPs: ESRC-OX-05-CR101/201. # My purpose here is to show how case-marking works in Malagasy, in the process distinguishing # between three different types of nouns depending on the...

Register Now

Unformatted Document Excerpt

Coursehero >> California >> East Los Angeles College >> CPGL 0015

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Verb-initial # grammars: A multilingual/parallel perspective # ESRC Project RES-000-23-0505 # Oxford University # Charles Randriamasimanana # Malagasy syntax & semantics: # Malagasy simple sentences Case-marking & NPs: ESRC-OX-05-CR101/201. # My purpose here is to show how case-marking works in Malagasy, in the process distinguishing # between three different types of nouns depending on the nature of the phrasal head, i.e. a D # accompanying a proper name(PN), a Det accompanying a common noun (CN) or a DX, which can go # with either PN or CN. In the second half of this document, it will be seen that a verb that # assigns accusative case does not necessarily undergo passive. # Three main types of noun: # A. Proper name (PN) = bare NP headed by a D; pattern A; # B. Common noun (CN) = optionally headed by a Det thus forming a DetP, # i.e Definite phrase; pattern B; # C. Either PN or CN headed by DX; pattern C. # Case-marking pattern: # Pattern A. With bare NPs with D, i.e. PN # Nominative = Accusative = an. # Pattern B. With DetP no accusative marker an at all possible. # Pattern C. With DX previous mention ilay, accusative marker an # is optional. # Three types of determiner: # Type D = { i 'intimate + proper name', ry 'proper name & associates', # Ra... 'familiar + proper name', Ikala 'intimate + female proper name', # Ingahy 'familiar + male proper name', Ramatoa 'Mrs.', Ramatoakely 'Miss', # Andriamatoa 'The honorable Mr...', Itompokovavy 'the late + intimate + female # proper name', Itompokolahy 'the late + intimate + male proper name', ... }. # Type Det = ny 'the entire set (of entities)'. # Type DX = { ilay 'the previous mention', ity 'this.singular.near.speaker', # ireto 'these.plural.near.speaker', iny 'this.singular.near.hearer', ireny 'these. # plural.near.hearer', iry 'this.visible.far', irery 'these.plural.visible.far', # itsy 'this.singular.to.the.side', iretsy 'these.plural.to.the.side', # iro ''this.singular.visible', irero 'these.plural.visible', ...}. # Typical traditional proper names = {i Koto, Ikoto, Rakoto; i Naivo, # Ranaivo, i Soa, Rasoa; IKala, Rakala; i Ketaka, Iketaka, Raketaka; # i Tefy, Ratefy; i Vololona, Ravololona}. # Apparent exceptions behave as expected, i.e. as PN following pattern A # above: { NyAvana, NyOny, NyAina,} # F 1: Testfile for Case in simple Malagasy sentences. # However see File 3 below for Case in sentences involving complex predicates as many verbs # appear to be superficially simple and yet involve rather complex morphology. # General pattern A: Nominative case-marker but D is obligatory. # Ungrammatical Bakoly ve no manapaka bozaka? (0! 0 0 0) # Bakoly ve no m- an-(t)apaka bozaka? # Bakoly Q focus pres-prf.an-root.tapaka grass # "Is it Bakoly who is cutting grass?" # This sequence is adapted from Ileana Paul (2000: 177, ex. 48). # Note the absence of D.sg 'i' in front of 'Bakoly'. I Bakoly ve no manapaka bozaka? # I Bakoly ve no m- an-(t)apaka bozaka? # D.sg Bakoly Q focus pres-prf.an-root.tapaka grass # "Is it Bakoly who is cutting grass?" # Note the presence of D.sg 'i' in front of 'Bakoly'. # Ungrammatical Omaly ve Bakoly no manapaka bozaka? (0! 0 0 0) # Omaly ve Bakoly no m- an-(t)apaka bozaka? # yesterday Q Bakoly focus pres-prf.an-root.tapaka grass # "Was it yesterday that Bakoly was cutting grass?" # This sequence is adapted from Ileana Paul (2000: 178, ex. 49). # Note the absence of D.sg 'i' in front of 'Bakoly'. Omaly ve i Bakoly no nanapaka bozaka? # Omaly ve i Bakoly no n-an- (t)apaka bozaka? # yesterday Q D.sg Bakoly focus past-prf.an-root.tapaka grass # "Was it yesterday that Bakoly was cutting grass?" # Note the presence of D.sg 'i' in front of 'Bakoly'. # Ungrammatical Bakoly ve dia manapaka bozaka? (0! 0 0 0) # Bakoly ve dia m- an-(t)apaka bozaka? # Bakoly Q topic pres-prf.an-root.tapaka grass # "Bakoly, is she cutting grass?" # This sequence is adapted from Ileana Paul (2000: 178, ex. 50). # Note the absence of D.sg 'i' in front of 'Bakoly'. I Bakoly ve dia manapaka bozaka? # I Bakoly ve dia m- an-(t)apaka bozaka? # D.sg Bakoly Q topic pres-prf.an-root.tapaka grass # "Bakoly, is she cutting grass?" # This sequence was adapted from Ileana Paul (2000: 178, ex. 50). # Note the presence of D.sg 'i' in front of 'Bakoly'. # General pattern A: Accusative-marker 'an' obligatory on D. Nahita ani Koto i Soa. # Nahita an i Koto i Soa. # N-a-hita an' i Koto i Soa. # past-pref.a-root.hita acc D.sg Koto D.sg Soa # "Soa (intimate) saw Koto (intimate)." # Ungrammatical Nahita i Koto i Soa.