Course Hero - We put you ahead of the curve!

You have requested the below document.

Coursehero >> Texas >> Texas >> MANIMALAJC 042

by Copyright Joseph Chacko Manimala 2004 The Dissertation Committee for Joseph Chacko Manimala Certifies that this is the approved version of the following dissertation: SELEX: A Tool to Study the Sequence Specific Molecular Recognition of Single Stranded Nucleic Acids Committee: Eric V. Anslyn, Supervisor Andrew D. Ellington, or Co-Supervisor Karen S. Browning David W. Hoffman Brent L. Iverson Sean M. Kerwin SELEX: A Tool to Study the Sequence Specific Molecular Recognition of Single Stranded Nucleic Acids by Joseph Chacko Manimala, B.S Dissertation Presented to the Faculty of the Graduate School of The University of Texas at Austin in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy The University of Texas at Austin May, 2004 Dedication I would like to dedicate this work to my family and friends, especially my parents and my brother Jimmy for all their support, encouragement, and expectations. More than anyone, I want to dedicate this to my sister Annie. Without you, none of this would have been possible. You have been there for me and supported me through out the years, ever since I was a little boy. Thus, all my accomplishments and achievements are also yours. Acknowledgements There are so many people who influenced me in my life in developing my interest in the sciences. However, no one played a bigger role than the educators and advisors in the grade school and in college. I want to thank my high school science teachers Mr. Panko and Ms. Picken for their tutelages and encouragements. I am most thankful to my advisors Eric and Andy for welcoming me into their groups and for all their advising and directions. It was a very challenging experience for me to be part of two completely different groups and I am sure it was also challenge for the two of you. However, I am very thankful that you welcomed the idea. I have earned a lot of knowledge and gained numerous skills. I want to thank you for allowing me to be independent and take on research projects that were not the "mainstream projects" in either research groups. It allowed me to learn not only numerous scientific skills, but also problem solving skills and collaboration skills. They say that when you join a research group, you pattern your character around that of your advisors'. Being part of the groups of two successful and well respected advisors in their respective fields, not only allowed me to pick up scientific knowledge, but also valuable life lessons. Last, but not least, I want to thank both the Anslyn and Ellington research groups for all their support. Without their scientific advice, none of it would have been possible. v SELEX: A Tool to Study the Sequence Specific Molecular Recognition of Single Stranded Nucleic Acids Publication No._____________ Joseph Chacko Manimala, PhD The University of Texas at Austin, 2004 Supervisors: Eric V. Anslyn and Andrew D. Ellington Recently, understanding the sequence specific molecular recognition between nucleic acids and small molecules has been a topic of high interest, mainly due to the role of nucleic acids as drug targets. The development of systematic evolution of ligands by exponential enrichment or SELEX has been a great tool to study the interactions between nucleic acids and small molecules. The research presented herein is aimed toward deciphering these molecular recognition behaviors of RNA and ssDNA. Chapter 1 provides an introduction to the importance of the studies, SELEX and its use, and the structural basis of recognition. Chapter 2 details our findings of the comparisons and contrast of molecular recognition tendencies of ssDNA and RNA using aminoglycosides as our ligands. In chapter 3, we report tuning the specificity of a synthetic receptor using a selected aptamer. Finally, in chapter 4, our progress toward the development of amino acid nucleic acid interaction database is detailed. vi Table of Contents List of Tables ......................................................................................................... xi List of Figures ....................................................................................................... xii List of Schemes......................................................................................................xv Chapter 1 Introduction and Background.................................................................1 1.0 Introduction ..............................................................................................1 1.1 Tools for Understanding Sequence Specific Molecular Recognition......5 1.1.1 Traditional Method .......................................................................5 1.1.2 Modification of Nucleic Acid Binding Natural Products............6 1.1.2.1 Functional Group Modifications..............................6 1.1.2.1.1 Ammoniums vs. Hydroxyls...........................6 1.1.2.1.2 Addition of Functionalities..........................10 1.1.2.1.3 Ammoniums vs. Guanidiniums.....................11 1.1.2.2 Monomeric vs.Dimeric...................................... .13 1.1.2.3 Phenanthridine Derivatives.............................................15 1.1.3 SELEX....................................................................16 1.1.3.1 In Vitro Selection..............................................17 1.1.3.1.1 Target Immobilization.............................. 18 1.1.3.1.2 Pool Synthesis........................................20 1.1.3.1.3 Primers................................................23 1.1.3.1.4 The Art of Selection.................................23 1.1.3.1.4.1 Target.........................................24 1.1.3.1.4.2 Buffer Conditions...........................24 1.1.3.1.4.3 Competitors..................................24 1.1.3.1.4.4 Equilibration.................................24 1.1.3.1.4.5 Pool : Target Ratio..........................25 1.1.3.1.4.6 Matrix Binding..............................25 1.1.3.1.4.7 Stringency....................................25 vii 1.1.3.2 RNA SELEX...................................................26 1.1.3.3 ssDNA SELEX................................................27 1.2 The Structural Basis of Recognition..........................................27 1.2.1 Primary Structures.....................................................27 1.2.2 Secondary and Tertiary Structures.................................. 29 1.2.3 Molecular Recognition at a Structural Level.......................37 1.2.3.1 Three - Dimensional Structural Analysis..................38 1.2.3.1.1 The ATP Aptamer....................................38 1.2.3.1.2 The Tobramycin Aptamer...........................39 1.2.3.1.3 The Neomycin Aptamer.............................40 1.2.3.1.5 The Streptomycin Aptamer.........................42 1.2.3.1.5 The Theophylline Aptamer.........................43 1.2.3.1.6 Aptamers Against Aromatic Compounds........ 44 1.2.3.1.7 Aptamers Against Positively Charged Amino Acids.................................................. 46 1.2.3.1.8 Aptamers Against Peptides........................ 48 1.2.4 Molecular Dynamics Studies........................................ 53 1.3 Binding Affinity Measurements............................................. 53 1.3.1 Fluorescence Anisotropy.............................................54 1.3.2 Miscellaneous Fluorescence Methods..............................54 1.3.3 Surface Plasma Resonance...........................................55 1.3.4 Colorimetric Assay....................................................55 1.3.5 Mass Spectrometry....................................................56 1.4 Sequence Specific Molecular Recognition in Action: Aptamers in Chromatography...........................................................57 1.5 Aptamers as Pharmaceuticals.................................................60 1.6 Current Status of SELEX......................................................62 1.7 Summaries and Outlook........................................................67 1.8 References.......................................................................68 Chapter 2 In Vitro Selection and Analysis of Aminoglycoside Aptamers to Understand Sequence Specific Molecular Recognition.......................90 viii 2.0 Introduction.....................................................................90 2.1 Roles of Aminoglycosides in Living Systems.............................91 2.1.1 Aminoglycosides in Protein Synthesis.............................91 2.1.2 Aminoglycosides in Ribozyme Inhibition.........................94 2.1.3 Other Roles of Aminoglycosides in RNA Binding...............96 2.2 Mode of Aminoglycoside Binding...........................................96 2.2.1 Types of Interactions.................................................99 2.2.2 Aminoglycoside - Aptamer Interactions.........................100 2.3 Fluorescence: A Tool to Measure Equilibrium Constants..............100 2.4 Results.........................................................................101 2.4.1 Kanamycin A : RNA SELEX......................................102 2.4.2 Kanamycin A : ssDNA SELEX....................................107 2.4.3 Tobramycin : ssDNA SELEX......................................113 2.5 Discussion.....................................................................118 2.6 Summaries and Future Outlook.............................................121 2.7 Materials and Methods.......................................................121 2.8 References.....................................................................127 Chapter 3 Tuning the Specificity of a Synthetic Receptor Using an Aptamer ....134 3.0 Introduction...........................................................................................134 3.1 Natural Receptors..................................................................................135 3.2 Synthetic Receptors............................................................136 3.2.1 Origin of Binding in Synthetic Receptors.........................136 3.2.2 Low Specificity in Synthetic Receptors...........................137 3.3 In - Line Assays...............................................................140 3.4 Experimental Design..........................................................142 3.5 Results and Discussion........................................................143 3.6 Summaries and Future Outlook............................................. 156 3.7 Materials and Methods........................................................156 3.8 References......................................................................160 Chapter 4 Towards the Development of an Amino Acid - Nucleotide Interaction Database.............................................................................165 ix 4.0 Introduction.....................................................................165 4.1 Guanidiniums..................................................................167 4.1.1 Guanidiniums in Proteins............................................167 4.1.2 Guanidiniums as Pharmaceutical Agents..........................168 4.1.3 Guanidiniums in Molecular Recognition..........................169 4.1.4 Other Uses of Guanidiniums........................................169 4.2 Synthesis of Guanidiniums...................................................169 4.2.1 Guanidiniums through Solid Phase Combinatorial Chemistry..169 4.2.2 Guanidiniums from Thiourea........................................170 4.2.2.1 The Synthesis.................................................170 4.2.2.2 Protecting Groups for the Thiourea........................171 4.2.2.2.1 A Novel Protecting Group for the Synthesis of Guanidiniums....................................172 4.3 Synthesis of Target 4.1........................................................175 4.4 Automated Selection Against 4.1...........................................178 4.5 A New Modified Target......................................................180 4.5.1 A New Scheme for the Synthesis of 4.29.........................182 4.6 Summaries and Future Outlook.............................................184 4.7 Materials and Methods.......................................................185 4.8 References.....................................................................194 Bibliography ........................................................................................................202 Vita.................................................................................................................237 x List of Tables Table 1.0: Table 1.1: Table 1.3: Table 1.4: Table 2.1: Table 2.2: Table 2.3: Table 3.1: Table 3.2: Table 4.1: Table 4.2: Binding Affinities .............................................................................10 Binding Affinities...........................................................13 Binding Affinities...........................................................15 Binding Affinities...........................................................16 Kd Values for the RNA Aptamers against Kanamycin A............106 Kd Values for the ssDNA Aptamers against Kanamycin A.........113 Kd Values for the ssDNA Aptamers against Tobramycin............118 Kd Values for 3.12 with Various Analytes.............................143 Kds for the Aptamers Under Various Conditions.....................152 The Yield of Various Guanidines.......................................174 The Deprotection Yields of Guanidines 4.8...........................175 xi List of Figures Figure 1.0: The Traditional Method ......................................................................5 Figure 1.1: Some Naturally Occurring Aminoglycosides and their Derivatives...9 Figure 1.2: Secondary Structure of Hammerhead 16 Ribozyme...................10 Figure 1.3: Structures of Modified Kanamycin Family Aminoglycosides........12 Figure 1.4: Structures of Modified Neomycin Family Aminoglycosides.........13 Figure 1.5: SELEX........................................................................17 Figure 1.6: RNA SELEX................................................................27 Figure 1.7: Strand Separation...........................................................29 Figure 1.8: Primary Structures of Nucleic Acids.....................................31 Figure 1.9: Base Pairs....................................................................32 Figure 1.10: Schematics of Some RNA Secondary Structures.......................34 Figure 1.11: Structure of T. Thermophila Group I Intron P4 - P6 Domain.........35 Figure 1.12: Some RNA Tertiary Structures...........................................35 Figure 1.13: A-Minor Motif..............................................................36 Figure 1.14: The Minor Groove RNA Triplex in a Pseudoknot.....................36 Figure 1.15: ATP - Aptamer Complex..................................................39 Figure 1.16: Tobramycin - Aptamer Complex.........................................40 Figure 1.17: Tobramycin and Neomycin Aptamers...................................41 Figure 1.18: Neomycin - Aptamer Complex..............................................42 Figure 1.19: Aptamer - Streptomycin Complex........................................43 Figure 1.20: Theophylline - Aptamer Complex........................................44 Figure 1.21: Aptamer - Flat Aromatic Ligand Complexes...........................46 Figure 1.22: Molecular Recognition of Basic Amino Acids.........................48 xii Figure 1.23: The RNA Aptamer Bound Conformation of an Arginine - Rich Peptide......................................................................51 Figure 1.24: A Dye - Displacement Scheme for Aptamers..........................56 Figure 1.25: Catalytic DNA Biosensor.................................................67 Figure 2.1: The Secondary Structure of the A-site RNA...........................93 Figure 2.2: The Three - Dimensional Model of the td Intron bound to Neomycin B................................................................95 Figure 2.3: NMR Solution Structures of the E. Coli Decoding Site of the 16S rRNA..................................................................99 Figure 2.4: Binding Assay for the Rounds Kanamycin A - RNA SELEX......102 Figure 2.5: Aptamer Families and their Sequence Analysis......................103 Figure 2.6: Possible Secondary Structures of Selected RNA Aptamers Against Kanamycin A....................................................104 Figure 2.7: Binding Assay for the Clones Isolated from the RNA Selection Against Kanamycin A....................................................105 Figure 2.8: Titration Curves for Clone 1 Aptamer against Kanamycin A.......106 Figure 2.9: Curve Fitting of Normalized Fluorescence Intensity.................106 Figure 2.10: The Binding Assay for the Rounds of ssDNA Selection against Kanamycin A..............................................................108 