Register now to access 7 million high quality study materials (What's Course Hero?) Course Hero is the premier provider of high quality online educational resources. With millions of study documents, online tutors, digital flashcards and free courseware, Course Hero is helping students learn more efficiently and effectively. Whether you're interested in exploring new subjects or mastering key topics for your next exam, Course Hero has the tools you need to achieve your goals.
3 Pages
syllabus+statistical+methods+for+the+sciences
Course: BE 260, Fall 2009School: Eckerd
Rating:
Word Count: 697
Document Preview
Methods Statistical for the Sciences: BE 260M Fall 2008 Professor: Office Hours (or by appointment): Paul Hindsley Monday: 9:00-11:00 107 SHB (Sheen B) Tuesday: 10:30-11:30 & 3:30-4:30 864-7722 (office) Wednesday: 9:00-11:00 hindslpr@eckerd.edu Thursday: 10:30-11:30 & 2:30-4:00 Friday: 10:00-11:30 Course Description: Statistical Methods for the Sciences will introduce you to the fundamentals of...
Unformatted Document Excerpt
Coursehero >> Florida >> Eckerd >> BE 260Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Methods Statistical for the Sciences: BE 260M Fall 2008 Professor: Office Hours (or by appointment): Paul Hindsley Monday: 9:00-11:00 107 SHB (Sheen B) Tuesday: 10:30-11:30 & 3:30-4:30 864-7722 (office) Wednesday: 9:00-11:00 hindslpr@eckerd.edu Thursday: 10:30-11:30 & 2:30-4:00 Friday: 10:00-11:30 Course Description: Statistical Methods for the Sciences will introduce you to the fundamentals of univariate descriptive, bivariate (and multivar...
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more.
Course Hero has millions of course specific materials providing students with the best way to expand
their education.
Below is a small sample set of documents:
Below is a small sample set of documents:
Duke - CPS - 296
Outline Query Optimization for XMLBy Jason Mchugh, Jennifer WidomDazhi Wang CPS296.1 Topics in Database SystemsBasics for Lore system Motivation Query Execution Engine Logical Query Plans Statistics and Cost Models Physical Plan Enumeration Perf
Maryland - CMSC - 132
Draft preprint for Univ. of Maryland CMSC 132, Spring 2008. May contain errors or omissions; please forward any problems or issues you find to Bill Pugh (pugh@cs.umd.edu) Please do not redistribute. After Spring, 2008, please get a copy of the book.
Duke - CPS - 296
Data mining Mining Frequent ItemsetsCPS 296.1 Topics in Database Systems Data knowledge DBMS meets AI and statistics Clustering, prediction (classification and regression), association analysis, outlier analysis, evolution analysis, etc.!Usuall
Maryland - CS - 412
IExecutable and Linkable Format (ELF)ContentsPreface1OBJECT FILESIntroduction ELF Header Sections String Table Symbol Table Relocation1-1 1-3 1-8 1-16 1-17 1-212PROGRAM LOADING AND DYNAMIC LINKINGIntroduction Program Header Program L
Maryland - CMSC - 724
CMSC 724: IntroductionAmol DeshpandeUniversity of Maryland, College ParkMarch 6, 2008TodayOverviewGrading etc. . . A crash course in why databases are needed What this class is about, What we will coverCourse Website Course Forum TA: Walaa
Maryland - CMSC - 724
CMSC724: Anatomy of a Database SystemAmol Deshpande March 11, 2008Anatomy of a Database System How is it implemented ? Issues: Overview Process Models Processes Heavyweight, context switch expensive Costly to create, limits on how many
Duke - CPS - 296
Announcements (Mar. 1) Programming with TinyOS and Tmote SkyJun Yang CPS 296.1, Spring 2007 Sensor Data Processing Reading for next Tuesday: MauveDB (review due) Next Thursday (Mar. 8): project proposal talk215 minutes per group; 20% of total gr