(0! 0 0 0) # N-a-hita i Koto i Soa. # past-pref.a-root.hita D.sg Koto D.sg Soa. # "Soa (intimate) saw Koto (intimate)." Nahita an-dry Koto ry Soa. # N-a-hita an- d-ry Koto ry Soa. # past-pref.a-root.hita acc-d-D.pl Koto D.pl Soa # "Soa & associates saw Koto & associates." # Note the presence of the accusative particle 'an'. # Note the epenthetic d between 'an' and D.plur 'ry.' # Ungrammatical Nahita ry Koto ry Soa.(0! 0 0 0) # N-a-hita ry Koto ry Soa. # past-pref.a-root.hita D.pl Koto D.pl Soa # "Soa & associates saw Koto & associates." # Note the absence of the accusative particle 'an'. Nahita an-dRaKoto Rasoa. # N-a-hita an- d-Ra- koto Ra-soa. # past-pref.a-root.hita acc-d-D.sg koto D.sg-soa # "Rasoa (familiar) saw Rakoto (familiar)." # Note the presence of the accusative particle 'an'. # Note the epenthetic 'd' between 'an' & 'Rakoto'. # Ungrammatical Nahita RaKoto Rasoa.(0! 0 0 0) # N-a-hita Ra-koto Ra-soa. # past-pref.a-root.hita D.sg-koto D.sg-soa # "Rasoa (familiar) saw Rakoto (familiar)." # Note the absence of the accusative particle 'an'. Nahita an'Ikala Soa i Koto. # N-a-hita an Ikala Soa i Koto. # past-pref.a-root.hita acc D.sg Soa D.sg Soa # "Koto (intimate) saw Soa (very intimate, only between females)." # Note the presence of the accusative particle 'an' in front of # D.sg 'Ikala". # Ungrammatical Nahita Ikala Soa i Koto.(0! 0 0 0) # N-a-hita Ikala Soa i Koto # past-pref.a-root.hita D.sg Soa D.sg Koto # "Koto (intimate) saw Soa (very intimate, only between females)." # Note the absence of the accusative particle 'an' in front of # D.sg 'Ikala'. Nahita an-dRamatoa Rakala i Koto. # N-a-hita an- d-Ramatoa Rakala i Koto. # past-pref.a-root.hita acc-d-D.sg Rakala D.sg Koto # "Koto (intimate) saw Mrs. Rakala (deferential)." # Note the presence of the accusative particle 'an' in front of # D.sg 'Ramatoa'. # Note the epenthetic 'd' between the accusative particle 'an' and # D.sg 'Ramatoa'. # Ungrammatical Nahita Ramatoa Rakala i Koto.(0! 0 0 0) # N-a-hita Ramatoa Rakala i Koto # past-pref.a-root.hita D.sg Rakala D.sg Koto # "Koto (intimate) saw Mrs. Rakala (deferential)." # Note the absence of the accusative particle 'an' in front of # D.sg 'Ramatoa'. Nahita anIngahy Rakoto i Soa. # N-a-hita an' Ingahy Rakoto i Soa. # past-pref.a-root.hita acc D.sg Rakoto D.sg Soa # "Soa (intimate) saw Mr. Rakoto (somewhat familiar)." # Note the presence of the accusative particle 'an' in front of # D.sg 'Ingahy'. # Ungrammatical Nahita Ingahy Koto i Soa.(0! 0 0 0) # N-a-hita Ingahy Rakoto i Soa. # past-pref.a-root.hita D.sg Rakoto D.sg Soa # "Soa (intimate) saw Mr. Rakoto (somewhat familiar)." # Note the absence of the accusative particle 'an' in front of # D.sg 'Ingahy'. Nahita anAndriamatoa Rakoto i Soa. # N-a-hita an' Andriamatoa Rakoto i Soa. # past-pref.a-root.hita acc D.sg Rakoto D.sg Soa # "Soa (intimate) saw Mr. Rakoto (deferential)." # Note the presence of the accusative particle 'an' in front of # D.sg 'Andriamatoa'. # Ungrammatical Nahita Andriamatoa Rakoto i Soa.(0! 0 0 0) # N-a-hita Andriamatoa Rakoto i Soa. # past-pref.a-root.hita D.sg Rakoto D.sg Soa # "Soa (intimate) saw Mr. Rakoto (deferential)." # Note the absence of the accusative particle 'an' in front of # D.sg 'Andriamatoa'. Nahita ani NyAina i NyAvana. # N-a-hita an' i Nyaina i NyAvana. # past-pref.a-root.hita acc D.sg Nyaina D.sg NyAvana # "NyAvana (intimate) saw NyAina (intimate)." # Note the presence of the accusative particle 'an' in front of # D.sg 'i'. # Note that 'NyAina' is a proper name, not analyzed as a combination # of 'Ny + Aina'. # Ungrammatical Nahita NyAina i NyAvana.(0! 0 0 0) # N-a-hita Nyaina i NyAvana. # past-pref.a-root.hita Nyaina D.sg NyAvana # "NyAvana (intimate) saw NyAina (intimate)." # Note the absence of the accusative particle and that of # D.sg 'i' in front of the proper name 'NyAina'. # Ungrammatical Nahita an'NyAina i NyAvana.(0! 0 0 0) # N-a-hita an' Nyaina i NyAvana. # past-pref.a-root.hita acc Nyaina D.sg NyAvana # "NyAvana (intimate) saw NyAina (intimate)." # Note the absence of D.sg 'i' in front of the proper name 'NyAina'. # General pattern B: accusative-marker 'an' incompatible with Det 'ny'. Nahita ny ankizy i Soa. # N-a-hita ny ankizy i Soa. # past-pref.a-root.hita Det.unspec child(ren) D.sg Soa # "Soa (intimate) saw the (previous mention) children." # Note the absence of the accusative case particle 'an' in front # of Det.unspec 'ny'. # Ungrammatical Nahita anny ankizy i Soa.