Figure 2.11: The ssDNA Aptamer Families Against Kanamycin A...............108 Figure 2.12: Possible Secondary Structures of ssDNA Aptamers against Kanamycin A..............................................................109 Figure 2.13: Binding Assays for Various ssDNA Aptamers against KanamycinA..............................................................110 Figure 2.14: Curve Fittings for the ssDNA Aptamers against Kanamycin A.....113 xiii Figure 2.15: The Binding Assay for the Rounds of ssDNA Selection against Tobramycin................................................................114 Figure 2.16: The Sequences of ssDNA Aptamers against Tobramycin...........114 Figure 2.17: Possible Secondary Structures of ssDNA APtamers against Tobramycin................................................................115 Figure 2.18: Binding Assay for ssDNA Aptamers against Tobramycin...........116 Figure 2.19: Curve Fittings for the Tobramycin ssDNA Aptamer Titrations.....118 Figure 3.1: A Schematic Diagram of the Ternary Complex.......................135 Figure 3.2: The Binding Assay for Different Rounds..............................145 Figure 3.3: The Families of Sequences Resulted from the selection.............146 Figure 3.4: Possible Secondary Structures of Some of the Selected Clones....147 Figure 3.5: The Binding Assay of the Families.....................................148 Figure 3.6: Assay for the Effect of [MeOH] on Ligand Binding.................149 Figure 3.7: The Effect of Various Solvents on Ligand Binding..................150 Figure 3.8: Fluorescence Measurements with Clone #5 Under Various Conditions..................................................................151 Figure 3.9: The In - Line Assay Results of Clone #5...............................154 Figure 3.10: The Effect of Incubation Times on Cleavage Patterns...............155 Figure 4.1: The Primary Amines that were Coupled to the Thiourea............174 Figure 4.2: Automated Selection Scheme............................................179 Figure 4.3: Families from the Automated Selection against 4.1..................180 xiv List of Schemes Scheme 2.1: Scheme 2.2: The Process of Biotinylation.....................................................123 The Direct Coupling of the Aminoglycoside to the glyoxal Agarose Beads ..........................................................................124 Scheme 3.1: Scheme 3.2: Scheme 4.1: Scheme 4.2: Scheme 4.3: Scheme 4.4: Scheme 4.5: Scheme 4.6: The Phosphodiester Bond Cleavage................................140 Immobilization of the Receptor on Agarose....................... 142 General Scheme for the Synthesis of Secondary Guanidiniums.171 Guanidinium Synthesis w/ Ethyl Carbamate Protecting Group 173 The Synthesis of the Synthetic Peptide..............................177 Cleavage and Deprotection of the Synthetic Peptide..............178 The Synthesis Target with Two Parallel Linked Guanidiniums..182 Alternative Synthetic Scheme for the Modified Target...........184 xv CHAPTER 1: INTRODUCTION AND BACKGROUND 1.0 INTRODUCTION The processes of recognition and binding of ligands to nucleic acids are very crucial in sustaining homeostasis. Even with all the scientific breakthroughs, we are unable to foresee with great accuracy if two molecules can bind to each other. It has been long known that numerous drug compounds interact with nucleic acids. The eventual goal of most medicinal-synthetic chemists is to see the compound they have synthesized become a drug for the treatment of diseases. Often, even with the modern scientific technology, the compound that was synthesized doesn't pass the first biological activity assay. The structure- activity relationships of binding in general are not very well understood, let alone sequence specific molecular recognition. Understanding the interactions between small molecules and sequences of RNA and DNA is pivotal to the development of novel drug candidates. How does the drug adapt to the nucleic acid target (and vice versa)? How do nucleic acid structures affect ligand binding? How do small molecules read the genetic information (DNA and RNA Binders)? Answering these questions not only fulfills our scientific curiosity, but also allows us to create better DNA/RNA binders. Being able to predict such bindings will revolutionize pharmaceutical and bioorganic chemistry.1 In this introduction, we will look at the role of molecular recognition by single stranded nucleic acids in living systems. We will also 1 look at the different levels of molecular recognition by RNA and ssDNA. These include general overall molecular recognition, sequence specific molecular recognition, and finally molecular recognition at a structural level. Then, the process of SELEX is given an up-close look and some of the applications of aptamers are detailed. The role of aptamers in analytical chemistry, and in pharmaceutical industry is detailed along with some up to date use of SELEX. The quest to understand the sequence specific interactions between drugs and DNA dates back more than 40 years.2 For example, in the 1960's actinomycin D, an antibiotic, was found to be a selective inhibitor of transcription. It was known as one of the best anticancer agent in chemotherapy, and was discovered to be a selective inhibitor of transcription by its specific inhibitory action on RNA polymerase.2 These finding were credited to the tight but reversible binding of actinomycin to double stranded DNA template.3 On the other hand, the effort to understand sequence specific interactions between small molecules and RNA didn't start until recently. RNA is not only a carrier of genetic code, but it is also involved in a range of biological processes, such as chemical catalysis and information storage. Cellular RNAs form ordered secondary and sometimes tertiary structures, creating binding pockets for other cellular components. Sequence specific molecular recognition of RNA often precedes catalytic events that are essential to a wide range of cellular activities, such as initiation of DNA replication,4 extension of the telomeric regions of chromosomes,5 splicing of pre-mRNA,6 and iron chelation.7 RNA is also the primary genome for most pathogenic viruses.8 Therefore, molecular recognition of RNA plays important roles in gene expression and viral invasion. 2 The gene expression depends upon the recognition events and catalytic activities of RNA- protein complexes. Ribosomal RNA (rRNA) accounts for about 80% of total cellular RNA. They provide both the recognition motifs and catalytic scaffold needed for protein translation.9 The key step of translation occurs at the ribosomal A site, where the recognition between codon of mRNA and anticodon of tRNA take places. Upon the correct recognition, the ribosome's peptidyltransferase activity catalyzes the formation of a new peptide bond between the amino acid charged tRNA in the A-site and the growing protein chain on the tRNA in the P- site. Recent studies have shown that peptidyltransferase active site is entirely composed of rRNA.10 A single, unusually basic adenosine may be the key player in the mechanism of peptidyl transfer.11,12 The most common soluble RNA is tRNA, since they lack associated proteins and they are about 15% of total cellular RNA. The binding of tRNA to the ribosomal A- site is mediated through extensive RNA- RNA interactions, such as rRNA- tRNA, and mRNA- tRNA. Through these and other important interactions, the ribosome can distinguish the relatively small energetic differences between cognate and non-cognate codon- anticodon pairing to achieve an astounding fidelity of translation (over 99.9% accuracy).13 The transport, translation efficiency, and stability of individual messenger RNAs are controlled by numerous protein- RNA, ribonucleoprotein- RNA, and RNA- RNA interactions.14-16 Upon transcription from DNA, ribonucleoprotein complexes called splisosomes excise the introns from pre-mRNA and from other heterogeneous RNAs. Some organisms are capable of intron excision (splicing) without protein assistance, and provided the first examples of RNA enzymes or ribozymes.17 The translational efficiency of individual mRNAa is regulated at many levels, including the binding of the 3 5' and 3' untranslated regions (UTRs) of the mRNA by proteins,18 microRNAs,19 and even small molecules.20 The ability of small organic molecules to regulate gene expression in vivo has recently been illustrated in the context of an artificial gene construct.20 An RNA aptamer located in the 5' UTR region of an mRNA, has been shown to inactivate translation of a downstream open reading frame upon the binding of its cognate small molecules. The mechanism proposed for translation inactivation involves the structural rearrangement of the aptamer into a rigid RNA- small molecule complex that cannot be correctly scanned by the ribosomal pre-initiation machinery. Over 65% of the known families of viruses use RNA for primary genome and cause many of the modern-day plagues, such as AIDS, cancer, hepatitis, smallpox, ebola, and influenza.21 Approximately, 42% of the human genome is composed of transposable elements that multiply by reverse transcription, using an RNA intermediate similar to that of a retrovirus.22 There exist numerous examples of small molecule- RNA binding in natural systems. The folding and the formation of the secondary structures depend upon the binding of divalent metal ions, especially Mg++. Mg++ binding affinities range from 0.01 mM through 10 mM in the presence of 0.1-0.2 M of monovalent ions.23,24 The Mg++ induced folding of the Tetrahymena thermophila group 1 intron has become an important paradigm for RNA folding.25-27 In the absence of Mg++ it adopts flexible structures dominated by duplex regions that are interrupted by internal bulges and stem loops. This secondary structure can largely be predicted from its nucleotide sequence using basepairing and nearest neighbor rules.28-30 Upon Mg++ binding, it collapses into a more rigid, 4 enzymatically active, tertiary structure with fewer available conformations. In at least one region of the group 1 intron, Mg++ binding induces a rearrangement of the RNA secondary structure itself.31 1.1 TOOLS FOR UNDERSTANDING SEQUENCE SPECIFIC MOLECULAR RECOGNITION We have looked at the roles of binding interactions of single stranded nucleic acids (especially RNA) in sustaining homeostasis. Now, we will examine the ways to study these interactions. There are two ways to study molecular recognition between nucleic acids and small molecules. The first one is the traditional method, commonly used by medicinal chemists (Figure 1.0). It is also a "trial and error" method that gives very little information into sequence specific molecular recognition. Library of related compounds Binding studies with a selected RNA Select the compound that binds and study the interactions Figure 1.0: The Traditional Method. In this method a library of compounds are screened for their binding abilities toward a given nucleic acid. 1.1.1 Traditional Method Figure 1.0 illustrates the traditional method to understanding molecular recognition between nucleic acids and other molecules. This method is widely used in pharmaceutical industry and it is more of a "hit or miss" process. In this case a library of lead compounds are synthesized and tested for their efficacy by carrying out binding 5 studies against a target nucleic acid which is usually of high medicinal interest. The interactions between the best binding member of the library and the nucleic acid target can then be further studied. This can shed some light into the molecular recognition of nucleic acids, but this method is a very "relative" method in that it picks out only a member of the library of choice that has the best binding tendencies toward the nucleic acid target. In other words, there might be another compound that has a better binding affinity and/or specificity for the particular nucleic acid target of interest that is not a member of the chosen library. 1.1.2 Modification of Nucleic Acid Binding Natural Products The traditional method of understanding the sequence specific interactions between nucleic acids and small molecules revolves mainly around the modification of natural products that are known to bind nucleic acids and evaluating that effect on binding. One of the common methods to isolate high affinity ligands for nucleic acids is through modification of existing natural products that are already known to bind RNA or DNA for improved binding. This method is useful in identifying lead compounds in medicinal chemistry. Functional group modifications and addition of functionalities are some of the modifications that are commonly carried out. 1.1.2.1 Functional Group Modifications Aminoglycoside functional groups have been modified to test their effect on nucleic acid recognition. Here, we will look at some of these studies. 1.1.2.1.1 Ammoniums Vs. Hydroxyls Wang and coworkers studied the importance of electrostatic interactions for binding aminoglycosides to RNA. They wanted to study the role of hydroxyl groups in 6 binding as well as the effect on binding affinity if the hydroxyl groups were replaced with amino groups (Figure 1.1).35-39 The effect of aminoglycosides and their derivatives on the cleavage rate of the hammerhead ribozyme was investigated at pH 7.3 in the presence of Mg++ (Figure 1.2). The cleavage rates of the ribozyme in the presence of various aminoglycosides and their derivatives are shown in Table 1.0. The removal of hydroxyl groups slowed down the ribozyme cleavage indicating a tighter binding with the RNA. It was proposed that the deoxygenated aminoglycoside antibiotics may be stronger RNA binders due to an increased basicity of the neighboring amino groups, since the basicity of ethylamine (pKa = 10.7) to ethanolamine (pKa = 9.5) indicates that the vicinal hydroxyl lowers the basicity of the amine by more than one pKa unit.40 The most potent binders were the deoxygenated aminoglycoside derivatives lacking the secondary hydroxyl groups (Table 1.0). The 4'-OH is part of a 3-aminopropanol fragment and is likely to interact with the primary 6'-amino group. The 4"- and 2"-hydroxyls are vicinal to the 3"-amino group. Additionally, the 2"-OH is within an H-bonding distance from the 1-amino group on the 2-deoxystreptamine ring. Therefore, removal of the 4"- hydroxyl (2 vs. 5 in Figure 1.1) may enhance the basicity of the neighboring amine group while deoxygenation of the 2"- hydroxyl may affect two amino groups simultaneously causing the 2"-deoxytobramycin (6 in Figure 1.1) to be a superior inhibitor. The 6"hydroxyl (2 vs. 4 in Figure 1.1) is remote to any amino group, and its removal has no effect on RNA binding.40 The amine groups and hydroxyl groups of aminoglycosides are shown to interact with the nucleic acid backbone and/or with the heterocyclic bases. It is known that the aminomethyl groups (-CH2NH2) in various aminoglycosides are more basic (pKa 8.6 7 9.0) than the other primary amines (pKa 6.2 - 8.1).32-34 Thus, they have decided to modify the hydroxyls at position 6" in kanamycin A and tobramycin, and position 5" in neomycin B into ammoniums. Aminoglycosides containing four amino groups show much less binding affinity for RNA, while the ones with six amino groups shows very high binding affinity.37-39 It was also shown that the aminoglycosides whose hydroxyl groups were modified to amino groups (7, 9, and 11 in Figure 1.1) slowed down the cleavage dramatically compared to the parent compounds (6, 8, and 10 in Figure 1.1), indicating that the conversion increased the binding affinity of the compound. The 6"amino 6"-deoxykanamycin A (9 in Figure 1.1) and Kanamycin B (1 in Figure 1.1) were shown to have comparable ribozyme inhibitory activity since both derivatives have five amino groups, though in different positions. It was proposed that both of these Due to the compounds present a similar stereochemical array of positive charges. spherical shape of an ammonium group and its geometrical degeneracy, both derivatives can display a similar array of ammonium groups and charge densities toward the RNA skeleton. It was suggested that a three-dimensional electrostatic complementarity rather than highly specific contacts between aminoglycoside antibiotics and their RNA hosts directs binding.35-39 8 R1 R2 H3N O R3 O H3 N HO R4 HO O R5 NH3 O NH3 Aminoglycoside Kanamycin B (1) Tobramycin (2) Dibekacin (3) 6"-Deoxytobramycin (4) 4"-Deoxytobramycin (5) 2"- Deoxytobramycin (6) 6"-amino6"deoxytobramycin (7) Kanamycin A (8) 6"-amino-6"deoxykanamycin A (9) R1 OH OH OH H OH OH NH2 OH NH2 R2 OH OH OH OH H OH OH OH OH R3 OH OH OH OH OH H OH OH OH R4 OH H H H H H H OH OH R5 OH OH H OH OH OH OH OH OH NH2 HO HO R O R2HN NH2 HO NH2 O H2 N HO OH O OH NH2 O O O 10 (R=OH) neomycin B 11 (R=NH2) 5"-amino-5"-deoxyneomycin B Figure 1.1: Some Naturally Occurring Aminoglycosides and their Derivatives. The first structure and the chart details the structures of kanamycin family aminoglycosides while the second structure shows the neomycin family. These compounds were used to study the role of electrostatic interactions in RNA binding. 