Duke - CPS - 296
Comparison of Geometric Spanner Construction Methods for Network ApplicationsJen Burge Geometric Optimization ProjectAbstract There are a number of applications of geometric spanners in wireless, wired and sensor networks, including decentralized l
Duke - CPS - 296
Approximation schemes for NP-hard geometric optimization problems: A surveySanjeev Arora Princeton UniversityNP-hard geometric optimization problems arise in many disciplines. Perhaps the most famous one is the traveling salesman problem (TSP): gi
Duke - CPS - 296
CPS296.2 Geometric OptimizationMarch 22, 2007Lecture 19: Well Separated Pair DecompositionLecturer: Pankaj K. Agarwal Scribe: Sharath Kumar19.1 Well Separated Point SetsLet P be a set of n points in Rd . For any parameter s 1, A, B P are sa
Duke - CPS - 196
Data Warehousing & MiningCPS 196.3 Introduction to Database SystemsData integration! Data2resides in many distributed, heterogeneous OLTP (On-Line Transaction Processing) sources" Sales, inventory, customer, " NC branch, NY branch, CA branc
Duke - CPS - 182
Prev. ChapterPrev. PageHomeNext PageNext ChapterCHAPTER 2 . Protocol Building Blocks . INTRODUCTION TO PROTOCOLS .The Purpose Protocols . The Players . Arbitrated Protocols . TABLE 2.1 Dramatis Personae . Adjudicated Protocols . Self-Enfor
Duke - CPS - 182
Prev. ChapterPrev. page Next PageHomePrevious Page Next PageNext ChapterCHAPTER 1 . Foundations . TERMINOLOGY .Sender and Receiver . Messages and Encryption . Original Plaintext b Decryption . Authentication, Integrity, and Nonrepudiati .
Maryland - CMSC - 433
CMSC433, Fall 2008 Programming Language Technology and ParadigmsJava ReviewAdam Porter 9/4/08Java Descended from Simula67, SmallTalk, others Superficially similar to C, C+ Fully specified, compiles to virtual machine machine-independent S
Maryland - CMSC - 433
CMSC 433 Programming Language Technologies and Paradigms Spring 2006Memory ManagementMemory Management in Java Local variables live on the stack Allocated at method invocation time Deallocated when method returns Other data lives on the hea
Maryland - CMSC - 433
Do you wish you could hear the audio and read the transcription of this session?Then come to JavaOneSM Online where this session is available in a multimedia tool with full audio and transcription synced with the slide presentation. JavaOne Online o
Maryland - CMSC - 433
12/11/08112/11/08212/11/08312/11/08412/11/08512/11/08612/11/08712/11/08812/11/08912/11/081012/11/081112/11/081212/11/081312/11/081412/11/081512/11/081612/11/081712/11/081812/11/0
Duke - CPS - 004
What is a program? What is code?Instructions in a language a computer executes Languages have different characteristics, strengths, weaknesses Scheme, BASIC, C+, Fortran, Java, Perl, PHP, Computer executes one instruction at a time Memory and state
Eckerd - AR - 102
DRAWING ASSIGNMENT 8 DUE NOV 18 For this week we will use the gray paper and white charcoal in addition to black charcoal pencil, stump and eraser. If you need new stumps or erasers let me know. (Dedicate a stump to white only!) We have some thin but
Eckerd - IA - 200
THIRD WEEK OF ASSIGNMENTS / Theatre / Movement / and Performance Art VIEWING / READING ASSIGNMENTS of performance works FOR WEEK 3: at http:/www.ubu.com MARINA ABRAMOVIC : Balkan Baroque (in its entirety, about an hour) GILBERT & GEORGE: The Ten Comm
Eckerd - AR - 102