(0! 0 0 0) # N-a-hita an ny ankizy i Soa.(0! 0 0 0) # past-pref.a-root.hita acc Det.unspec child(ren) D.sg Soa # "Soa (intimate) saw the (previous mention) children." # Note the presence of the accusative case particle 'an' in front # of Det.unspec 'ny'. # Note that Det 'ny' is unspecified in that it refers to a set, which # can comprise a whole set of entities (plural) or only one single # entity (singular) in case of familiarity. # Thus the following sequence # Nahita ny lehilahy ny vehivavy. # N-a-hita ny lehilahy ny vehivavy. # past-pref.a-root.hita Det.unspec man/men Det.unspec woman/women # "The woman saw the man." (original translation) # This sentence is adapted from Ileana Paul (2000: 15, ex 23a.). # It should be translated as 'The (previous mention) women saw # the (previous mention) men." Nahita ny lehilahy ny vehivavy. # N-a-hita ny lehilahy ny vehivavy. # past-pref.a-root.hita Det.unspec man/men Det.unspec woman/women # "The woman saw the man." (original translation) # This sentence is from Ileana Paul (2000: 15, ex 23a.). # It should be translated as 'The (previous mention) women saw # the (previous mention) men." # The above sequence cannot appear discourse-initially; first # one needs (a) to introduce all the entities comprised in # the set in a previously explicit discourse and (b) refer to # all members of the set. Nahita ny alika ny zazavavy. # N-a-hita ny alika ny zazavavy. # past-pref.a-root.hita Det.unspec a/dog(s) Det.unspec a/girl(s) # "The girl sees the dog." (original translation) # This sentence is from Matthew Pearson (2001: 28, ex 19a.). # It should be translated as 'The (previous mention) girls saw # the (previous mention) dogs." # The above sequence cannot appear discourse-initially; first # one needs (a) to introduce all the entities comprised in # the set in a previously explicit discourse and (b) refer to # all members of the set. # General pattern C: accusative-marker an optional on DX. Nahita ilay ankizy i Soa. # N-a-hita ilay ankizy i Soa. # past-pref.a-root.hita DX.sg child(ren) D.sg Soa # "Soa (intimate) saw the (previous mention) child." # Note the absence of the accusative particle 'an' in front of # DX.sg 'ilay''the previously mentioned' Nahita anilay ankizy i Soa. # N-a-hita an' ilay ankizy i Soa. # past-pref.a-root.hita acc DX.sg child(ren) D.sg Soa # "Soa (intimate) saw the (previous mention) child." # Note the presence of the accusative particle 'an' in front of # DX.sg 'ilay''the previously mentioned' Nahita ity ankizy i Soa. # N-a-hita ity ankizy i Soa. # past-pref.a-root.hita DX.sg child(ren) D.sg Soa # "Soa (intimate) saw this (previous mention) child." # Note the absence of the accusative particle 'an' in front of # DX.sg 'ity''this.near.the.speaker' Nahita anity ankizy i Soa. # N-a-hita an' ity ankizy i Soa. # past-pref.a-root.hita acc DX.sg child(ren) D.sg Soa # "Soa (intimate) saw the (previous mention) child." # Note the presence of the accusative particle 'an' in front of # DX.sg 'ity''this.near.the.speaker' Nahita ireto ankizy i Soa. # N-a-hita ireto ankizy i Soa. # past-pref.a-root.hita DX.pl child(ren) D.sg Soa # "Soa (intimate) saw these (previous mention) children." # Note the absence of the accusative particle 'an' in front of # DX.pl 'ireto''these.near.the.speaker'. Nahita anireto ankizy i Soa. # N-a-hita an' ireto ankizy i Soa. # past-pref.a-root.hita acc DX.pl child(ren) D.sg Soa # "Soa (intimate) saw these (previous mention) children." # Note the presence of the accusative particle 'an' in front of # DX.pl 'ireto''these.near.the.speaker'. Nahita iro ankizy i Soa. # N-a-hita iro ankizy i Soa. # past-pref.a-root.hita DX.sg child(ren) D.sg Soa # "Soa (intimate) saw this (previous mention) child." # Note the absence of the accusative particle 'an' in front of # DX.sg 'iro''this.near.the.speaker/hearer'. Nahita aniro ankizy i Soa. # N-a-hita an' iro ankizy i Soa. # past-pref.a-root.hita acc DX.sg child(ren) D.sg Soa # "Soa (intimate) saw this (previous mention) child." # Note the absence of the accusative particle 'an' in front of # DX.sg 'iro''this.near.the.speaker/hearer'. Nahita irero ankizy i Soa. # N-a-hita irero ankizy i Soa. # past-pref.a-root.hita DX.pl child(ren) D.sg Soa # "Soa (intimate) saw those (previous mention) children." # Note the absence of the accusative particle 'an' in front of # DX.pl 'irero''these.near.the.speaker/hearer'. Nahita anirero ankizy i Soa. # N-a-hita an' irero