9 Figure 1.2: Secondary Structure of Hammerhead 16 Ribozyme. In this secondary structure, the arrow shows the point at which the cleavage takes place. Aminoglycoside K2 (min-1) at 100 M K2 (min-1) at 10 M control 0.075 0.075 0.018 0.060 1 0.012 0.051 2 0.004 0.046 3 0.017 0.052 4 0.004 0.039 5 0.002 0.034 6 0.011 7 0.058 8 0.018 0.018 9 0.012 0.051 10 0.011 11 Table 1.0: Binding Affinities. Binding affinity measurements of the naturally occurring aminoglycosides and their derivatives. 1.1.2.1.2 Addition of Functionalities Certain functionalities can be added to the aminoglycoside to make it a better nucleic acid binder. Wang and coworkers have reported the synthesis and analysis of an EDTA-aminoglycoside conjugate (1.1). The ability of this compound to inhibit the hammerhead ribozyme HH16 (Figure 1.2) was analyzed. The EDTA can be chelated with different metal ions, such as Fe++ and Fe+++. A rate constant of 0.17 min-1 was observed for the ribozyme cleavage by this conjugate. In the presence of Fe++, the 10 ribozyme cleavage was completely abolished, however in the presence of Fe+++, the inhibition was much slower. It was proposed that the Fe(II)-EDTA fragment in the complex possesses a single negative charge and it can coordinate a positively charged ion such as Mg++, lowering the activity of the ribozyme, since Mg++ plays an important role in catalysis. On the other hand, the Fe(III)-EDTA complex is neutral and shows The metal-free EDTA inhibitory activity very similar to the parent tobramycin. conjugate is a weaker inhibitor due to a the potential zwitterionic structure and can have a different RNA binding mode.41 HO HO O O N O O OH S HO H3N O OH O H3N HO HO O OH NH3 N NH 1.1 O NH3 1.1.2.1.3 Ammoniums Vs. Guanidiniums Aminoglycosides have been shown to competitively block the binding of the Rev protein to the Rev Response Element (RRE).42 Luedtke and coworkers have developed an assay using the competition between aminoglycosides and a fluorescent Rev peptide for binding to an immobilized RRE fragment. In this competition assay, the amount of fluorescent peptide in solution or remaining on the solid support is quantitated upon the treatment with the competitor aminoglycosides. This displacement assay was proven to be as accurate as the more conventional methods (Table 1.4).43 11 Baker and coworkers reported the effect of converting aminoglycoside ammoniums to guanidiniums in RNA binding. In contrast to ammonium groups, guanidinium groups are more basic, planar, and exhibit directionality in their H-bonding interactions. Thus, it is hypothesized that the RNA affinity and selectivity of aminoglycosides are increased upon converting ammoniums to guanidiniums. All the ammoniums on the aminoglycosides were converted to guanidiniums (Figures 1.3 and 1.4). To study the binding interactions, the aforementioned HIV-1 Rev-RRE competitive assay was used. The "guanidinoglycosides" were used as inhibitors for Rev binding. Guanidinylation of kanamycin A, kanamycin B, and tobramycin resulted in greater than 10-fold increase in inhibitory activity relative to the parent compound (Table 1.1). Guanidinylation of neomycin B and paromomycin resulted in 5-fold increase in activity (Table 1.1). Relative specificity studies were carried out using the aforementioned solidphase assay and comparing it to the values received from the ligand binding of other known aminoglycoside RNA binders. These studies revealed that the specificity of kanamycin A, kanamycin B, tobramycin, and paromomycin increased upon guanidinylation, while the specificity of neomycin decreased.44,45 OH HO R3HN O OH O R3HN HO R2 R1 O O NHR3 OH NHR3 Aminoglycoside GuanidinoKanamycin A GuanidinoKanamycin B Guanidinotobramycin R1 OH NH(C=NH)NH2 R2 OH OH R3 NH(C=NH)NH2 NH(C=NH)NH2 NH(C=NH)NH2 NH(C=NH)NH2 NH(C=NH)NH2 12 Figure 1.3: Structures of Modified Kanamycin Family Aminoglycosides. The amines were converted to guanidiniums to study their effect on RNA binding. R1 HO HO HO O R2HN O R2HN O O NHR2 HO NHR2 O R2HN HO OH O OH R2 Aminoglycoside R1 Paromomycin OH H Neomycin B NH2 H Guanidino-paromomycin OH (C=NH)NH2 Guanidino-neomycin B NH(C=NH)NH2 (C=NH)NH2 Figure 1.4: Structures of Modified Neomycin Family Aminoglycosides. The amines were converted to guanidiniums to study their effect on RNA binding. Aminoglycoside IC50 ( M) Guanidino-Kanamycin A 65 Guanidino-Kanamycin B 3.5 Guanidino-tobramycin 3.8 Paromomycin 65 Guanidino-paromomycin 18 Guanidino-neomycin B 1.3 Table 1.1: Binding Affinities. The IC50 values of Kanamycin and neomycin derivatives on binding to RRE. 1.1.2.2 Monomeric Vs. Dimeric The effect of monomeric aminoglycoside vs. covalently linked symmetrical and nonsymmetrical dimeric aminoglycosides on nucleic acid binding was studied by Michael and coworkers. The dimeric aminoglycosides were linked through dithio linkages (1.2). The dimeric derivatives were compared to the monomers in their ability to inhibit the Tetrahymena ribozyme. It was found that the dimeric counterparts inhibit 13 ribozyme function 20 to 1.2 x 103 fold more effectively than the monomers (Table 1.3). The binding curves for the dimers showed a characteristic two high affinity-binding sites within the ribozyme's three-dimensional fold.46 From these studies, it was proposed that the ribozyme possesses multiple sites for aminoglycoside binding with different affinities. One binding site for a dimeric aminoglycoside could consist of two adjacent monomeric sites. These sites could be located next to each other in the primary sequence or within close proximity in the ribozyme's tertiary structure. Each monomeric subunit of a dimeric aminoglycoside could occupy one of the two sites. Most of the entropic penalty is paid by binding in the first subunit to the RNA molecule, which brings the covalent linked second subunit in close proximity to its binding site.47 These studies also show that one equivalent of a dimeric aminoglycoside decreases the rate of substrate cleavage more than two equivalents of the corresponding monomeric aminoglycosides. Thus, two adjacent RNA binding sites can be occupied by two individual monomeric aminoglycosides and monomeric aminoglycosides are encumbered with an entropical disadvantage.46 The following explanations were proposed for the above findings. Monomeric aminoglycosides dissociate quickly from the ribozyme, as reported in fast off rates in aminoglycoside-RRE-RNA binding.48 Once the monomer is dissociated from the RNA, shielding by counter ions prevents rapid re-association leading to slow on rates. This effect is expected to be even more pronounced at high ionic strength. Since Kd = koff/kon, it is expected to be relatively high for a monomer. On the other hand, the RNA/ dimeric aminoglycoside complex is likely to dissociate slowly. One of the two monomeric subunits might be permanently bound to the RNA. Partial dissociation of one monomer 14 subunit would be followed by quick reassociation, because the dissociated subunit is held in close proximity to its binding site by the tethered subunit that remained bound. Thus, the dimeric aminoglycoside shows a lower IC50 value than the monomer. S S R2 H3 N O S S O O HO R3 O H3 N HO O O NH3 OH OH NH3 S R2 H3 N O R3 O H3 N HO HO O O NH3 OH OH NH3 1.2 Aminoglycoside IC50 ( M) Neomycin B 3.4 Tobramycin 16 Kanamycin A 9.3x102 Neo-Neo 0.19 Tob-Tob 0.11 Kan-Kan 0.77 Tob-Neo 0.39 Kan-Tob 0.26 Table 1.3: Binding Affinities. The IC50 values of dimeric aminoglycosides are measured. 1.1.2.3 Phenanthridine Derivatives Leudtke and coworkers have used the aforementioned competitive displacement assay to measure the binding affinity of Rev Response Element (RRE) to various phenanthridine (1.3) derivatives synthesized by converting the amines at the 3- and 8positions of ethidium bromide into guanidine, pyrrole, urea, and various substituted ureas. One of the derivatives 1.4 (3, 8-bis-urea-ethylenediamine-5-ethyl-615 phenylphenanthridinium trifluoroacetate) shows an enhanced affinity and specificity for HIV-1 RRE as compared to ethidium bromide.49 Solid Solid phase Solid phase phase + DNA + tRNA Neomycin B 7 7 8 20 Tobramycin 47 45 50 100 Kanamycin B 80 90 90 170 Kanamycin A 780 750 750 1200 Table 1.4: Binding Affinities. Comparison of dissociation constants measured using different methods. All values are in M. Compound Anisotropy Br N H2N NH2 N O N H TFA N N H O N 1.3 1.4 The overall charge of a ligand is critical for high binding nucleic acid affinity. Larger RNA molecules that have elaborated secondary and tertiary structural elements may provide larger or multiple binding sites. Increasing the size and charge of the recognition domain may therefore become beneficial when targeting large RNA molecules. These are some of the understandings that we have gathered through the traditional method regarding RNA-small molecule interactions. However, to study the sequence specific molecular recognition, we have to look at other methods. 1.1.3 SELEX Figure 1.5 illustrates a more "complete" method of understanding molecular recognition between nucleic acids and other molecules through SELEX and it allows us to study sequence specific interactions. In this method, a library of nucleic acids competes for the binding of a target. A nucleic acid or a group of related nucleic acids 16 are then selected out of this process that has the highest binding affinity and specificity for the target of interest. This method is more of a "complete" method, since a nucleic acid library itself is a complete population, since they are made of only four nucleotide bases. Since, this method gives the highest binding and affinity species, a molecular recognition database of nucleic acids can be created where the effect of various functional groups and monomers can be evaluated for their binding affinities. Once understandings of these interactions are developed, it will be possible to design and synthesize better nucleic acid binders. Then, these compounds can be examined for their binding abilities and as potential pharmaceutical agent through the "hit or miss" method as described in Figure 1. Select the RNA that has the highest affinity and study the interactions Selection against a given target Library of RNA of a known length Figure 1.5: SELEX. In this method, "complete" libraries of nucleic acids are allowed to compete against each other for the binding of a ligand. 1.1.3.1 In Vitro Selection In order for a genetic selection to work, genotype and phenotype must be linked. In the case of SELEX, the nucleic acid possesses both genotype (a sequence that can be copied by a polymerase) and phenotype (some functional trait such as binding). In the 1960s, Sol Spiegelman showed that Darwinian selection can be carried out in a cell-free system through the RNA bacteriophage Q.50 This viral genome can be copied in vitro 17 by the Q replicase. Through serial dilutions, genome replication became very quick, with the phenotype under selective pressure being replication speed. In other words, the RNAs who replicated fast enough survived. Due to the inherent mutation rate of this polymerase, genotypic variations are developed in vitro and the Q genome adapted to it through deleting sequences unnecessary for polymerase recognition, thus shortening the replication time. Spiegelman also developed RNA sequences that adapted to different "niches", such as the presence of ethidium bromide or an unbalanced composition of nucleotide triphosphate.51 Even though, the phenotype was limited to selection speed, these were the reported initial in vitro selection experiments. By the 1990s, chemical synthesis of DNA libraries, the isolation of reverse transcriptase, and the invention of polymerase chain reaction (PCR) allows the introduction of a new phenotype, being able to bind a target. It led to the development of SELEX. SELEX is a method to isolate functional nucleic acids from a large library of oligonucleotides by a repetitive process of in vitro selection and amplification. The selected nucleic acids can act as receptors and catalytic nucleic acids (ribozymes and aptazymes). SELEX can be carried out on a wide variety of targets, such as inorganic ions,52 organic cellular metabolites,53-55 proteins,56-58 organelles,59 complex structures such as viruses,60 and whole cells.61 Since SELEX is possible to be carried out on such a wide range of targets, there exist no written guidelines on how it is done. The fitness ability of the molecules in a SELEX is a function of not only their target binding ability, but also of their relative efficiency of enzyme-mediated replication, as well as of the kinetic and thermodynamic parameters of folding. Depending on how the SELEX is 18 carried out, different steps, including folding, substrate binding, or catalysis, can become rate limiting and therefore the main targets of the selection.62-64 To perform SELEX, initially, the target of interest needs to be immobilized on to a solid support. Secondly, an appropriate buffer condition needs to be chosen. Finally, the process of in vitro selection and amplification is carried out. 1.1.3.1.1 Target Immobilization When immobilizing targets for SELEX, it is important to choose a matrix that does not have high affinity for nucleic acids. Affi-Gel (Bio-Rad, Hercules, CA) and Toyopearl (Tosohassa, Montomeryfille, PA) were both found to bind large amounts of randomized pool RNA nonspecifically.65 Epoxy-activated agarose (Pierce, Rockford, IL) or Sepharose (Pharmacia, Piscataway, NJ) under 250-500 mM NaCl conditions have been shown to bind less than 1% of randomized pool RNAs.66 There are numerous ways to immobilize target on to the resin for the SELEX purpose. However, the immobilization can be divided into two types; affinity immobilization and covalent immobilization. The main type of affinity immobilization that is carried out is through the biotin streptavidin system. In this case, the target is biotinylated and is then incubated with resins (mainly agarose) that are loaded with streptavidin. There are numerous activated biotin reagents available that can undergo various reactions with different functional groups that can be used for biotinylation. The target can also be directly immobilized on derivatized hydrophilic resins through covalent linkages. Glyoxial and CNBr agarose beads and EAH Sepharose67 are two of the common resins for this purpose. Epoxy-activated Sepharose forms stable ether 19 linkages with alcohols, C-N bonds with primary amines, and thioether linkages with thiols. Different targets can be loaded on to agarose resins using various linkers, such as a dihydrazide linker.68 Moreno and coworkers have reported the use of colloidal gold for the purpose of immobilization of targets for SELEX. They have immobilized the parasitic membrane protein kinetoplastid membrane protein-11 on gold for SELEX.69 1.1.3.1.2 Pool Synthesis The process of selection starts with the synthesis of an ssDNA library of oligonucleotides. Each oligonucleotide consists of a 5' and a 3' constant region and a central region of random sequence. The constant regions on both ends are primer binding regions and the 5' end also contains the T7 promoter region. Even though, in most cases the binding motifs are embedded in the variable region, sometimes the constant regions (primers) play a role in binding. There are three important considerations in designing the library: the avoidance of amplification artifacts, the degree of randomness, and the length of the random sequence tract.70 Random sequence pools allow us to ask what the probability is of finding a sequence with a given level of activity, and how this is affected by the length and composition of the random sequence.71-73 Such selections allow us to determine the amount of information required to specify a given level of binding free energy for aptamers.74 During the pool synthesis, in order to ensure an equimolar representation of bases in the final product, 0.1 M solutions of phosphoramidites should be mixed in a molar ratio of 3:3:2:2 A:C:G:T.75 The synthetic DNA pool obtained from the chemical synthesis should be enzymatically amplified prior to carrying out a SELEX. Chemical 20 synthesis might introduce chemical lesions such as apurinic sites that prevent oligomers from serving as PCR templates for enzymes and may reduce the pool complexity and lower theoretical yield from 2- to 100-fold. In order to estimate the original complexity of a pool, both the synthetic yield and the fraction of the population that can serve as the template for the elongation should be estimated. The structure-function relationship of binding is dependent on the randomness of the nucleic acid pool. There are three types of randomization: partial, segmental, and complete. When doing a partial randomization involves "doping" mutations into a constant sequence at