DRAWING ASSIGNMENT 6 DUE MARCH 31 NOTE: THIS ASSIGNMENT TAKES US PAST SPRING BREAK. YOU HAVE NINETEEN DAYS TO ACCOMPLISH THESE DRAWINGS. DO NOT BEGIN THE NIGHT BEFORE THEY ARE DUE! THE ASSIGNMENT BELOW IS A DOUBLE ASSIGNMENT, 4 DRAWINGS TOTAL. 11 HRS
Eckerd - AR - 102
DRAWING ASSIGNMENT 6, DUE APRIL 1ST NOTE: THIS ASSIGNMENT TAKES US PAST SPRING BREAK. YOU HAVE 3 WEEKS TO ACCOMPLISH THESE DRAWINGS. DO NOT BEGIN THE NIGHT BEFORE THEY ARE DUE! THE ASSIGNMENT BELOW IS A DOUBLE ASSIGNMENT, 4 DRAWINGS TOTAL. 11 HRS MIN
Duke - CPS - 004
Review of JavaClasses are object factories Encapsulate state/data and behavior/methods Ask not what you can do to an object, but what A program is created by using classes in libraries provided and combining these with classes you design/implement
Duke - CPS - 004
What is a program? What is code?Instructions in a language a computer executes Languages have different characteristics, strengths, weaknesses Scheme, BASIC, C+, Fortran, Java, Perl, PHP, Computer executes one instruction at a time Memory and state
Duke - CPS - 004
FOCUS COMPSCI 004G The Genome Revolution and its Impact on SocietyOwen Astrachan http:/www.cs.duke.edu/courses/cps004g/fall05 http:/www.cs.duke.edu/~olaGenome Revolution: COMPSCI 004G1.1Where are we going?What is computer science? What is bio
Duke - CPS - 004
Printed by Owen L. Astrachan Oct 12, 05 13:14import java.net.*; import java.util.*; import java.io.*;5 75NameDataRetriever.javaPage 1/3Oct 12, 05 13:14NameDataRetriever.javaPage 2/3import javax.swing.text.MutableAttributeSet; import jav
Duke - CPS - 004
jn m v gh ur s dxqeo RcXtcr n m o d i y dxql p4ufxriRh n m l j d i y dx6j k4ufxriRh f y f Hrdbrq xub g efdfyxteuqs)fdrHufAxteb HH4wexrwv b t q i f i yi ti g sqi puterph gf db e"eca ` UYWUS 5& P I GE UVCBXVT)RQ)& HFD ( 7 @87532 0 (& $ CBA96641)'%#
Duke - CPS - 004
Printed by Owen L. Astrachan Oct 31, 05 13:14RegExModel.javaPage 1/1Oct 31, 05 13:14import java.util.regex.*; public class RepeatFinder {5RepeatFinder.javaPage 1/1import java.util.*; import java.util.regex.Matcher; import java.util.rege
Maryland - CMSC - 132
CMSC 132: Object-Oriented Programming IIHeaps & Priority QueuesDepartment of Computer Science University of Maryland, College ParkOverviewBinary treesFull, Perfect, CompleteHeapsInsert getSmallestHeap applicationsHeapsort Priority queues
Duke - CPS - 6096
6.096 Algorithms for Computational BiologyProfessor: Manolis KellisProblem Set 1InstructionsThis problem set is due in lecture on Friday March 4th, 2005. For problems with a programming component, the algorithms should be implemented using pyt
Duke - CPS - 004
PROBLEM 2 :(I've got a URL Jones (20 points)Each URL on the world-wide web has a corresponding Internet Protocol (IP) address. For example, the IP address of www.duke.edu is 152.3.233.20. The table below shows some URLs and the corresponding IP a
Duke - CPS - 004
Review of JavaClasses are object factories Encapsulate state/data and behavior/methods Ask not what you can do to an object, but what A program is created by using classes in libraries provided and combining these with classes you design/implement
Duke - CPS - 004
Printed by Owen L. Astrachan Nov 04, 05 12:54import java.util.regex.*; public class RepeatFinder {5RepeatFinder.javaPage 1/1Oct 24, 05 12:36public class RepeatCount {5RepeatCount.javaPage 1/4public String dna = "ATGGCGGAGTCTTCGGATAAGC
Duke - CPS - 004
hn l k ef ro p Smcj fasqao n l k h b g u Smcj i5rdSFgfe dw u d xF`Fi Sr` d duSqcrip)dbFxwrdBSqc` xwx5vtcSFts ` q i g yv d g ug qg e pig hrqcFhf ed b` c"caY X WR TRP 6& H G&9 WDDVUSQFIF)F& E ( 8 A98642 0 (& $ DCB@77531)'%# ! " j u p i