ankizy i Soa. # past-pref.a-root.hita acc DX.pl child(ren) D.sg Soa # "Soa (intimate) saw those (previous mention) children." # Note the presence of the accusative particle 'an' in front of # DX.pl 'irero''these.near.the.speaker/hearer'. # Remarks on pseudo-transitive verbs in Malagasy: # In Malagasy, many verbs look like could they be simple transitive verbs; in reality, they are # not as they do not undergo passive. A typical example is 'mahita''to see'. This phenomenon seems # to be generally related to the morphological complexity of the verbal predicate under consideration. # At first, we will consider apparently simple predicates before delving into complex ones. # Part A: Morpheme aha > a & lack of morphological Fusion, i.e. a complex predicate # comprising this morpheme remains complex in that there is no fusion between the # higher and the lower predicates. See Randriamasimanana (1986:129-177) for further # details. This contrasts with the situation to be dealt with in Part B. hita # hita root 'be.seen'; mahita # mahita m+a+hita pseudo-transitive verb 'to see' or 'to be able to see'; # at first sight, the form mahita looks like a straightforward and simple predicate; # in reality, it is a complex predicate, which will assign accusative case to its # complement, but not be able to undergo passive as a morphological unit; we will # label this type of verb as 'pseudo-transitive'; # mahita < m+a+hita < m+aha+hita 'active.voice.pres-aha-root.hita'; standard Malagasy being # an h-dropping variety, aha reduces to aa > a, hence the apparent prefix a; evidence for # deriving a from aha, mahita = 'see' as well as 'can see'(ABILITATIVE meaning); the # above solution was first suggested in Rabenilaina (1996:133, Table 11). # Evidence that mahita is a pseudo-transitive V: # (A) It is true that 'mahita' requires a complement, which appears to be a Direct Object,i.e. # DO at least, as far as case-assignment is concerned; consider Nahita an'Ikala Soa i Koto. # N-a-hita an Ikala Soa i Koto. # past-pref.a-root.hita acc D.sg Soa D.sg Soa # "Koto (intimate) saw Soa (very intimate, only between females)." # Ungrammatical: Nahita Ikala Soa i Koto.(0! 0 0 0) # N-a-hita Ikala Soa i Koto # past-pref.a-root.hita D.sg Soa D.sg Koto # "Koto (intimate) saw Soa (very intimate, only between females)." # (B) However, if mahita was really a transitive V it should be possible to 'promote' its DO # to grammatical subject. Now this is totally impossible! The reason for this kind of # phenomenon can be related to the general behavior of ABILITATIVE aha when combining with other # roots, i.e. passive roots (exactly the case of mahita) as well as nonpassive roots. # In the sequence ABILITATIVE aha + root, we have two separate predicates, i.e. # the higher predicate aha and the lower root predicate. The complex aha + root # can assign accusative case to its complement; but because we do not have one single # predicate but two different ones, passive of the complex sequence is totally impossible. # The above phenomenon is not restricted to the pseudo-transitive V mahita. It applies # to all sequences comprising ABILITATIVE aha + passive root (first section). Consider # the examples below Nahaloaka an'ilay varavarana i Koto. # N-aha-loaka an' ilay varavarana i Koto. # past-aha-root.loaka acc DX.sg window D.sg Koto # 'Koto managed to perforate the window.' # Ungrammatical: Nahaloakan'i Koto ilay varavarana.(0! 0 0 0) # N-aha-loaka-n(a) i Koto ilay varavarana . # past-aha-root.loaka-suff.ana D.sg Koto DX.sg window # 'The window was managed to be perforated by Koto.' # The above sentence simply does NOT exist in Malagasy and the initial sequence does not # have a passive voice counterpart comprising the verbal prefix aha: An attempt was made # to passivise on the complex verbal predicate aha + loaka, with the AGENT encoded as a # genitive introduced by -n(a). In fact, the nearest equivalent to a passive voice sequence # is the following Loakan'i Koto ilay varavarana. # Loaka-n' i Koto ilay varavarana. # root.loaka-clitic.na D.sg Koto DX.sg window # 'The (previous mention) window has been successfully perforated by Koto.' # where the ABILITATIVE prefix aha has been taken off the passive root and the AGENT # is now encoded as a genitive via the clitic -n(a) 'by'. Note that the two sequences # ' Nahaloaka an'ilay varavarana i Koto' in the active voice with aha and the perfective # aspect sequence 'Loakan'i Koto ilay varavarana' are cognitively equivalent. # The above phenomenon is not restricted to the pseudo-transitive V mahita. It also applies # to all sequences comprising ABILITATIVE aha + nonpassive root (second section); recall that # this is an open-ended process. Consider the following examples Nahasasa an'ilay lamba i Soa. # N-aha-sasa an' ilay lamba i Soa. # past-aha-root.sasa acc DX.sg linen D.sg Soa # 'Soa managed to wash the (previous mention) linen.' # Ungrammatical: Nahasasan' i Soa ilay lamba.