a fixed rate and it aids in determining which residues contribute to structure and function.76,77 This method produces arrays of point mutations with very high frequency. The segmental strategy involves the complete randomization of a short segment of a nucleic acid. This can be used to study the mutation affect on the wild type sequences and identify novel sequence or structural motifs that changes the binding affinities.78 In a 15% doped pool selection against GTP, using the ATP aptamer by Huang and Szostak explored a broad region of structural space, while remaining in the region of sequence space closer to the original aptamer. It was found that that the original secondary structure was disrupted and new recognition loops were evolved. It was learned that there are novel structures that recognize a significantly different ligand in the region of sequence space close to the ATP aptamer. It was suggested that RNA structures may tend to evolve through the accumulation of mutations followed by jumps to distinct structures with novel functions.68, 79 21 The length of the random sequence is dependent on what range of nucleic acid sequences need to be examined for the formation of structures.73 If a target has good affinity for nucleic acids, then a partial, segmental, or a short, completely random pool will likely yield aptamers. As a rule, a complete randomized pool for an aptamer selection contain 30 to 60 randomized nucleotides.80 This way, sequences can be readily aligned and sequences and motifs can be easily identified. On the other hand, if the target is not known to bind nucleic acids, then a longer (>60 residue), completely random pool gives a better chance to isolate an aptamer. A longer random sequence results in greater structural complexity while a shorter sequence results in greater representation. Even though in theory, longer random sequences form more complex sequence motifs and more elaborate structures, shorter, less complex binding motifs might predominate even in these pools. On the other hand, residues that are dispersed in a long sequence can come together to form simple recognition sequences such as stem-loops. The long sequences can be disadvantageous, because they result in less complete coverage of "sequence space" than shorter random sequence tracts. Regardless of whether a shorter or longer random sequence pool is used, the ultimate complexity of the pool is limited by DNA synthesis chemistry to a total of 1013-1616 different sequences. For example, theoretically, there should be approximately 1042 sequences in a library consisting of 70 nucleotides, but in actuality there are only 1013 to 1015 different sequences present in a random pool. Thus, only a small fraction of the total possible sequence diversity is sampled in the 70-mer pool, though the longer pool still contain all possible 22- to 25mers (422 1013; 425 1015). 22 1.1.3.1.3 Primers Since the synthesized ssDNA library is PCR amplified using primers, many amplification artifacts can be avoided through careful design of primer sequences, such as avoiding sequences that are highly structured and stable, that can self-prime, and can form primer dimers. During a SELEX, an original synthetic DNA can go through PCR rounds hundreds of times. Thus, it is possible to develop internally primed long sequences and/or short sequences that survive based on their enhanced replicability. To avoid these artifacts, primers should have no regions of dyad symmetry and their termini should be AT rich. The use of Single Strand Binding Proteins in PCR can also help with this process.81 1.1.3.1.4 The Art of Selection The most important part of SELEX is the separation of unbound nucleic acid species from bound. This is determined by the selection procedure. Small molecular targets are usually immobilized on resin prior to the SELEX process, while large molecules such as proteins, the protein-aptamer complexes are isolated on modified cellulose filters.82 For the selection against antibodies, immunoprecipitation of antibodyaptamer complex is achievable.83-85 The nucleic acid- target complex can also be size separated on native polyacrylamide gels (gel shift).86 The binding species selected out of SELEX are highly dependent on the selection conditions. The aptamers that are selected are usually specific for the buffer conditions used in the selection process. A change in buffer usually results in a change in aptamer sequences.87 When designing a SELEX experiment, numerous parameters need to be considered as explained below. 23 1.1.3.1.4.1 Target Compounds that are known to bind to nucleic acids are good targets for SELEX. Compounds that are also positively charged are better targets than negatively charged compounds. It is due to the fact that the phosphodiester linkages in nucleic acids are also negatively charged and cause charge repulsion with negatively charged compounds. 1.1.3.1.4.2 Buffer Conditions The buffer usually contains at least a monovalent and divalent cation. A higher concentration of monovalent cation will prevent some nonspecific binding to the target.88 On the other hand, higher concentrations of divalent cations, such as Mg++ facilitate the formation of secondary structures, also increasing non-specific binding. 1.1.3.1.4.3 Competitors Compounds that are similar to the target can be used to increase the affinity and selectivity of the selected aptamers. The use of a competitor will encourage the isolation of high affinity species from a random sequence pool. The more resembling the competitor is to the target, the more specific the aptamer will be. 1.1.3.1.4.4 Equilibration During the process of selection, the members of the pool are competing against each other for target binding. Since, the binding of an aptamer and its target maybe dependent on an induced fit,89 it is necessary to give certain amount of time before the reaction come to equilibrium. Usually, species with nanomolar disscociation constants requires minutes, while species with picomolar dissociation constants require hours to reach equilibrium. 24 1.1.3.1.4.5 Pool: Target Ratio The higher this ratio is, the better competition there will be for target binding, and thus the progression of SELEX is improved. On the other hand, lower ratios will allow weak binders to remain in the pool.90 1.1.3.1.4.6 Matrix Binding The nucleic acid species that are amplified after every round of selection include those that can bind to the target and those that can be bound to the solid matrix. It is important in a SELEX to remove these matrix binders in the beginning before they start to build up in the population and might take over the selection process. More matrix binders are common when the matrix is a better nucleic acid binder or when the conditions that are used for the SELEX, prefers binding of the nucleic acids to the matrix. There are numerous ways to eliminate these matrix binders. Negative selections can be carried out to remove these species. It is the incubation of the nucleic acid pool with the matrix itself under the selection conditions and filtering out the RNA that do not bind to the matrix. Sometimes, it is advantageous to carry out negative selections multiple times before (pre- negative selection) and after (post- negative selection) the regular selection. Finally, the matrix binders can be removed through cloning, if the pool has some target binding ability, but also are mostly matrix binders. 1.1.3.1.4.7 Stringency While performing a SELEX, it is very important to increase the stringency of the selection from round to round, since the goal is to isolate the highest affinity/specificity species. Early rounds of the selection may require less stringent conditions and longer incubation periods to maximize the recovery of the relatively few high affinity molecules 25 present in the initial pool. Stringency can be increased in the later rounds where the population winnows to predominantly high affinity binders. As alluded to earlier, there are many ways to achieve this. One way to do this is through washing. By increasing the volume of the wash from round to round as well as the monovalent salt concentration of the buffer, only the nucleic acid species with higher affinity is allowed to get through the rounds. The weak binders from a pool can also be eliminated by increasing the pool: target ratio from round to round. If the stringency of the selection is too high at the start or is increased too quickly in subsequent rounds, then filter or bead binding species can take over the selection process. To avoid this problem, negative selection steps can be carried out. The pool can be passed through a cellulose filter or a column containing plain resin without the target. The negative selection can be carried out multiple times and before and after a positive selection round to remove any matrix binders. If the matrix binding species predominates in a population, it is better to restart the selection with less stringent selection conditions. 1.1.3.2 RNA SELEX In order to carry out an RNA SELEX, the ssDNA library is PCR amplified and is then transcribed to form the RNA library, which is then undergoes in vitro selection (Figure 1.6). The RNA pool is incubated with the target, which is usually immobilized on to a solid support. Upon incubation, the resin is washed to remove any unbound or weakly bound RNA. The bound nucleic acid is then eluted using an elution buffer or through competitive eluting. The elution buffer usually contains urea or some other agent that is known to break apart the interactions between the target and the nucleic acids. The bound RNA is reverse transcribed, PCR amplified and transcribed to retain an 26 enriched RNA pool. A new round of selection is carried out with this selected RNA pool. This selection process is repeated till the highest binding and specific RNA species has been isolated. The final pool is cloned and then sequenced to further analyze and study the properties of the selected aptamers. Forward Primer 5' Constant Region T7 Promoter 5' Constant Region T7 Promoter Constant Region 3'ss-DNA Pool Reverse Primer 3' Constant Region Random Sequence PCR Random Sequence PCR Transcription Amplification (Reverse Transcription PCR Transcription) RNA Pool Target (Usually immobilized on a solid support) Incubation Enriched Pool (Aptamers) Isolation of bound species from unbound species Elution of RNA Recovery Bound RNA Unbound RNA Figure 1.6: RNA SELEX. A schematic representation of how SELEX against RNA is carried out. 27 1.1.3.3 ssDNA SELEX ssDNA SELEX is less prevalent than RNA SELEX, mainly due to the difficulties of carrying out selection using ssDNA. ssDNA does not form complex secondary and tertiary structures to the same extent of RNA, thus limiting the formation of binding pockets necessary for target binding. Thus, binding tendencies of ssDNA toward its ligands is lower than that of RNA. Nevertheless, it is very important to understand the molecular recognition between ssDNA and other molecules. For instance, majority of the enzymes in the DNA replication and in transcription processes bind to the unwound ssDNA. In the case of ssDNA SELEX, the ssDNA library is PCR amplified in the presence of a biotinylated primer and the DNA is incubated with streptavidin loaded resin (Figure 1.7). The DNA then undergoes strand separation under basic conditions to isolate the ssDNA library. A similar selection process as to the RNA was carried out on the ssDNA library. Once the bound ssDNAs are isolated from the beads, they are PCR amplified with the aforementioned biotinylated primer and the strand separation and isolation of enriched pool is carried out as seen above. 28 Forward Primer (biotinylated) Random Sequence Constant Region 3' ss-DNA 5' Constant Region Pool Reverse Primer T7 Promoter PCR Random Sequence 5' Constant Region T7 Promoter 3' Constant Region Strand separation Streptavidin- agarose column 5' 3' Target Biotinylated and bound to steptavidin agarose beads Incubation Isolation of bound species from unbound species Recovery 5' 3' Figure 1.7: Strand Separation. This is a schematic representation of how ssDNA is isolated for the process of SELEX. Single-stranded DNA aptamers have been isolated for organic dyes,91 ATP,92 Porphyrins,93-94 and arginine.95 Most DNA aptamers do not function if they are converted into RNA, and vice versa. This is presumably, due to the role of 3'-OH in determining helical parameters and helix stability, and in contributing to tertiary interactions that stabilize aptamer structure and interact directly with the ligand. One exception to this is the G-quartet-base flavin aptamer, which although selected from an RNA pool, binds with approximately equal affinity when composed of ssDNA.96 29 1.2 The Structural Basis of Recognition The aptamers isolated through selection will give information on sequence specific molecular recognition. However, to understand and decipher these interactions, it is necessary to examine the aptamer-ligand complex in a structural level. Here, we will examine the primary, secondary, and tertiary structures of single stranded nucleic acids as well as the three dimensional structural analyses of some aptamer-ligand complexes. 1.2.1 Primary Structures Deoxyribonucleic acids (DNA) is made of the monomer deoxy ribo-nucleotides with the bases Adenine (A), Guanine (G), Cytosine (C), and Thymine (T), while ribonucleic acids (RNA) are made of the monomer ribo-nucleotides with the bases A, G, C, and Uracil (U) (Figure 1.8). In general the purines (A, G) base pairs with the pyrimidines (C, T, U) and this base pairing lead to the secondary structure of the nucleic acids (Figure 1.9). Next, we will look at the secondary and tertiary structures of single stranded nucleic acids. 30 NH2 N N H N Adenine NH2 N N H Cytosine O N N N H O NH N Guanine NH2 O NH O N H Thymine O NH N H Uracil O Base O H H O O P O Deoxy ribo-nucleotide OO H H H O H O H O P O OO H Base H OH Ribo-nucleotide Figure 1.8: Primary Structure of Nucleic Acids. The structures of purines (adenine (A) and guanine (G)) and pyrimidines (cytosine (C), thymine (T), and uracil (U)) bases and the sugar phosphate backbones are the building blocks of both DNA and RNA. 31 Figure 1.9: Base Pairs. This figure represents the base pairing schemes between purines and pyrimidines. The H-bonds are shown in pink.97 1.2.2 Secondary and Tertiary Structures Naturally occurring RNAs are either completely double helical with A-form conformations or globular with short double-helical domains connected by singlestranded regions. The double-helical regions that contain the Watson-Crick base pairs and purely single-stranded regions are considered secondary structure. In the A-form duplex conformation, the nucleic-acid bases are pushed outward from the helix axis in the minor groove direction and tilted substantially with respect to the helix axis. The resulting helix has a shallow and wide minor groove and a major groove that is narrow and pulled deeply into the interior of the molecule. The basis for the A-form conformation is a C3'-endo sugar pucker which leads to a short phosphate-phosphate 32 distance of about 5.9 . Thus, the major groove of double-helical RNA is inaccessible to many ligands.98 The noncanonical intra- and inter-strand base-stacking and H-bonding interactions serve to establish the tertiary structures of single stranded nucleic acids. Some RNA tertiary structures that have been defined include A-minor motif, ribose zipper, pseudoknots, hairpins, bulge loops, mismatches, and triple-strand interactions in which specific H-bonding interactions define the folded structures. RNA tertiary structures are stabilized by monovalent cations.99 In most cases, the single-stranded regions of these structures can form unique tertiary interactions. Some tetraloops (hairpins with four loop residues) exhibit unusual base-pairing and H-bonding interactions. For example, the GAAA loop has a G-A base pair100 and the UUYG loop (where Y is a pyrimidine residue) contains a U-G base pair.101-102 The different tetraloops also differ in structure with variable stacking arrangements and sugar conformations, thus providing unique binding sites for small molecules.103 Bulges are formed when there are an unequal number of bases on the duplex strands. When there is a single base bulge, the unpaired nucleotide can either stack into the duplex or loop out into solution depending on the base composition. Multiple base bulges can cause a distortion of base stacking in the RNA duplex, bending of the RNA helix, or reduce the stability of the duplex. Certain base bulges will lead to an opening of the major groove accessibility, creating sites for binding ligands.104 Internal loops can involve symmetric or asymmetric loops within the duplex (Figures 1.10 1.14). These loops may contain one or more unpaired or impaired bases on each strand of the duplex. These regions can be ligand binding sites. They serve to 33 make the major groove of the RNA more