Duke - CPS - 004
Compsci 004g, Fall 2005, Code Practicehttp:/www.cs.duke.edu/courses/cps004g/fall05/class/proteinpractice.htmlCompsci 004g, Fall 2005, Code PracticeThese question are based on the code in the class ProteinTools.java. You'll want to study the meth
Duke - CPS - 004
Storing and Retrieving ValuesRead words from a file and store them somewhere Dictionary of words to analyze in English All dimers in a DNA sequence All occurrences of TATA in All words that have 'e' before 'I' We don't want to print, we want to sto
Maryland - CMSC - 132
CMSC 132: Object-Oriented Programming IIObject-Oriented Programming IntroDepartment of Computer Science University of Maryland, College Park1Object-Oriented Programming (OOP)Approach to improving softwareView software as a collection of objec
Maryland - CMSC - 132
CMSC 132: Object-Oriented Programming IIProgram Correctness, ExceptionsDepartment of Computer Science University of Maryland, College ParkOverviewProgram correctness is determined by the presence / absence of program defects (errors) IssuesTyp
Maryland - CMSC - 132
CMSC 132: Object-Oriented Programming IICollection Abstractions & Java CollectionsDepartment of Computer Science University of Maryland, College ParkCollectionPrograms represent and manipulate abstractions (chunks of information)Examples: rost
Maryland - CMSC - 132
CMSC 132: Object-Oriented Programming IILinear Data StructuresDepartment of Computer Science University of Maryland, College ParkOverviewLinear data structuresGeneral propertiesImplementationsArray Linked listRestricted abstractionsStack
Maryland - CMSC - 132
CMSC 132: Object-Oriented Programming IIGeneric ProgrammingDepartment of Computer Science University of Maryland, College ParkGeneric ProgrammingGeneric programmingDefining constructs that can be used with different data types I.e., using same
Maryland - CMSC - 132
CMSC 132: Object-Oriented Programming IIJava I/O OverviewDepartment of Computer Science University of Maryland, College Park1Input/OutputApproaches to store file dataText files Data represented in human-readable formExample: Java source pr
Maryland - CMSC - 132
CMSC 132: Object-Oriented Programming IIA Trick to Simplify List ImplementationDepartment of Computer Science University of Maryland, College Park1Typical List ImplementationClass List { Node head; } Class Node { Object value; Node next; }2
Maryland - CMSC - 132
CMSC 132: Object-Oriented Programming IISoftware DevelopmentDepartment of Computer Science University of Maryland, College Park1Modern Software DevelopmentWhy do we want to study the software development process?To understand Software develo
Maryland - CMSC - 132
CMSC 132: Object-Oriented Programming IISoftware Process ModelsDepartment of Computer Science University of Maryland, College Park1OverviewSoftware process modelsWaterfall IterativeChoosing a software process modelLevel of understanding C
Maryland - CMSC - 132
CMSC 132: Object-Oriented Programming IIProgram TestingDepartment of Computer Science University of Maryland, College ParkProgram TestingEmpirical testingTest software with selected test cases More scalable than verification Test failures freq
Maryland - CMSC - 132
CMSC 132: Object-Oriented Programming IIObject-Oriented DesignDepartment of Computer Science University of Maryland, College ParkApplying Object-Oriented Design1.Look at objects participating in system Find nouns in problem statement (require
Maryland - CMSC - 132