(0! 0 0 0) # N-aha-sasa-n(a) i Soa ilay lamba. # past-aha-root.sasa-suff.(a)na D.sg Soa DX.sg linen # 'The (previous mention) linen was managed to be washed by Soa.' # The above sentence simply does NOT exist in Malagasy and the initial sequence does not # have a passive voice counterpart comprising the verbal prefix aha: An attempt was made # to passivise on the complex verbal predicate aha + sasa, with the AGENT encoded as a # genitive introduced by -n(a). In fact, the nearest equivalent to a passive voice sequence # is the following Voasasan' i Soa ilay lamba. # Voa-sasa-n(a) i Soa ilay lamba. # Perf-root.sasa-clitic.na D.sg Soa DX.sg linen # 'The (previous mention) linen has been successfully washed by Soa.' # where the ABILITATIVE prefix aha has been taken off the nonpassive root and the AGENT is now # encoded as a genitive via the clitic -n(a). The two sequences 'Nahasasa an'ilay lamba i Soa' # in the active voice with aha and the perfective aspect sequence 'Voasasan' i Soa ilay lamba' # are cognitively equivalent. # Part B: Absence of morpheme aha > a & morphological Fusion, i.e. a complex predicate # from which this morpheme aha > a is absent indicates that there may be a fusion between the # higher and the lower predicates. This contrasts with the situation dealt with in # Part A above. tapaka be.cut manapaka m+an+(t)apaka > manapaka genuinely transitive verb 'to cut' # In the active voice, Fusion of the lower predicate, i.e. the root 'tapaka''be.cut' into the # the higher predicate 'an' is quite apparent in the disappearance of the initial consonant of # the root and in the homorganic nasal assimilation usually affecting the nasal of prefix an. # Evidence that manapaka 'to cut' is a genuinely transitive verb. Its complement can not only # take the accusative case-marker 'an'; its direct object can also become a subject, as in Nanapaka an'ilay tady i Paoly. # N-an-(t)apaka an' ilay tady i Paoly. # past-pref.an-root.tapaka acc DX.sg rope D.sg Paul # "Paul cut the (previous mentioned) rope.' Notapahin'i Paoly ilay tady. # No-tapah-in' i Paoly ilay tady. # past.pass-stem.tapah-suff.ina D.sg Paul DX.sg rope # 'The (p.m.) rope was cut by Paul.' # This last sequence shows that the initially complex sequence n+an+tapaka has become one # single unit and that passive on the entire sequence is possible with passive 1 affixes # no...ina. This is characteristic of a typically transitive verb, which is explicitly # indicated in the lexicon by a label like MANIPULATIVE an in the active voice sequence # m+an 'active.voice.present.tense-prf.an' along with its passive 1 counterpart involving # the affixes 'no...ina'. # As expected, with manapaka m+an+(t)apaka the prefix an is MANIPULATIVE an since the embedded # predicate tapaka 'be.cut' is not a psychological predicate. See Randriamasimanana (1986: # 20-26), for example, for further illustrations. If, on the other hand, the prefix an was # CAUSAL, then the embedded predicate is more than likely to be a psychological predicate. # Part C: Pseudo-transitive complex predicates. # It is not just the sequence ABILITATIVE aha+root, which gives rise to a pseudo-transitive # complex predicate, as was shown to be the case in Part A above. It is also the case with # most other causative constructions including the following, which all clearly involve # an embedded psychological predicate: # CAUSAL aha+root mahafaty # root faty N 'corpse'; # m+aha+faty 'pres-aha-faty''dangerous' Io no nahafaty an'i Paoly. # Io no nahafaty an' i Paoly # this focus past-aha-root.faty acc D.sg Paul # 'It is this which caused Paul's death.' # Ungrammatical: Io no nahafaty i Paoly.(0! 0 0 0) # Io no nahafaty i Paoly # this focus past-aha-root.faty D.sg Paul # 'It is this which caused Paul's death.' # The accusative case-marker an has been left out and the second sequence is irretrievably # ungrammatical. # Ungrammatical: Nahafatesan'i Paoly io.(0! 0 0 0) # N-aha-fate-s-an' i Paoly io. # past-aha-stem.fat(i>e)-s-suffix.ana D.sg Paul this # 'It is this which caused Paul's death.' # Putative passive voice for 'Io no nahafaty an'i Paoly'. # An attempt was made to passivise on the complex predicate aha+faty and the output is # total...