accessible or they can undergo conformational changes when bound to ligands.105 RNA junctions are regions that connect three or more stems. A pseudoknot involves base pairing between one strand of an internal loop and a distinct single-strand region, or between single-stranded regions of two separate hairpin loops.106 A less complicated tertiary interaction is the triple-stranded RNA, which uses Hoogsteen base pairs to add polypyrimidine third strand to a polypurine-polypyrimidine duplex. Figure 1.10: Schematics of Some RNA Secondary Structures. (A) duplex, (B) hairpin loop, (C) single-base bulge, (D) multiple-base bulge, (E) symmetric internal loop, (F) asymmetrical internal loop, (G) mismatch loop, (H) three-stem junction, and (I) four-stem junction.104 34 Figure 1.11: Structure of the T. thermophila Group I Intron P4-P6 Domain. The three dimensional structure of this ribozyme contains a tetraloop and an A-rich bulge. The three helix junction is in light blue. Mg++ is shown in red. The locations of motifs seen in the tertiary structure are labeled. The A-rich bulge is consists of ribose zipper.107 A B C Figure 1.12: Some RNA Tertiary Structures. (A)hairpin,108 (B)stem-loop,109 and (C)ribose zipper110 35 Figure 1.13: A-minor Motif. The smooth minor grove edges of adenines are inserted into the minor groove of neighboring helices, preferentially at C-G base pairs, where they form H-bonds with one or both of the 2' hydroxyls of those pairs. This motif stabilizes contacts between RNA helices, interactions between loops and helices, and the conformation of junctions and tight turns.111-114 Figure 1.14: The Minor Groove RNA Triplex in a Pseudoknot. It is the Beet Western Yellow Virus pseudoknot. A Mg++ in rose, coordinate to the 5'-triphoshate region, while one Na+ in orange is coordinated in the minor groove. The stem backbone is in yellow.115-117 The secondary and tertiary structures determine the binding interactions between the ligands and the small molecules and there are several different types of these interactions. Nonspecific interactions such as the electrostatic effects between the cationic species and the negatively charged nucleic acid backbone play in important role in binding. These interactions usually take place along the exterior of the helix. In 36 another general binding mode involves the direct H-bonding or van der Waals interactions with the nucleic acid bases within the major groove or the wide shallow minor groove of the RNA helix. More specific binding can be achieved by H-bonding interactions between the ligand and the nucleic acid bases. Stacking interactions between RNA bases and aromatic ligands leads to intercalation. This binding mode distorts the RNA helix in order to accommodate the ligand.103 In some cases, functional changes bring in structural changes. In RNA, a small number of mutations can develop into a new secondary structure by destabilizing the parental fold and stabilizing one of the numerous competing ones. Many RNA sequences have a "neighborhood" of secondary structures in addition to its preferred structure. They become favorable upon one to two nucleotide substitutions.118 Since many sequences can form the same secondary structure, an RNA sequence can neutrally drift great distances through sequence space without significantly compromising its structure and function, thus exploring new neighborhoods of secondary and tertiary structure space.119-120 1.2.3 Molecular Recognition at a Structural Level The structural basis for molecular recognition of ligands by nucleic acids is purine-rich loops. The base of the loops engages in noncanonical base pairing interactions with each other to arrange the proper surfaces and H-bond donors and acceptors for ligand interaction. Often, irregular chain topologies and cross-helix stacking interactions stabilize the active conformation.121 37 1.2.3.1 Three Dimensional Structure Analysis Three-dimensional structural analyses of aptamer-ligand complexes have answered several questions regarding sequence specific molecular recognition of nucleic acids. It gives insights into the structural basis of highly specific ligand discrimination by aptamers. It also allows us to look at the differences between ligand-binding to aptamers versus the natural nucleic acids and proteins. Next, we will examine some specific examples of three-dimensional structure information that can further unfold the mysteries behind the sequence specific molecular recognition between nucleic acids and small molecules. 1.2.3.1.1 The ATP Aptamer The solution structure of the ATP aptamer, as determined by the NMR is illustrated in Figure 1.15.122-124 It reveals that the purine-rich loop is highly ordered, and the trace of its backbone can be described by (three consecutive turns). The two helices flanking the zeta are closed by mismatched G-G base pairs. This combination of irregular structural elements provides bases for H-bonding to and stacking against the adenine portion of the ligand and the other bases stack against the ribose moiety. About half of the ligand is buried within the binding cavity. This remarkable RNA conformation is stabilized by ligand binding, while in the absence of ATP, this region is poorly ordered. On the other hand, the DNA aptamer to ATP shows a very different sequence and secondary structure, but its NMR structure reveals that many aspects of the actual binding site are similar.125 In both cases, the Watson-Crick face of the ATP Hbonds to the minor groove face of a G residue, and the ligand base stacks on top of a reversed Hoogsteen G-G base pair. 38 Figure 1.15: ATP- Aptamer Complex. This figure represents the three-dimensional structure of the RNA aptamer - ATP complex determined by NMR spectroscopy. 122-124 1.2.3.1.2 The Tobramycin Aptamer The structure of the tobramycin RNA aptamer is one of the simple ones and is illustrated in Figure 1.16.126-128 Tobramycin is bound by a hairpin loop with a single bulged A in the stem. The ligand resides in the major groove and is covered by a flap formed by a C residue from the loop. To allow accommodation of the ligand, the deep groove is widened by either a bulged nucleotide129 or non-Watson-Crick base pairs130 up on complex formation. The RNA tightly encapsulates the alicyclic ring and one amino sugar, in part by a single bulged base, which acts as a flap closing the groove. The remaining amino sugar, closest to the attachment site on the solid support during the in vitro selection procedure, is directed outward into the solvent. Shape complementarities between the aminoglycoside and the RNA folds and distinct H-bonds involving ammonium groups of the antibiotics explain, in part, the high specificity by which RNA aptamers exclusively recognize their cognate ligands. Other factors that enhance binding specificity and affinity include structural electrostatic complementarity131 between the negatively charged RNA and the cationic ligands. The RNA binding pocket is lined by 39 negative charges creating a binding surface that is complementary to the threedimensional arrangement of positively charged ammonium groups in the oligosaccharide scaffold of the aminoglycosides. A potential disruption of a key interaction involving a cationic ammonium group thus permits a tobramycin-binding RNA aptamer to discriminate against another closely resembling compound.130 This kind of structural electrostatic complementarity between positively charged antibiotics and negatively charged pockets in RNA folds that is frequently occupied by metal ions, has also been discovered for natural RNA molecules.132-134 Figure 1.16: Tobramycin - Aptamer Complex. This picture shows the threedimensional structure of the RNA aptamer- tobramycin complex determined by NMR spectroscopy.126-128 1.2.3.1.3 The Neomycin Aptamer Just like the tobramycin aptamer, the neomycin aptamer also contains a simplestem loop fold closed by a large loop containing 13-14 residues (Figure 1.17). When the aminoglycoside is bound, the loops form their structure by zippering up through the formation of non-Watson-Crick base pairs such as G-U or G-A mismatches (Figure 1.18).135 The loop is closed by three consecutive G-U mismatches, a Watson-Crick G-C 40 pair and a sheared G-A base pair. While residues A14 and G15 stack upon each other, A16 loops out into solution. Neomycin B is bound to the floor of the widened major groove and it is partially encapsulated (rings I and II) by the flap base A16. Ring IV is directed outwards from the binding pocket. This encapsulation is mainly through potential H-bonds involving the amino groups of the aminoglycosides and the base edges as well as the phosphate backbone of the aptamer. Figure 1.17: Tobramycin and Neomycin Aptamers. These figures shows the secondary structures of both tobramycin and neomycin aptamers.135 41 Figure 1.18: Neomycin- Aptamer Complex. The Watson crick base pairs are in cyan and the mismatches are in green. The flap base A16 is in magenta and the neomycin is in yellow.135 1.2.3.1.4 The Streptomycin Aptamer The RNA aptamer against streptomycin undergoes an adaptive conformational change upon complex formation, resulting in formation of an L-shaped structure, stabilized by the formation of additional Watson-Crick and non-canonical pairs, and a base triple. The streptose ring (contains two guanidine moieties) of streptomycin is trapped within a cavity defined by components of two asymmetric internal loops and the intervening stem segment (Figure 1.19). Specificity of binding arises from the intermolecular hydrogen bonds to RNA base edges and sugar hydroxyl groups, but not to backbone phosphates. A pair of H-bonds accounts for 10,000 fold specificity of this 42 aptamer for streptomycin relative to bluensomycin, in which a guanidine group is replaced by a carbamate.136 Figure 1.19: Aptamer - Streptomycin Complex. It is a 2.9 crystal structure of the streptomycin- aptamer complex. The pink balls represent the bound Ba++.136 1.2.3.1.5 The Theophylline Aptamer The binding motif of a theophylline aptamer is a short hairpin with two small internal loops (one symmetric and the other asymmetric) (Figure 1.20).137,138 To form the binding pocket, one bulged strand forms an "S-turn" in which the direction of the chain reverses twice within a stretch of only five nucleotides. This causes several bases to make extensive stacking and H-bonding interactions with the ligand theophylline, and closing in around it to form a snug binding pocket. The S-turn contortion is stabilized by a "1-3-2 stack" in which a base is stacked between the bases of the two proceeding nucleotides, and a "base-zipper," in which bases from two different strands interdigitate so as to form a continuous stack. By stacking above a platform of two base-paired 43 nucleotides consecutive within one strand, theophylline is oriented in a coplanar fashion and facing the Watson-Crick edge of an adjacent cytosine base. Hydrogen bonding between the cytosine and the purine-like theophylline gives rise to a pseudo-base pair with one partner provided by the aptamer ligand. This pairing alignment would be disrupted by the additional bulky methyl group in the caffeine ligand, accounting for the discriminatory recognition by the RNA aptamer.139 Figure 1.20: Theophylline- Aptamer Complex. The three-dimensional structure of the RNA aptamer- theophylline complex determined by NMR spectroscopy is represented.137 1.2.3.1.6 Aptamers against Aromatic Compounds The flavin-mononucleotide (FMN) aptamer has a much simpler structure (Figure 1.21).140 It consists of a stem loop with an internal asymmetric purine-rich loop consisting of five nucleotides on one side and six on the other. This asymmetric loop is "zippered up" using base mismatches and one base triple without large backbone distortions. The planar tricyclic flavin moiety is stacked between a base triple and a G-G mismatch, and one edge of the chromophore H-bonds with the Hoogsteen face of an A. The FMN RNA aptamer complex along with the theophylline RNA aptamer, and AMP ssDNA and RNA aptamers, the ligand binding involves a planar surface (cyan) above which the ligand (orange) stacks coplanar with an adjacent base (cyan sticks), which forms specific intermolecular H-bonds. The stacking surface is constituted by pairs or 44 triples of coplanar bases interacting in non-Watson-Crick arrangements. In the AMP ssDNA aptamer, two molecules of AMP are recognized by H-bonding between their Watson-Crick edges and the minor groove edge of guanine bases.141 Each AMP-G pseudo-base pair stacks between a reversed Hoogsteen G-G pair and an adenine. In the case of the RNA aptamer against AMP, the same motif, G-G pair as a stacking platform and H-bonding between the AMP ligand and a guanine, determines the ligand-binding site in the AMP-RNA aptamer, which however only associates with a single ligand.122,123 The distinct H-bonding scheme in the AMP-G pseudo-base accounts for discrimination against the three other nucleotide bases by the AMP-binding aptamers. The AMP-G pseudo-base pair in the RNA-aptamer complex is part of a GNRA-like motif (where N is any nucleotide and R is a purine), an extremely stable structural element of many RNAs. 139,143,144 45 Figure 1.21: Aptamer - Flat Aromatic Ligand complexes.122 (Adapted from Patel et al. Science). (A) (left to right) Theophylline, FMN, and AMP. (B) FMN RNA aptamer (C) Theophylline RNA aptamer (D) AMP DNA aptamer (E) AMP RNA aptamer.140 1.2.3.1.7 Aptamers against Positively Charged Amino Acids In the case of positively charged amino acids (Figure 1.22), their side chains penetrates deeply into the nucleic acid fold where intermolecular H-bonds are formed exclusively with bases (cyan). The ligand-binding pockets are lined by clusters of bases (green) excluding both the negatively charged phosphate backbone and solvent water. In both the ssDNA and RNA aptamer against arginine, the guanidinium group of the ligand is aligned coplanar with the Watson-Crick edge of a cytosine base, which forms two Hbonds with the ligand. In one of the ssDNA aptamers, the arginine side chain is 46 buttressed between the Hoogsteen face of a coplanar guanine and a tilted cytosine. The tight encapsulation of the ligand within base-lined pockets maximizes the specificity of ligand recognition by excluding promiscuous contacts with the phosphate backbone and interactions mediated by solvent molecules. Similar structural features can be observed for the RNA aptamer against citrulline. In both complexes, a cytidine residue is proximal to the ligand, which is further enclosed by a stacking non-Watson-Crick G-G pair and two perpendicular bases.144 The precise discrimination between the two amino acids by the aptamers originates from the distinct shapes and orientation of polar functional groups between the ligand-binding pockets. In the citrulline aptamer, the terminal urea group of the ligand is forced to rotate by 90 as compared with the guanidinium group of arginine. As a consequence, it was proposed that citrulline forms H-bonds with the tilted guanine and packs against the cytosine, whereas the role of these two bases is reversed in the arginine aptamer. 