CMSC 132: Object-Oriented Programming IIUnified Modeling Language (UML)Department of Computer Science University of Maryland, College ParkUML (Unified Modeling Language)UML is a modeling language forSpecifying Visualizing Constructing Document
Duke - CPS - 004
What does this position entail?qDo you want to build quantitative models millions of people will use, based on data from the world's largest online laboratory? Are you passionate about formulating relevant questions and producing solutions to init
Maryland - CMSC - 411
Administrivia CMSC 411 Computer Systems Architecture Lecture 12 Memory HierarchyAlan Sussman als@cs.umd.edu l @ d d Homework #3 due Thursday Read Appendix C of H&P Wanli's office hours have changed new one on class home pageCMSC 411 - 12 (some
Maryland - CMSC - 411
Administrivia CMSC 411 Computer Systems Architecture Lecture 13 Memory Hierarchy (cont.)Alan Sussman als@cs.umd.edu l @ d d Homework #3 due today Finish reading Appendix C of H&P, start reading H&P Ch. 5, but only up through 5.3 for nowCMSC 411
Maryland - CMSC - 411
Administrivia CMSC 411 Computer Systems Architecture Lecture 14 Memory Hierarchy (cont.)Alan Sussman als@cs.umd.edu l @ d d Homework #4 posted Project out soon Finish reading Ch. 5, at least through 5.3CMSC 411 - 14 (some from Patterson, Sussma
Maryland - CMSC - 411
Administrivia Homework #4 postedCMSC 411 Computer Systems Architecture Lecture 15 Memory Hierarchy (cont.)Alan Sussman als@cs.umd.edu l @ d d due date posted after todays lecture today s Project out by tomorrow Finish reading Ch. 5CMSC 411
Maryland - CMSC - 828
ContentsComposition SystemsS. Geman, D.F. Potter, Z. ChiIntroduction Example: On-line Character Recognition OnComposition Systems From MDL to Compositional Measures Recognition of Scenes in ImagesPresented by Haibin Ling 12. 2. 2003Introduct
Maryland - CMSC - 828
Announcements See Chapter 5 of Duda, Hart, and Stork. Tutorial by Burge linked to on web page. "Learning quickly when irrelevant attributes abound," by Littlestone, Machine Learning 2:285-318, 1988.Supervised Learning Classification with labele
Duke - CPS - 116
Data Warehousing and Data MiningCPS 116 Introduction to Database SystemsAnnouncements (December 4)Homework #4 will be graded over this weekendSample solution available on Thursday2Remember your project demo slot! Final exam next Saturday, De
Duke - CPS - 004
Bioinformatics VocabularyWhat does DNA (data) look like?Processing, analyzing, experimenting with data Where does the data come from? How do we get it? What does it mean? What do we do with it? From nucleotide to protein to gene Identifica
Duke - CPS - 004
Regex Practice: CPS 004GOwen Astrachan October 25, 2007Name: Login: Honor code acknowledgment (signature)1PROBLEM 1 :(Being Regular with Regex (22 points)Part A (4 points) We used a program in class that processed regular expressions and l
Duke - CPS - 004
Printed by Owen L. Astrachan Oct 07, 05 12:41ProteinTools.javaPage 1/2Oct 07, 05 12:4175ProteinTools.javareturn aminoAcidArray[k];Page 2/2510/* * Convert codon to amino acid and viceversa. This * class provides static methods to get
Duke - CPS - 004
"Harder, Better, Faster, Stronger" -Daft Punk Work It Make It Do It Makes Us Harder Better Faster Stronger More Than Hour Our Never Ever After Work is Over [x2] Work It Harder Make It Better Do It Faster, Makes Us stronger More Than Ever Hour After O
Duke - CPS - 004
David HausslerFrom 1997 Computer Science Professor to 2006 Professor of Biomolecular Engineering, HHMI Investigator, Member NAS Differences? UCSC Genome Browser Web-based genome microscope Encode All parts of human genome crucial to biological