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy lexicon:# Malagasy Roots with a passive meaning: ESRC-OX-05-CR301.# There exist in Malagasy
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax &amp; semantics:# Passive affixes in Malagasy - ESRC-OX-05-CR106/204.# As outlined in Randr
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax &amp; semantics:# Malagasy Passives: ina/ana alternation. ESRC-OX-05-CR105/203.# Malagasy
Allan Hancock College - TIB - 2009360
QueenslandTelecommunicationsInterception Bill 2009 QueenslandTelecommunications Interception Bill2009Contents
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Adjectives &amp; Adverbs in Malagasy - ESRC-OX-06-CR211# Adjectives &amp; Adverb
East Los Angeles College - CPGL - 0015
# Verb-initial grammars: A multilingual/parallel perspective# ESRC Project RES-000-23-0505# Oxford University# Charles Randriamasimanana# Malagasy syntax/semantics: # Grammatical functions, roots and stems in Malagasy - ESRC-OX-06-CR209.# G
Mt. Holyoke - PH - 256
Igneous Tourmaline HS#2356 Black Tourmaline 18mil 8/27/92 512 0 0 0 1 0 0 0 0 0 0.000000E+00 300.000 3.907231E+07 2.009
Cal Poly - INF - 6900
PC/Mikes Word Documents/Writing a paper.docHow to Write a PaperMike Ashby, Engineering Department, University of Cambridge, Cambridge CB2 1PZ, UK Version 5, January, 2000This brief manual gives guidance in writing a paper about your research. M
UC Davis - LOG - 0804
Sveriges lantbruksuniversitet - IR - 104
Open Access: Basics and Benefits&quot;Open Access&quot; has emerged in recent years as a major development in the world of scholarly communication. It may have the potential to greatly alter the university publishing environment and change the ways in which e
Sveriges lantbruksuniversitet - LIB - 104
Open Access: Basics and Benefits&quot;Open Access&quot; has emerged in recent years as a major development in the world of scholarly communication. It may have the potential to greatly alter the university publishing environment and change the ways in which e
Sveriges lantbruksuniversitet - IR - 1589
Frame and Metaphor in Political GamesIan BogostGeorgia Institute of Technology School of Literature Communication and Culture 686 Cherry St. Atlanta, GA 30332 USA +1 (404) 894-1160 ian.bogost@lcc.gatech.edu ABSTRACT This paper offers an approach to
Sveriges lantbruksuniversitet - LIB - 1589
Frame and Metaphor in Political GamesIan BogostGeorgia Institute of Technology School of Literature Communication and Culture 686 Cherry St. Atlanta, GA 30332 USA +1 (404) 894-1160 ian.bogost@lcc.gatech.edu ABSTRACT This paper offers an approach to
Sveriges lantbruksuniversitet - IR - 1618
1Architecting Scalability for Massively Multiplayer Online Gaming ExperiencesRui GilCISUC, University of Coimbra Polo II Universidade de Coimbra, 3030-290 Coimbra, Portugal +351-23979000 rgil@dei.uc.ptJos Pedro TavaresCISUC, University of Coi
Sveriges lantbruksuniversitet - IR - 1605
Designing Puzzles for Collaborative Gaming Experience CASE: eScapeTony ManninenUniversity of Oulu, Department of Information Processing Science LudoCraft Game Design and Research Unit PO Box 3000, FIN-90014 OULUN YLIOPISTO tony.manninen@oulu.fiT
East Los Angeles College - MAGD - 2649
The easiest way for CompScis to access Oxford University exam results without using the VPN=NOTE: You follow these instructions at your own risk!1. On Linux or Mac, type this at a command prompt:ssh -D 1080 yourusername@ecs.ox.ac.uk On Win
East Los Angeles College - MERT - 2255
2628 July 28 July 28 July 30 July 1 Aug 36 Aug 69 AugNP, PWDerigging camp: carried gear up from camp to 480m on rst day; derigged out from camp to 480m on second day. Helped NP and PW with derigging from camp. Finished derigging Pozo Chicago. Der
East Los Angeles College - MERT - 2255
Entrance P36 P42 Meandro del Guaje P5 P7 Siniestro Parcial (P57)No hay Cristal! (P60)C6P8 El Jardinet (P50) P6 P6 P17 Pozu Acrobatico (P67) El fet diferencial P15 P22 P14 P12 P16 Pous Electrics P6 P4 P6 P10 P7 P4 P80 P7 P5 P4 P15 P9La Pica (P25
East Los Angeles College - MERT - 2255
BYU - IT - 104
TransformersNo, this has nothing to do with that movie!XAdmin Applications Power-line networking Lab feedback? Too many missing labs Looking for a Webmaster for IT ExperienceLearning outcomes Describe mutual induction State ideal Xf
Sveriges lantbruksuniversitet - BUS - 312
Liquidity RatiosNet Working Capital = Net Working Capital as a % of Total Assets Current Assets Current Liabilities=Net Working Capital Total AssetsCurrent Ratio =Current Assets Current LiabilitiesCash + Marketable Securities + Receivables
BYU - BIO - 465
Structure PredictionTertiary protein structure: protein foldingThree main approaches: [1] experimental determination (X-ray crystallography, NMR) [2] Comparative modeling (based on homology) [3] Ab initio (de novo) prediction (Dr. Ingo Ruczinski a
Sveriges lantbruksuniversitet - ENGL - 20022
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ENGL 205-3 E01 TITLE: 17TH/18TH C. LITS. SEMESTER: 2002-2 LOCATION: SFU SECTION TYPE: LEC ENROL: 24= PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with &lt; 3 students not shown
BYU - PHYSICS - 321