47 Figure 1.22: Molecular Recognition of Basic Amino Acids.122 (A) Arginine (left) and Citrulline (right) by aptamers. (B) and (C) are two different ssDNA aptamers against arginine, while D is an RNA aptamer against arginine and E is an RNA aptamer against citrulline.144 1.2.3.1.8 Aptamers against Peptides Three-dimensional structures have been solved for a ssDNA apatamer145 both free in solution146-148 and bound to human thrombin,149 two RNA aptamers150,151 against a 17 residue peptide derived from human immunodeficiency virus type 1 (HIV-1) Rev protein,152-153 an RNA aptamer against a 16-nucleotide oligomer peptide from human T cell leukemia virus (HTLV-1) Rex protein154 and three sequence-related RNA aptamers in complex with the 14-kD bacteriophage MS2 coat protein.155,156 The DNA aptamer against thrombin unusually adopts a quadruplex structure in solution without the ligand.148,157,158 The RNA aptamer complexes of the Rev and Rex peptides are drastically different from that of the MS2 coat protein bound to their cognate RNA aptamers. They 48 reveal numerous adaptations of the ligands upon aptamer binding. While the structure of the MS2 coat protein is unaffected by aptamer binding, the structure of the Rev peptide is dependent on the aptamer architecture (Figure 1.23). The Rev peptide, that is unstructured in solution159 when binds to an RNA aptamer adopts an -helical conformation. The same peptide adopts an extended conformation in the presence of another RNA aptamer. The peptide inserts into the RNA major groove, widened through adaptive formation of non-Watson-Crick purine-purine pairs and a U A:U base triple, in both aptamer complexes. In addition, the complexes are stabilized by nonspecific intermolecular contacts between the guanidinium groups on the arginines and the phosphate groups of the RNAs. Specific H-bonds between the major groove edges of guanines and guanidinium moieties on pairs of arginine residues mediate the precise recognition of the Rev peptide in both RNA-aptamer complexes. Additional motifs for ligand discrimination involve a non-Watson-Crick purine purine base pair interacting with an asparagine side chain in the RRE160 and the first aptamer and stacking of a tryptophan moiety on a pyrimidine base of the second aptamer complex. In many protein-RNA complexes, non-Watson-Crick base pairs and base triples play an important role,161 mainly by distorting the RNA major groove for ligand docking and by providing unique sets of H-bonding sites.139 In the case of the MS2 coat protein, it is the aptamers that change their conformation upon ligand binding. The protein retains its three-dimensional fold. The aptamer contains a critical unpaired adenine residue, which stacks between the flanking helices in the free RNAs162,163 but is looped out in the protein bound complexes.164,165 This bulged adenine is one of the three unpaired bases that mediate the molecular 49 recognition between the aptamer and the MS2 coat protein. Two looped-out adenines form intermolecular H-bonds within hydrophobic pockets on the protein surface, along with an unpaired cytosine, which stacks precisely on a tyrosine side chain (Figure 1.23). These intermolecular interactions with the protein stabilize the looped-out conformation of the unpaired bases. It also drives the rearrangement of the critical adenine, which leads to unstacking of the base. A widened RNA major groove is necessary to accommodate minimal elements of protein secondary structures166,167 such as -helices and -sheets168,169 and extended conformations. On the other hand, ssDNA aptamers that bind to proteins need two or more secondary structure elements to form stable nucleic acid complexes.145 50 Figure 1.23: The RNA Aptamer Bound Conformation of an Arginine-rich Peptide.122 (A) from the human immunodeficiency virus (HIV-1) Rev protein is dictated by the nature of the RNA aptamer. (B) In one aptamer, the bound peptide folds into an -helical conformation within the major groove of the aptamer. (C) In a different aptamer, the same kind of binding is observed, but the peptide confirms an extended conformation. (D) and (E) An RNA aptamer (gray) that binds to bacteriophage MS2 coat protein (orange) binds to the surface of antiparallel sheets. The highly specific ligand recognition by aptamers is due to the enclosure of large parts of the ligand by the nucleic acids. This kind of entrapping of the ligand by the aptamer provides various discriminatory intermolecular contacts as seen above. The ligand discrimination is based on various effects. For example, in the case of theophylline aptamer, steric hindrance from the methyl group of caffeine prevents it from binding to it. In the case of the AMP aptamer, a specific H-bonding scheme is present 51 that is required for the formation of a pseudo-base pair with the ligand and is responsible for the selection of adenine as a ligand. For the arginine and citrulline aptamers, Hbonding plays a key role in discrimination. With the aminoglycoside aptamers, the recognition is through a combination of electrostatic and shape complementarity along with distinct H-bonds. The peptide and protein aptamers use a variety of discriminatory contacts, including stacking, shape complementarity, and H-bonding, since the ligands are more structurally complex.139 The aptamers are made of structurally similar four nucleotides and are limited in possible ways to pack around the ligand. Thus, the binding displays a less than perfect shape complementarity (compared to proteins). However it can be overcome by deep encapsulation of the ligand. The planarity of the nucleotide bases favors the stacking interactions. When comparing to the naturally occurring nucleic acids, the aptamers exhibit a higher ligand binding affinity. It is due to the fact that the functions of natural nucleic acids are parts of an intricate network of biological processes that require a biased cooptimization of different structural motifs including the ligand binding site, while the single function of an aptamer is to bind its ligand. Aptamers also carry unpaired loop regions that are disordered when free in solution, but undergo a conformational change in solution in the presence of the ligand. In some aptamers, single unpaired bases are conformationally immobilized as flaps over the ligand-binding sites, trapping the ligand or part of it in. In the case of natural nucleic acids, the ligand evolves to bind to the nucleic acid, but with the aptamers, the nucleic acids undergo an adoptive recognition for ligand binding.139 52 1.2.4 MOLECULAR DYNAMICS STUDIES Starikov and Nilsson carried out a theoretical study to understand the structural basis of ligand-aptamer interactions through molecular dynamics. They used the RNA aptamer against biotin. It was learned that as the negatively charged biotin approaches the aptamer, two Mg++ cations that aid the binding come closer to each other and the fluctuations in their relative positions become restricted. This induces the proper conformational transition in the aptamer's loop 2 backbone and facilitates the base stacking necessary to recognize the biotin ligand. It was concluded that the binding of the ligand is an "induced fit" with aptamer's secondary and tertiary structures predefined by its sequence is in no way trivial.170 1.3 BINDING AFFINITY MEASUREMENTS The ligand binding to the aptamer is discussed in terms of its specificity. Ligand specificity is defined as the binding affinity of a small molecule to a particular RNA site divided by its average affinity to all other RNAs. In other words, it's a comparison between the affinities of the ligand molecule to its RNA target and that of other RNAs. In general, larger molecules exhibit a higher binding specificity, which explains the low binding specificity of metal ions to RNA. High specificity is necessary for successful drug candidates. Numerous methods are available for evaluating the binding affinity between a small molecule and nucleic acids. In the early days of SELEX, binding affinity measurements were mainly carried out through the use of radiolabeled aptamers. The aptamer is incubated at different concentrations of targets and the amount of aptamers bound to the target is measured. Using these measurements, dissociation constants are extrapolated. Today there exist 53 more accurate and modern methods to evaluate the binding between nucleic acids and their ligands. 1.3.1 FLUOURESCENCE ANISOTROPY Fluorescence anisotrophy can be used to measure the binding affinities of small molecules to nucleic acids. The anisotrophy value is directly proportional to the tumbling rate of a fluorescein labeled target. As the target is added to the nucleic acid, their association is observed by an increased anisotrophy value. The increase in anisotrophy is due to the slower tumbling rate of the complex compared to that of the target alone. By non-linear regression, analysis of the association data yields a binding constant. Fang and coworkers reported the use of anisotropy change to detect the binding events between the platelet-derived growth factor protein and the aptamer against it.171 1.3.2 MISCELLANEOUS FLUORESCENCE METHODS Another method to measure binding constants is affinity-displacement assay. Initially, the biotinylated nucleic acid is immobilized on to a solid support. fluoresceinated target is then added and allowed to bind to the nucleic acid. Kd= (moles of free nucleic acids X moles of fluoresceinated target in solution)/(moles of complex) The fraction of fluoresceinated target bound to the immobilized nucleic acids is easily determined by measuring the fluorescence intensity of the bound versus that of the free in solution. Baebendure and coworkers have shown that aptamers can switch on the fluorescence of triphenylmethane dyes.172 Merino and coworkers have reported the shift in fluorescence upon addition of target to an aptamer loaded with a fluorophore.173 54 The 1.3.3 SURFACE PLASMA RESONANCE Surface plasma resonance (SPR) can be used to detect the binding of target to an aptamer. SPR is a reference optical method. In this technique, a selective surface is created by immobilizing the aptamer on the surface of a sensor chip. The ligand solution is then injected at a constant flow rate. The instrument monitors the changes in the resonance angle that occur at the sensor-chip surface when the ligand binds to the aptamer. The signal is proportional to the bound aptamer and is measured in resonance units (RU). From the data, important kinetic parameters, such as Ka, Kd, and the affinity constant KA of the aptamer-ligand interactions can be measured.174 1.3.4 COLORIMETRIC ASSAY Stojanovic and Landry have reported the development of an aptamer-based colorimetric probe for cocaine (Figure 1.24). The cocaine aptamer had a Kd value of less than 5 M and cocaine binds to it through a hydrophobic pocket formed by a noncanonical three way junction. A collection of dyes were screened for a change in visible spectra upon addition of a stock solution of cocaine to a mixture of aptamer and dye. The cyanine dye diethylthiotricarbocyanine iodide displayed a high attenuation of absorbance and a change in the ratio of two relative maxima that dominated the visible spectra. The dye was then used in a dye displacement assay to detect cocaine. Upon the addition of cocaine to the dye bound aptamer, the dye gets displaced (Figure 1.24) and the absorption at 760 nm decreased progressively, while the absorption at 670 nm remained constant. This displacement process was specific for cocaine.175 55 Figure 1.24: A Dye Displacement Assay Scheme for Aptamers.175 The cocaine aptamer (1) is complexed with the monomeric dye (2). The cocaine then displaces the dye, causing attenuation in absorbance and an eventual precipitation of dye. 1.3.5 MASS SPECTROMETRY Ding and coworkers have reported the use of ESIMS for the determination of solution phase dissociation constants of RNA-ligand complexes based on the gas phase measurements of the ratio of free and bound RNA target. ESIMS was also used to determine the location of ligand binding on the RNA. These studies were directed toward the evaluation of a group of compounds derived from the aminoglycoside paromomycin.176 Binding affinity measurements gives the strength of the nucleic acid-ligand complex, but the selectivity and specificity binding information is more subtle. Selectivity is the preferential formation of one complex over another in a binding event. Specificity can be ascertained if a related ligand generates a different population of 56 complexes. Specificity cannot be established, therefore, without proper comparison. Hence, specific binding implies selectivity, but selective binding is not necessarily specific.177 1.4 SEQUENCE SPECIFIC MOLECULAR RECOGNITION IN ACTION: APTAMERS IN CHROMATOGRAPHY Aptamers are valuable tools in numerous fields of science. They are remarkable compounds in that they rival synthetic receptors and antibodies with their affinity and specificity. The high affinity and specificity binding ability of aptamers can be used as molecular recognition tool in incorporating into analytical chemistry. Davis and coworkers have reported the use of an ssDNA aptamer against human neutrophil elastase as a high affinity ligand in flow cytometry178 The same group has reported the isolation of an aptamer against recombinant human CD4 from a 2'-F-pyrimidine containing RNA pool. The aptamers were then conjugated to fluorophores and were used to stain cells expressing human CD4 on cell surfaces, and analysis by flow cytometry.179 Englelke and coworkers have reported the use of an RNA affinity tags for purification of RNAs against Sephadex and streptavidin through carrying out SELEX against these two targets. One of the affinity tags is a high-affinity ligand for streptavidin that is eluted by competition with biotin under native binding conditions. The other tag binds selectively to Sephadex beads and is eluted by competition with the soluble dextran that composes Sephadex.180 Deng and coworkers have reported the use of aptamer affinity chromatography for rapid assay of adenosine in microdialysis samples collected in vivo. The adenosine 57 aptamer was used as part of the stationary phase in the chromatography. Ni++ was used to elute out the adenosine.181 RNA aptamers were used as biosensors by Kleinjung and coworkers. They used an fluor labeled L-adenosine-specific RNA aptamer as the sensor. The sensor measures the binding of FITC-labeled L-adenosine. They were able to detect L-adenosine in the submicromolar range.182 Potyrailo and coworkers reported the development of another biosensor using aptamers. This sensor was used for the detection of thrombin. The detection was carried out by following changes in the evanescent-wave-induced fluorescence anisotropy of the immobilized aptamer.183 Aptamers can be used as ligands in affinity probe capillary electrophoresis as reported by German and coworkers. They selected a DNA aptamer against IgE and it was labeled with a fluorophore. It was then used as a selective fluorescent tag for detecting IgE by capillary electrophoresis with laser-induced fluorescence detection. They were able to detect down to the pico mole range. IgE was detected in serum samples and similar conditions were used to detect thrombin.184 Ghatnagar and coworkers have reported the use of two G-quartet forming aptamers covalently linked to fused silica capillary columns as stationary-phase reagents in capillary electrochromatography. They were successful in separating binary mixtures of amino acids (D-trp and D-tyr), enantiomers (D-trp and L-trp), and polycyclic aromatic hydrocarbons.185 Romig and coworkers have shown that "aptamer affinity chromatography" can be used to purify proteins. A human L-selectin specific DNA aptamer was immobilized to a chromatography support to create an affinity column. The protein was efficiently bound 58 to the column and was later eluted off of it. There was a 1500-fold purification with an 83% single step recovery.186 Deng and coworkers have reported the use of aptamer stationary phase for the retention and separation of adenosine and analogues by affinity chromatography. They used biotinylated-DNA aptamers against adenosine and similar compounds and were immobilized on to streptavidin that was covalently linked to porous chromatographic support. The column was capable of selectively retaining and separating cyclic-AMP, NAD+, AMP, ADP, ATP, and adenosine even in complex mixtures.187 Rehder and coworkers were also shown that aptamer-derivatized capillaries can be used to separate nontarget molecule using throbmbin based aptamer. The aptamer was coated to the wall of fused silica capillary. The capillaries were used to separate two forms of -lactoglobulin.188 Pavski and coworkers have reported the use of aptamer as probes in affinity capillary electrophoresis for the detection of HIV-1 reverse transcriptase (RT). The ssDNA aptamer was selected against the RT and was fluorescently labeled. An affinity capillary electrophoresis/ laser-induced fluorescence (CE/LIF) assay was then developed for the direct detection of this RT. The assay was capable of identifying up to 50 nM HIV-1 RT. However, the HIV-1 RT concentrations in the sera of HIV infected individuals are approximately in the range of 9x10-4 pg/ml to 1 pg/ml which is many orders of magnitude below the analytical working range of this technique.189 It was recently shown that a DNA aptamer can be used for target-specific chiral selector for HPLC. An aptamer that was selected against the D-enantiomer of argininevasopressin was immobilized on to a chromatographic support. 