Physics 321 Take-home Test 6 Problem 1. A lamina is in the shape of a right triangle with the two sides (not the hypotenuse) with lengths a = 6.0 cm and b = 4.5 cm. The mass of the traingle is 250 g and the density is uniform. We choose the x-axis of
BYU - PHYSICS - 321
Physics 321 Homework 2 Due at midnight on the day of Hour 3. This homework is intended to help you understand how Maple can arrive at the solution of complicated differential equations numerically. The basic idea is that we can start with initial con
BYU - INBIO - 465
[starts PAUP]begin paup;setautoclose [closes the status window automatically]nowarntree [turns off the feature that prompts you to save trees in memory]nowarnreset [turns off feature that asks &quot;do you really want to reset the data file
BYU - DAM - 465
[starts PAUP]begin paup;setautoclose [closes the status window automatically]nowarntree [turns off the feature that prompts you to save trees in memory]nowarnreset [turns off feature that asks &quot;do you really want to reset the data file
BYU - WEEK - 465
[starts PAUP]begin paup;setautoclose [closes the status window automatically]nowarntree [turns off the feature that prompts you to save trees in memory]nowarnreset [turns off feature that asks &quot;do you really want to reset the data file
BYU - INBIO - 465
newsRival demands sink genome alliance plansLondonSecret talks between rival teams racing to complete the sequencing of the human genome have failed, dashing hopes of collaboration and leaving a trail of recriminations. The two teams - the publi
BYU - DAM - 465
newsRival demands sink genome alliance plansLondonSecret talks between rival teams racing to complete the sequencing of the human genome have failed, dashing hopes of collaboration and leaving a trail of recriminations. The two teams - the publi
BYU - WEEK - 465
newsRival demands sink genome alliance plansLondonSecret talks between rival teams racing to complete the sequencing of the human genome have failed, dashing hopes of collaboration and leaving a trail of recriminations. The two teams - the publi
BYU - INBIO - 465
#NEXUSBEGIN DATA;DIMENSIONS NTAX=15 NCHAR=315;FORMAT DATATYPE=DNA GAP=- MISSING=?;MATRIXseq1CATTACACGCCAGACACCTCAACTGCTTTCTCATCAGTCGCACACATCTGCCGAGACGTCAACTGAGGACAAATATCATTCTGAGGCGCAACCGTCATCACCAACCTCTTATCAGCAATCCCTTATATCGGCACTACCTTAGTCGAAT
BYU - DAM - 465
#NEXUSBEGIN DATA;DIMENSIONS NTAX=15 NCHAR=315;FORMAT DATATYPE=DNA GAP=- MISSING=?;MATRIXseq1CATTACACGCCAGACACCTCAACTGCTTTCTCATCAGTCGCACACATCTGCCGAGACGTCAACTGAGGACAAATATCATTCTGAGGCGCAACCGTCATCACCAACCTCTTATCAGCAATCCCTTATATCGGCACTACCTTAGTCGAAT
BYU - WEEK - 465
#NEXUSBEGIN DATA;DIMENSIONS NTAX=15 NCHAR=315;FORMAT DATATYPE=DNA GAP=- MISSING=?;MATRIXseq1CATTACACGCCAGACACCTCAACTGCTTTCTCATCAGTCGCACACATCTGCCGAGACGTCAACTGAGGACAAATATCATTCTGAGGCGCAACCGTCATCACCAACCTCTTATCAGCAATCCCTTATATCGGCACTACCTTAGTCGAAT
East Los Angeles College - MAGD - 1129
ConsCiousness and Timeedinburgh university 1-3 april 2008abden House, Pollock HallsabstractsTuesday 1st april 3.455.00 Consciousness takes time: evidence from sequence learning, conditioning, and action studies. Prof axel Cleeremans (Cognitive
East Los Angeles College - MAGD - 1129
EXPERIENCE AND TIME: ABSTRACTWe are no less directly acquainted with the temporal structure of the world than with its spatial structure. We hear one word succeeding another; feel two taps as simultaneous; or see the glow of a firework persisting
Allan Hancock College - DDA - 1992264
[pic]Disability Discrimination Act 1992Act No. 135 of 1992 as amendedThis compilation was prepared on 27 March 2006taking into account amendments up to Act No. 86 of 2005and SLI 2006 No. 50The text of any of those amendments not in forceo
East Los Angeles College - PATH - 0116
AutoMACS User GuideThe autoMACS allows biomagnetic cell sorting of cells labelled with MACS microbeads. The MACS products are sold by Miltenyi Biotec (on-line catalogue at www.miltenyibiotec.com). The Dunn School autoMACS is located in Rm. 41, wher
Sveriges lantbruksuniversitet - ENGL - 20022
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ENGL 199-3 D01 LOCATION: SFU TITLE: INTRO UNIV. WRITING SECTION TYPE: SEM SEMESTER: 2002-2 ENROL: 18 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with &lt; 3 students not shown
Sveriges lantbruksuniversitet - ARTS - 20022
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: SA 325-4 D01 LOCATION: SFU TITLE: POLITICAL SOCIOLOGY SECTION TYPE: SEM SEMESTER: 2002-2 ENROL: 28 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with &lt; 3 students not shown s
Sveriges lantbruksuniversitet - ENGL - 20022
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ENGL 371-4 H01 LOCATION: DOW TITLE: WRITING:THEORY/PRAC SECTION TYPE: SEC SEMESTER: 2002-2 ENROL: 18 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with &lt; 3 students not shown
Sveriges lantbruksuniversitet - POL - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: POL 422-4 D01 LOCATION: SFU TITLE: CAN.INTL.SECURITY SECTION TYPE: SEM SEMESTER: 2000-1 ENROL: 8 = PROGRAM OF STUDENT (Top 5 programs reported in each category) -Approved Intended Approved Certs, Majo