59 The utilization conditions of the aptamer column was investigated and defined. A very high enantioselectivity was observed in separating the D and L enantiomers of the aforementioned peptide.190 This group has also reported the use of DNA aptamers selected against D-adenosine and L-tyrosinamide were used to resolve the enantiomers by HPLC, using microbore columns. The observed the enantioseparation of adenosine was similar to that reported with imprinted chiral stationary phase. While, the enantioselectivity observed for tyrosinamide enantiomers. Using van't Hoff plots, a very large H values for the target enantiomers were observed. Such values were consistent with the tight complex formation between these analytes and the aptamer chiral stationary phase's.191 Murphy and coworkers reported the isolation of a DNA aptamer that binds to thyroid transcription factor 1 (TTF1) using a magnetic separation method. The aptamers were then shown to be useful for enzyme-linked assays, western blots, and affinity purification. The affinity purification was capable of purifying the TTF1 protein out of the E.coli lysate in a single purification step.192 1.5 APTAMERS AS PHARMACEUTICS Aptamers can also be used as pharmaceutical agents. They can act as potential inhibitors in numerous biological pathways. SELEX has carried out against numerous "generic" proteins (i.e. those that are not believed to bind nucleic acids in vivo) and the isolated aptamers express KD values for their targets ranging from 50 pM to 50 nM.193,194 The frequency of these aptamers in random sequence is generally 10-10 -10-14, depending on the target. This has raised the possibility that functional interactions between RNA and "generic" proteins may be more common in vivo than is presently appreciated.195-197 60 Aptamers that bind to and interfere with the action of proteins implicated in pathological conditions could potentially be used as pharmaceutical agents.198-201 One of the chief obstacles to this approach is the instability of RNA in blood due to ribonucleases. The rate of RNA degradation can be drastically reduced by replacing the 2' hydroxyls of pyrimidines with amino or fluoro groups,202 and this modification is accepted by T7 RNA polymerase and avian myeloblastosis virus reverse transcriptase.203 Replacing all 2'-hydroxyls with other moieties, of course, tends to interfere with the properties of the aptamer, so the preferred method is so-called "front-loaded SELEX," in which the selection is performed using a pool already bearing all the modifications.204 Several aptamers selected from such libraries have been reported,205,206 and they display half-lives of up to 80 hours in serum.207 Such 2'-modified aptamers against basic fibroblast growth factor,208 immunoglobulin E (IgE),209 interferon-,210 and keratinocyte growth factor211 have been reported to inhibit cultured cells from undergoing normal physiological responses to these ligands. In addition, a nuclease-stabilized DNA aptamer to L-selectin was reported to inhibit L-selectin-dependent lymphocyte trafficking when injected intravenously into mice.212 There are other limitations to use RNA as drugs. The syntheses of RNA at milli gram level are very costly. RNAs rapidly undergo renal clearance, reducing their Conjugation of polyethylene glycol (PEG) and efficacy as pharmaceuticals.213-214 covalent attachment of dialkylglycerol to the RNA have been successful in preventing the renal clearance.215 Another way to prevent the degradation of RNA is by inverting all the chiral centers in the nucleic acids to create a mirror image of the RNA that is resistant to nucleases in the body, which are enantiospecific. In order to do that, the enantiomer of 61 the target is used to select against from a normal pool of RNA or DNA. Then, a clone is synthesized as the enantiomeric equivalent of the selected aptamer, which then binds to the natural ligand.216-218 A process known as "blended SELEX" can be used to inhibit physiological processes.204 In this case, a low affinity or specificity irreversible inhibitor of a target enzyme is linked to the random nucleic acid pool prior to selection and those sequences that facilitate the reaction between the inhibitor and a target enzyme is selected.219 Aptamers can be designed to deliver radionuclides, toxins, or cytotoxic agents to diseased tissue. This particular use of aptamers is known as "escort aptamers". They can be used as targeting agents for in vivo diagnosis and therapy. An ideal targeting agent expresses six different properties: high affinity and specificity for the target molecule, rapid uptake in the target tissue, rapid blood clearance, urinary excretion, durable tissue retention, and accumulation of high concentrations in the target tissue. At the current state, aptamers are described as having high-affinity binding and durable retention in target tissue, rapid tissue penetration and blood clearance, and both urinary and hepatobiliary clearance pathways. In order to further optimize escort aptamers, it is necessary to thoroughly define clearance pathways and the effect of aptamer metabolism on tissue targeting.220 Aptamers have potential and useful roles in diagnosing and treating cancer,221-223 Alzheimer's disease,224 Chagas' disease,225 and AIDS.226-228 1.6 CURRENT STATUS OF SELEX Ito and coworkers have performed a SELEX against ATP using cytidine triphosphate within a pool of random sequence RNAs containing biotinyl groups in the 62 side chains. Due to the presence of the biotinyl groups, the binding affinity was found to be high.229 The selection of aptamers can be automated, especially in the case of RNA aptamers. It was shown that automated selection can be used for obtaining anti-lysozyme aptamers.230 It was also shown by carrying out a selection against translated human U1A, a component of the nuclear spliceosome. These aptamers were very similar to the natural binding sequences and structures.231 Burke and coworkers have reported the selection of boron-containing aptamers to ATP.232 The development of aptamers containing boron has application in Boron Neutron Capture Therapy (BNCT), which is a treatment for certain cancers, that destroys only cells near the boron. Thus, there is a high demand for the specific labeling of cancer cells with boron. Bowser and coworkers reported the capillary electrophoresis-SELEX (CESELEX), which uses electrophoresis to separate binding sequences from inactive ones. In this method, selection occurs in a solution, thus eliminating stationary support required for the normal SELEX. The nucleic acids that bind the target undergo a mobility shift similar to that seen in affinity capillary electrophoresis.233 The bound nucleic acids are then separated from the unbound by collecting separate CE fractions.234 Gonzalez and coworkers have reported a novel ssDNA SELEX method in that the target protein is bound to colloidal gold in order to confer a higher mass at the protein for further purification by centrifugation.235 Sullenger and coworkers have reported on a new method of SELEX known as "Toggle" SELEX. They carried out a SELEX, in which in the first round the selection 63 was carried out against both human and porcine thrombin together and on the second round, the selection was carried out against the human thrombin alone. On the third round, the enriched pool was selected against porcine thrombin. This "toggle" process was continued with human thrombin in even rounds and porcine thrombin in odd rounds for a total of thirteen rounds. In parallel, they carried out standard SELEX against both human and porcine thrombin. They compared the binding affinity and sequence The human thrombin aptamer similarities of the aptamers isolated from all SELEX. resulted from the normal SELEX was found to bind the porcine thrombin as well. All the aptamers from the "Toggle SELEX" and from the normal SELEX against the porcine and human thrombin resulted in a consensus sequence ACAAAGCUGRAGWACUUA, where R represents A or G and W represents A or U. These aptamers with the aforementioned consensus sequence expressed high binding affinities for both human (14 nM of Kd) and porcine (< 1 nM Kd) thrombin.236 There are numerous reports on the use of aptamers as molecular beacons.237-240 In all cases, the aptamer is extended or allowed to base pair with a short piece or nucleic acid that contains a quencher. The aptamer stays in the folded conformation when there is no ligand preset with the fluorescence quenched. Upon the introduction of the ligand, the aptamer binds to the ligand and it starts to fluoresce again. Fang and coworkers have reported the use of molecular beacons to detect proteins such as platelet-derived growth factor (PDGF).241 Toulme and coworkers have shown that aptamers can be selected against RNA and have potential application in inhibition of viral genes. They have selected an RNA 64 aptamer against RNA hairpins that can give rise to loop-loop complexes with the target hairpins such as TAR element of the HIV-1 or subdomains of the HCV mRNA.242 Beal and coworkers have developed a method to select aptamers against proteins that are reversible. They carried out a SELEX against the DNA repair enzyme formamidopyrimidine glycosylase and used neomycin in each round to dissociate the enzyme bound RNAs. They were successful in completely inhibiting the enzyme at 100 mM concentration. The enzyme activity was recovered in the presence of neomycin.243 Rusconi and coworkers have reported the isolation of aptamer against coagulation factor IXa as anticoagulants. The complementary oligonucleotide strand of the aptamer was shown to be an antidote that can effectively reverse the activity of the anticoagulants.244 McCauley and coworkers have reported the development of aptamer-based biosensor arrays for the detection and quantification of various proteins. They used fluorophore attached DNA and RNA aptamers that were immobilized on a glass substrate. Fluorescence polarization anisotropy was then used for solid- and solutionphase measurements of target protein binding. The solid-phase aptamer-protein interactions recapitulate binding interactions seen in solution. They also demonstrated specific detection and quantitation of cancer-associated proteins such as inosine monophosphate dehydrogenase II, vascular endothelial factor, and basic fibroblast growth factor in human serum and in cellular extracts. They expect this technology to speed up the diagnosis of cancer.245 Yamana and coworkers have reported the use of bis-pyrene labeled DNA aptamer as a fluorescent biosensor. They incorporated the bis-pyrene label within the body of a 65 DNA aptamer against ATP. This signaling aptamer exhibits a large fluorescence response while retaining its binding specificity to the cognate ligand.246 Lozupone and coworkers have carried out SELEX against isoleucine to identify the simplest RNA binding site by shrinking the size of the randomized region until affinity selection is extinguished. The structure of the aptamer was found to be a small asymmetrical internal loop. The sequences included isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. From these results, it was suggested that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA-amino acid binding structures.247 Liss and coworkers reported the development of an aptamer-based quartz crystal protein biosensor. It was shown that they could detect concentrations and ligand affinity parameters of free unlabeled proteins in real time through an aptamer selected against human IgE. It was also demonstrated that aptamers are equivalent to antibodies in terms of specificity and sensitivity. The aptamer-ligand provided to be relatively heat resistant and stable over several weeks.248 Lu and coworkers have reported the development of highly sensitive catalytic DNA biosensors for metal ions (Figure 1.25). They have isolated DNA aptamers that can bind to metal ions such as Pb++. The selected aptamers were then labeled with a fluorophore and a quencher pair. The sensor was then used to detect the presence of Pb++ in samples such as lake water.249 66 Figure 1.25. Catalytic DNA Biosensor.250 This scheme represents the development of a novel catalytic DNA biosensor that makes use of the ability of Pb++ to cleave DNA. 1.7 SUMMARIES AND OUTLOOK The following three chapters describe three research projects that have been completed for this dissertation. Though, all three projects are unique in their own right, they all have a common goal. That is the understanding of sequence specific molecular recognition. What I have learned is that, often sequences direct the secondary structure and structure directs binding. The energetics of binding in these projects is measured through equilibrium binding constants. Chapter 2 details the molecular recognition using antibiotics, while Chapter 3 describes the tuning the specificity of a synthetic receptor using an aptamer. In Chapter 4 we will look at our progress towards the development of an amino acid nucleotide interaction database. 67 1.8 REFERENCES 1. 2. 3. Waring, M. J., & Wakelin, L. P. G. (2003) "Forty Years On" pp 1-17. in DNA and RNA Binders, Demeunynck, M., Bailey, C., Wilson, W. D., Wiley-VCH. Lerman, L.S. (1961). Structural Considerations in the Interaction of Deoxyribonucleic Acid and Acridines. Journal of Molecular Biology 3, 18-30. Reich, E. & Goldberg, I. H. (1964). Actinomycin and Nucleic Acid Function. Progress in Nucleic Acids Research 3, 183-234. Kornberg, A., & Baker, T. (1992) DNA Replication. New York, W. H. Freeman. Blackburn, E. H. (1998) "Telomerase RNA structure and function" in RNA structure and function. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 669-693. Nilsen, T. W. (1998) "RNA-RNA interactions in nuclear pre-mRNA splicing" in RNA Structure and Function, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 279-307. Hartford, J. B. & Rouault, T. A. (1998) "RNA structure and function in cellular iron homeostasis" in RNA Structure and Function, Cold Spring Harbor Laboratory Press, Cold Springs Harbor, 575-602. Fields, B. N., Knipe, D. M., & Hwley, P. M. (EDS). (1996) Fundamental Virology, Lippincott- Raven, Philadelphia. Green, R. & Noller, H. F. (1997) Ribosome and Translation. Annual Reviews in Biochemistry 66, 679- 716. Cech, T. R. (2000) Structural Biology. The Ribosome is a Ribozyme. Science 289, 878-879. Nissen, P., Hansen, J., Ban, N., Moore, P. B., & Steitz, T. A. (2000) The Structural Basis of Ribosome Activity in Peptide Bond Synthesis. Science 289, 920- 930. Muth, G. W., Ortoleva- Donnelly, L., & Strobel, S. A. (2000) A Single Adenosine with a Neutral pKa in the Ribosomal Peptidyl Transferase Center. Science 289, 947- 950. Kurland, C. G. (1992) Translational Accuracy and the Fitness of Bacteria. Annual Review of Genetics 26, 29-50. 68 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. Siomi, H., & Dreyfuss, G. (1997) RNA-binding Proteins as Regulators of Gene Expression. Current Opinion in Genetics & Development 7, 345- 353. Varani, G. & Nagai, K. (1998) RNA Recognition by RNP Proteins During RNA Processing. Annual Review of Biophysics and Biomolecular Structure 27, 407445. Gray, N. K. & Wickens, M. (1998) Control of Translation Initiation in Animals. Annual Review of Cell and Developmental Biology 14, 399- 458. Cech, T. R. & Golden, B. L. (1999) "Building a catalytic active site using only RNA" in The RNA World, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 321-349. Hentze, M. W. & Kuhn, L. C. (1996) Molecular Control of Vertebrate Iron Metabolism: mRNA-based Regulatory Circuits Operated by Iron, Nitric Oxide, and Oxidative Stress. Proceedings of the National Academy of Sciences of the United States of America 93, 8175-8182. Lau, N. C., Lim, L. P., Weinstein, E. G., & Bartel, D. P. (2001) An Abundant Class of Tiny RNAs with Probable Regulatory Roles in Caenorhabditis Elegans. Science 294, 858-862. Werstuck, G. & Green, M. R. (1998) Controlling Gene Expression in Living Cells Through Small Molecule-RNA Interactions. Science 282, 296-298. Fields, B. N., Knipe, D. M., & Howley, P. M. (1996) Fundamental Virology, Lippincott-Raven, Philadelphia. International Human Genome Sequencing Consortium. (2001) Initial sequencing and analysis of the human genome. Nature 409, 860- 921. Feig, A. L. & Uhlenbeck, O. C. (1999) "The role of metal ions in RNA biochemistry" in The RNA World, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1999, 287-319. Misra, V. K. & Draper, D. E. (1998) On the Role of Magnesium Ions in RNA Stability. Biopolymers 48, 113-135. Russell, R. & Herschlag, D. (2001) Probing the Folding Landscape of the Tetrahymena Ribozyme: Commitment to Form the Native Conformation is Late in the Folding Pathway. Journal of Molecular Biology 308, 839- 851. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 69 26. Silverman, S. K., Deras, M. L., Woodson, S. A., Scaringe, S. A., & Cech, T. R. (2000) Multiple Folding Pathways for the P4-P6 RNA Domain. Biochemistry 39, 12465- 12475 Rook, M. S., Treber, D. K., & Williamson, J. R. (1999) An Optimal Mg2+ Concentration for Kinetic Folding of the Tetrahymena Ribozyme. Proceedings of the National Academy of Sciences of the United States of America 96, 1247112476. Zuker, M. (1989) On Finding all Suboptimal Foldings of an RNA Molecule. Science 244, 48-52. Gaspin, C., & Westhof, E. (1995) Modeling the Three-Dimensional Structure of RNA Using Discreete Nucleotide Conformational Sets. Journal of Molecular Biology 229, 1049-1064. Banerjee, A. R., Jaeger, J. A., & Turner, D. H. (1993) Thermal unfolding of a group I ribozyme: the low-temperature transition is primarily disruption of tertiary structure. Biochemistry 32, 153-163. Wu, M. & Tinoco, Jr. I. (1998) RNA Folding Causes Secondary Structure Rearrangement. Proceedings of the National Academy of Sciences of the United States of America 95, 11555- 11560. Dorman, D. E., Paschal, J. W., & Merkel, K. E. (1976) Nitrogen-15 nuclear magnetic resonance spectroscopy. The nebramycin aminoglycosides. Journal of the American Chemical Society 98, 6885-6888. Botto, R. E. & Coxon, B. (1983) Nitrogen-15 Nuclear Magnetic Resonance Spectroscopy of Neomycin B and Related Aminoglycosides. Journal of the American Chemical Society 105, 1021-1028. Szilagyi, L., Pusztahelyi, Z. Sz., Jakab, S., & Kovacs, I. (1993) Microscopic protonation constants in tobramycin. An NMR and pH study with the aid of partially N-acetylated derivatives. Carbohydrate Research 247, 99-109. Wang, H. & Tor, Y. (1998) RNA-Aminoglycoside Interactions: Design, Synthesis, and Binding of Amino-aminoglycosides to RNA. Angewandte Chemie International Edition in English 37, 109-111. Hendrix, M., Alper, P. B., Priestley, E. S., & Wong, C.