Sveriges lantbruksuniversitet - ARCH - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ARCH 340-5 D01 LOCATION: SFU TITLE: ZOOARCHAEOLOGY SECTION TYPE: LEC SEMESTER: 2000-1 ENROL: 23 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with &lt; 3 students not shown sepa
BYU - ECE - 320
Clock and SynchronizationRTL Hardware Design by P. ChuChapter 161Outline1. 2. 3. 4. Why synchronous? Clock distribution network and skew Multiple-clock system Meta-stability and synchronization failure 5. SynchronizerRTL Hardware Design by
Sveriges lantbruksuniversitet - PSYC - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: PSYC 461-5 D01 LOCATION: SFU TITLE: ST-SOCIAL COGNITION SECTION TYPE: SEM SEMESTER: 2000-1 ENROL: 12 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with &lt; 3 students not shown
Sveriges lantbruksuniversitet - CHEM - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: CHEM 122-2 D01 LOCATION: SFU TITLE: GENERAL CHEMISTRY II SECTION TYPE: LEC SEMESTER: 2000-1 ENROL: 300 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with &lt; 3 students not sho
Sveriges lantbruksuniversitet - PHIL - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: PHIL 110-3 D01 LOCATION: SFU TITLE: LOGIC AND REASONING SECTION TYPE: LEC SEMESTER: 2000-1 ENROL: 143 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with &lt; 3 students not show
Sveriges lantbruksuniversitet - ARTS - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: WS 102-3 C01 LOCATION: SFU TITLE: WESTERN FEMINISM SECTION TYPE: SEC SEMESTER: 2000-1 ENROL: 45 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with &lt; 3 students not shown sepa
Sveriges lantbruksuniversitet - PSYC - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: PSYC 201-4 C01 LOCATION: SFU TITLE: RESEARCH METHODS SECTION TYPE: SEC SEMESTER: 2000-1 ENROL: 38 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with &lt; 3 students not shown se
Sveriges lantbruksuniversitet - BUS - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: BUS 466-3 D01 LOCATION: SFU TITLE: MANAGING DATA CMNS SECTION TYPE: SEM SEMESTER: 2000-1 ENROL: 37 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with &lt; 3 students not shown s
Sveriges lantbruksuniversitet - APSC - 20001
Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: CMPT 475-3 E01 LOCATION: SFU TITLE: SOFTWARE ENGINEER.II SECTION TYPE: LEC SEMESTER: 2000-1 ENROL: 52 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with &lt; 3 students not show
Allan Hancock College - PLOEAR - 20051
[pic] Petroleum (Submerged Lands) (Management of Environment) Amendment Regulations 2005 (No. 1)1 Select Legislative Instrument 2005 No. 318 I, PHILIP MICHAEL JEFFERY, Governor-General of the Commonwealth of Australia, acting
East Los Angeles College - MAST - 0315
A Comparison of Univariate Time Series Methods for Forecasting Intraday Arrivals at a Call CenterJames W. Taylor Sad Business School University of OxfordManagement Science, 2008, Vol. 54, pp. 253-265.Address for Correspondence: James W. Taylor
East Los Angeles College - MAST - 0315
1Wind Power Density Forecasting Using Ensemble Predictions and Time Series ModelsJ. W. Taylor, P. E. McSharry, Senior Member, IEEE, and R. Buizza Forthcoming in IEEE Transactions on Energy Conversion.Abstract- Wind power is an increasingly used f
East Los Angeles College - SFOP - 0114
Collection paper INTRODUCTION TO LOGIC Hilary TermTIME: Please answer questions.I have indicated in the margin how many points I would give for each question. for each question is .e maximum. (a) What does it mean for an argument in English t
Sveriges lantbruksuniversitet - ARTS - 19972
PROFILE OF STUDENTS IN SFU COURSES COURSE: SA 496-4 ALL SECTIONS LOCATION: SFU OTH TITLE: DIRECTED READ.ANTHRO SECTION TYPE: SEC SEMESTER: 1997-2 ENROL: 4
East Los Angeles College - SFOP - 0114
LD R O A DSavile House Warham House New College SchoolH O LY W ELNew CollegeOxford OX1 3BN Tel: 01865 279555 Fax: 01865 279486MAIN ENTR ANCEH O LY WPANew College Oxford: Surrounding AreaNew College Sports GroundPAS AV I L E R DM A N
East Los Angeles College - SFOP - 0114
This paper has appeared in Analysis 66 (2006), 276-280, the misprint of (N2) has been corrected in vol. 67, 268HOW NOT TO STATE THE T-SENTENCES Volker Halbach1On many accounts of truth the T-sentences or similar equivalences feature prominently.
East Los Angeles College - SFOP - 0114
Notes, Denitions and Comments on Logic for Prelims for students in their rst year before 2008/2009NOTES ON HODGESS LOGICVolker Halbach New College, Oxford version of 24 July, 2008thThis text is to be used only by candidates sitting Moderations
East Los Angeles College - SFOP - 0114
LD R O A DSavile House Warham House New College SchoolH O LY W ELNew CollegeOxford OX1 3BN Tel: 01865 279555 Fax: 01865 279486MAIN E N T R A N C E LH O LY WPANew College Oxford: Surrounding AreaNew College Sports GroundPAS AV I L E R
East Los Angeles College - SFOP - 0114
INTRODUCTION TO PHILOSOPHY SECTION A: LOGICVolker Halbach MichaelmasI thank the author of the Trinity Term paper, Andrew Bacon, and Kentaro Fujimoto for their help in preparing this sample paper. e text for formalisation in propositional logic in