-H. (1997) Hydroxyamines as a New Motif for the Molecular Recognition of Phosphodiester: Implications for Aminoglycoside-RNA Interactions. Angewandte Chemie International Edition in English 36, 95-98. 70 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. Stage, T. K., Hertel, K. J., & Uhlenbeck, O. C. (1995) Inhibition of the hammerhead ribozyme by neomycin. RNA 1, 95-101. Zapp, M. L., Stern, S., & Green, M. R. (1993) Small Molecules that Selectively Block RNA Binding of HIV-1 Rev Protein Inhibit Rev Function and Viral Production. Cell 74, 969-978. Werstuck, G., Zapp, M. L., & Green, M. R. (1996) A Non-Canonical Base Pair Within the Human Immunodeficiency Virus Rev-Responsive Element is Involved in Both Rev and Small Molecule Recognition. Chemistry & Biology 3, 129-137. Wang, H. & Tor, Y. (1997) Electrostatic Interactions in RNA Aminoglycosides Binding. Journal of the American Chemical Society 119, 8734-8735. Wang, H. & Tor, Y. (1998) Tobramycin-EDTA Conjugate: A Noninnocent Affinity-Cleaving Reagent. Bioorganic & Medicinal Chemistry Letters 8, 36653670. Zapp, M. L., Stern, S., & Green, M. R. (1993) Small Molecules that Selectively Block RNA Binding of HIV-1 Rev Protein Inhibit Rev Function and Viral Production. Cell 74, 969-978. Luedtke, N. W., Tor, Y. (2000) A Novel Solid-Phase Assembly for Identifying Potent and Selective RNA Ligands. Angewandte Chemie International Edition in English 39, 1788-1790. Baker, T. J., Luedtke, N. W., Tor, Y., & Goodman, M. (2000) Synthesis and AntiHIV Activity of Guanidino Glycoside. Journal of Organic Chemistry 65, 90549058. Luedtke, N. W., Baker, T. J., Goodman, M., & Tor, Y. (2000) Guanidinoglycosides: A Novel Family of RNA Ligands. Journal of the American Chemical Society 122, 12035-12036. Michael, K., Wang, H., & Tor, Y. (1999) Enhanced RNA Binding of Dimerized Amino Glycosides. Bioorganic & Medicinal Chemistry 7, 1361-1371. Williams, D. H. & Westwell, M. S. (1998) Aspects of Weak Interactions. Chemical Society Reviews 27, 57. Hendrix, M., Priestley, E. S., Joyce, G. F., & Wong, C.-H. (1997) Direct Observation of Aminoglycoside-RNA Interactions by Surface Plasmon Resonance. Journal of the American Chemical Society 119, 3641-3648. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 71 49. Leudtke, N. W., Liu, Q., & Tor, Y. (2003) Synthesis, Photophysical Properties, and Nucleic Acid Binding of Phenanthridinium Derivatives Based on Ethidium. Bioorganic & Medicinal Chemistry 11, 5235-5247. Spiegelman, S. Q. (1971) An Approach to the Experimental Analysis of Precellular Evolution. Quarterly Reviews of Biophysics 4, 213-253. Wilson, D. S. & Szostak, J. W. (1999) In Vitro Evolution of Functional Nucleic Acids. Annual Reviews in Biochemistry 68, 611-647. Ciesiolka, J., Gorski, J., & Yarus, M. (1995) Selection of an RNA domain that binds Zn2+. RNA 1, 538-550. Sassanfar, M. & Szostak, J. W. (1993) An RNA Motif that Binds ATP. Nature 364, 550-553. Geiger, A., Burgstaller, P., von der Eltz, H., Roeder, A., & Famulok, M. (1996) RNA Aptamers That Bind L-arginine with Sub-Micromolar Dissociation Constants and High Enantioselectivity. Nucleic Acids Research 24, 1029. Burgstaller, P. & Famulok, M. (1994) Isolation of RNA Aptamers for Biological Cofactors by In Vitro Selection. Angewandte Chemie International Edition in English 33, 1084. Thomas, M., Chedin, S., Carles, C., Riva, M., Famulok, M., & Sentenac, A. (1997) Selective Targeting and Inhibition of Yeast RNA Polymerase II by RNA Aptamers. Journal of Biological Chemistry 272, 27980. Gal, S. W., Amontov, S., Urvil, P. T., Vishnuvardhan, D., Nishikawa, F., Kumar, P. K., & Nishikawa, S. (1998) Selection of a RNA Aptamer that Binds to Human Activated Protein C and Inhibits its Protease Function. European Journal of Biochemistry 252, 553. Kumar, P. K., Machida, K., Urvil, P. T., Kakiuchi, N., Vishnuvardhan, D., Shimotohno, K., Taira, K., & Nishikawa, S. (1997) Isolation of RNA Aptamers Specific to the NS3 Protein of Hepatitis C Virus from a Pool of Completely Random RNA. Virology 237, 270. Ringquist, S., Jones, T., Snyder, E. E., Gibson, T., & Gold, L. (1995) HighAffinity RNA Ligands to Escherichia coli Ribosomes and Ribosomal Protein S1: Comparison of Natural and Unnatural Binding Sites. Biochemistry 34, 3640-3648. Pan, W., Craven, R. C., Qiu, Q., Wilson, C. B., Wills, J. W., Golovine, S., & Wang, J. F. (1995) Isolation of Virus-Neutralizing RNAs from a Large Pool of 72 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. Random Sequences. Proceedings of the National Academy of Sciences of the United States of America 92, 11509-11513. 61. Morris, K. N., Jensen, K. B., Julin, C. M., Weil, M., & Gold, L. (1998) High Affinity Ligands from in vitro Selection: Complex. Targets Proceedings of the National Academy of Sciences of the United States of America 95, 2902-2907. Treiber, D. K., Rook, M. S., Zarrinkar, P. P., & Williamson, J. R. (1998) Kinetic Intermediates Trapped by Native Interactions in RNA Folding. Science 279, 1943- 1946. Zarrinkar, P. P. & Williamson, J. R. (1994) Kinetic Intermediates in RNA Folding. Science 265, 918-924. Sclavi, B., Sullivan, M., Chance, M. R., Brenowitz, M., & Woodson, S. A. (1998) RNA Folding at Millisecond Intervals by Synchrotron Hydroxyl Radical Footprinting. Science 279, 1940-1943. Lato, S. M., Boles, A. R., & Ellington, A. D. (1995) In vitro selection of RNA lectins: using combinatorial chemistry to interpret ribozyme evolution. Chemistry & Biology 2, 291-303. Wallace, S. T. & Schroeder, R. (2000) In Vitro Selection and Characterization of RNAs with High Affinity Antibiotics. Methods in Enzymology 318, 214-229. Meli, M., Vergne, J., Decout, J.-L., & Maurel, M.-C. (2002) Adenine-Aptamer Complexes. A BIPARTITE RNA SITE THAT BINDS THE ADENINE NUCLEIC BASE. Journal of Biological Chemistry 277, 2104-2111 Huang, Z. & Szostak, J. W. (2003) Evolution of aptamers with a new specificity and new secondary structures from an ATP aptamer. RNA 9, 1456-1463. Moreno, M., Rincon, E., Pineiro, D., Fernandez, G., Domingo, A., Jimenez-Ruiz, A., Salinas, M., & Gonzalez, V. M. (2003) Biochemical and Biophysical Research Communications 308, 214-218. Conrad, R. C., Giver, L., Tian, Y., & Ellington, A. D. (1996) In Vitro Selection of Nucleic Acid Aptamers that Bind Proteins. Methods in Enzymology 267, 336-367. Bartel, D. P. & Szostak, J. W. (1993) Isolation of New Ribozymes from a Large Pool of Random Sequences. Science 261, 1411-1418. Ekland, E. H. & Bartel, D. P. (1995) The secondary structure and sequence optimization of an RNA ligase ribozyme. Nucleic Acids Research 23, 3231-3238. 73 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. 73. Sabeti, P. C. & Unrau, P. J (1997) Accessing Rare Activities from Random RNA Sequences: The Importance of the Length of Molecules in the Starting Pool. Chemistry & Biology 4, 767-774. Wilson, D. S. & Szostak, J. W. (1999) In Vitro Selection of Functional Nucleic Acids. Annual Reviews in Biochemistry 68, 611-647. Ellington, A. D. & Green, R. in "Current Protocols in Molecular Biology" (1989) (F. M. Ausbel, Brent, R.; Kingston, R. E., Moore, D. D.; Seidman, J. G.; Smith, J. A.; Struhl, K. eds.), p. 2. Wiley, New York. Bartel, D. P., Zapp, M. L., Green, M. R., & Szostak, J. W. (1991) HIV-1 Rev Regulation Involves Recognition of Non-Watson-Crick Base Pairs in Viral RNA. Cell 67, 529. Peterson, E. T., Blank, J., Sprinzel, M., & Uhlenbeck, O. C. (1993) Selection for Active E.coli tRNA(Phe) Variants from a Randomized Library Using Two Proteins. EMBO Journal 12, 2959. Marshall, K. A. & Ellington, A. D. (2000) In Vitro Selection of RNA Aptamers. Methods in Enzymology 318, 193-214. Davis, J. H. & Szostak, J. W. (2002) Isolation of High-affinity GTP Aptamers from Partially Structured RNA Libraries. Proceedings of the National Academy of Sciences of the United States of America 99, 11616-11621. Gold, L., Polisky, B., Uhlenbeck, O., & Yarus, M. (1995) Diversity of Oligonucleotid Functions. Annual Review of Biochemistry 64, 763-797. Crameri, A., Stemmer, W. P. C. (1993) 10(20)-fold aptamer library amplification without gel purification. Nucleic Acids Research 21, 4410. Tuerk, C. & Gold, L. (1990) Systematic Evolution of Ligands by Exponential Enrichment: RNA Ligands to Bacteriophage T4 DNA Polymerase. Science 249, 505. Tsai, D. E., Harper, D. S., & Keene, J. D. (1991) U1-snRNP-A protein selects a ten nucleotide consensus sequence from a degenerate RNA pool presented in various structural contexts. Nucleic Acids Research Nucleic Acid Research 49314936. Levine, T. D., Gao, F., King, P. H., Andrews, L. G., & Keene, J. D. (1993) HelN1: An Autoimmune RNA-Binding Protein with Specificity for 3' Uridylate-rich Untranslated Regions of Growth Factor mRNAs. Molecular and Cellular Biology 13, 3494. 74 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. Tsai, D. E., Kenan, D. J., & Keene, J. D. (1992) In Vitro Selection of an RNA Epitope Immunologically Cross-Reactive with a Peptide. Proceedings of the National Academy of Sciences of the United States of America 89, 8864-8868. Blackwell, T. K. & Weintraub, H. (1990) Sequence-Specific DNA Binding by the c-Myc Protein. Science 250, 1104. Lorsch, J. R. & Szostak, J. W. (1994) In vitro selection of RNA aptamers specific for cyanocobalamin. Biochemistry 33, 973-982. Binkley, J., Allen, P., Brown, D. M., Green, L., Tuerk, C., & Gold, L. (1995) RNA Ligands to Human Nerve Growth Factor. Nucleic Acids Research 23, 31983205. Westhof, E. & Patel, D. J. (1997) Nucleic Acids. From Self-Assembly to Inducedfit Recognition. Current Opinions in Structural Biology 7, 305 Irvine, D., Tuerk, C., & Gold, L. (1991) SELEXION. Systematic Evolution of Ligands by Exponential Enrichment with Integrated Optimization by Non-linear Analysis. Journal of Molecular Biology 222, 739-761. Ellington, A. D. & Szostak, J. W. (1992) Nature Selection in vitro of singlestranded DNA molecules that fold into specific ligand-binding structures. 355, 850-852. Huizenga, D. E. & Szostak, J. W. (1995) A DNA Aptamer That Binds Adenosine and ATP. Biochemistry 34, 656-665. Conn, M. M., Prudent, J. R., & Schultz, P. G. (1996) Porphyrin Metalation Catalyzed by a Small RNA Molecule. Journal of the American Chemical Society 118, 7012-7013. Li, Y. & Sen, D. (1996) A Catalytic DNA for Porphyrin Metallation. Nature Structure Biology 3, 743-747. Harada, K.; Frankel, A. D. (1995) Identification of Two Novel Arginine Binding DNAs. EMBO Journal 14, 5798-5811. Lauhon, C. T. & Szostak, J. W. (1995) RNA aptamers that bind flavin and nicotinamide redox cofactors. Journal of the American Chemical Society 117, 1246-1257. Biochemistry 2nd Ed. By Garrett & Grisham 75 86. 87. 88. 89. 90. 91. 92. 93. 94. 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 108. Saenger, W. Principles of Nucleic Acid Structure (1984) Springer Verlag: New York. Shiman, R. & Draper, D. E. (2000) Stabilization of RNA Tertiary Structure by Monovalent Cations. Journal of Molecular Biology 302, 79-91. Heus, H. A. & Pardi, A. (1991)Structural Features That Give Rise to the Unusual Stability of RNA Hairpins Containing GNRA Loops. Science 253, 191. Cheong, C., Varani, G., & Tinoco, I., Jr. (1990) Solution structure of an unusually stable RNA hairpin, 5GGAC(UUCG)GUCC. Nature 346, 680. Varani, G., Cheong, C., & Tinoco, I., Jr. (1991) Structure of an unusually stable RNA hairpin. Biochemistry 30, 3280-3289. Chow, C. S. & Bogdan, F. M. (1997) A Structural Basis for RNA-Ligand Interactions. Chemical Reviews 97, 1489-1513. Weeks, K. M. & Crothers, D. M. (1991) RNA Recognition by Tat-derived Peptides: Interaction in the Major Groove. Cell 66, 577. Weeks, K. M. & Crothers, D. M. (1993) Major Groove Accessibility of RNA. Science 261, 1574. Puglisi, J. D., Wyatt, J. R., & Tinoco, I., Jr. (1990) Conformation of an RNA Pseudoknot. Journal of Molecular Biology 214, 437. http://www.sciencemag.org/feature/data/pharmacia/1998/Cate.shl Theimer, C. A., Finger, L. D., & Feigon, J. (2003) Evolution of aptamers with a new specificity and new secondary structures from an ATP aptamer. RNA 9, 1446-1455. Finger, L. D., Trantirek, L., Johansson, C., & Feigon, (2003) Solution Structures of Stem-Loop RNAs that Bind to the Two N-Terminal RNA-Binding Domains of Nucleonlin. Nucleic Acids Research 31, 6461-6472. http://scor.lbl.gov/help/RZResLocationHelp.html Correll, C. C. & Swinger, K. (2003). Common and Distinctive Features of GNRA Tetraloops Based on a GUAA Tetraloop Structure at 1.4 Resolution. RNA 9, 355-363. 109. 110. 111. 76 112. Strobel, S. A. (2002). Biochemical Identification of A-minor Motifs within RNA Tertiary Structure by Interference Analysis. Biochemical Society Transactions 30, 1126-1131. Battle, D. J. & Doudna, J. A. (2002). Specificity of RNA-RNA Helix Recognition. Proceedings of the National Academy of Sciences of the United States of America 99, 11676-11681. Nissen, P., Ippolito, J. A., Ban, N., Moore, P. B., & Steitz, T. A. (2001) RNA Tertiary Interactions in the Large Ribosomal Subunit: The A-minor Motif. Proceedings of the National Academy of Sciences of the United States of America 98, 4899-4903. Han, K. & Byun, Y. (2003) PseudoViewer2: Visualization of RNA Pseudoknots of any Type. Nucleic Acids Research 31, 3432-3440. Michiels, P. J. A., Versleijen, A. A. M., Verlaan, P. W., Pleij, C. W. A., Hilbers, & C. W., Heus, H. A. (2001) Solution Structure of the Pseudoknot of SRV-1 RNA Involved in Ribosomal Frameshifting. Journal of Molecular Biology 310, 1109-1123. Kim, Y.-G., Su, L., Maas, S., O'Neill, A., & Rich, A. (1999) Specific Mutations in a Viral RNA Pseudoknot Drastically Change Ribosomal Frameshifting Efficiency, Proceedings of the National Academy of Sciences of the United States of America 96, 14234-14239. Schuster, P., Fontana, W., Stadler, P. F., & Hofacker, I. L. (1994) From Sequences to Shapes and Back: A Case Study in RNA Secondary Structures. Proceedings of the Royal Society of London Series B 255, 279-284. Huynen, M. A., Stadler, P. F., & Fontana, W. (1996) Smoothness Within Ruggedness: The Role of Neutrality in Adaptation. Proceedings of the National Academy of Sciences of the United States of America 93, 397-401. Huynen, M. A. (1996) Exploring Phenotype Space through Neutral Evolution. Journal of Molecular Evolution 43, 165-169. Wilson, D. S., & Szostak, J. W. In Vitro Selection of Functional Nucleic Acids. (1999) Annual Reviews in Biochemistry 68, 611-647. Jiang, F., Kumar, R. A., Jones, R. A., & Patel, D. J. (1996) Structural basis of RNA folding and recognition in an AMP RNA aptamer complex. Nature 382, 183- 186. 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. 77 123. 124. Dieckmann, T., Suzuki, E., Nakamura, G. K., & Feigon, J. (1996) Solution structure of an ATP-binding RNA aptamer reveals a novel fold. RNA 2, 628-640. Dieckmann, T., Butcher, S. E., Sassanfar, M., Szostak, J. W., & Feigon, J. (1997) Mutant ATP-binding RNA aptamers reveal the structural basis for ligand binding. Journal of Molecular Biology 273, 467- 478. Lin, C. H. & Patel, D. J. (1997) Structural Basis of DNA Folding and Recognition in an AMP-DNA Aptamer Complex: Distinct Architectures but Common Recognition Motifs for DNA and RNA Aptamers Complexed to AMP. Chemistry & Biology 4, 817-832. Wang, Y. & Rando, R. R. (1995) Specific Binding of Aminoglycoside Antibiotics to RNA. Chemistry & Biology 2, 281-290. Jiang, L., Suri, A. K., Fiala, R., & Patel, D. J. (1997) Saccharide-RNA Recognition in an Aminoglycoside Antibiotic-RNA Aptamer Complex. Chemistry & Biology 4, 35-50. Jiang, L. & Patel, D. J. (1998) Solution Structure of the Tobramycin-RNA aptamer Complex. Nature Structure Biology 5, 769-774. Jiang, L., Suri, A. K., Fiala, R., & Patel, D. J. (1998) Saccharide-RNA Recognition in an Aminoglycoside Antibiotic-RNA Aptamer Complex. Nature Stucture Biology 5, 769. Jiang, L. & Patel, D. J. (1998) Nature Strucural Biology 276, 903. Hermann, T. & Westhof, E. (1998) Aminoglycoside binding to the hammerhead ribozyme: a general model for the interaction of cationic antibiotics with RNA. Journal of Molecular Biology 276, 903-912. Clouet-d'Orval, B., Stage, T. K., & Uhlenbeck, O. C. (1995) Neomycin Inhibition of the Hammerhead Ribozyme Involves Ionic Interactions. Biochemistry 34, 11186-11190. Wang, H. & Tor, Y. (1998) RNA-Aminoglycoside Interactions: Design, Synthesis, and Binding of Amino-aminoglycosides to RNA. Angewandte Chemie International Edition in English 37, 109-111. Tor, Y., Hermann, T., & Westhof, E. (1998) Deciphering RNA Recognition: Aminoglycoside Binding to the Hammerhead Ribozyme. Chemistry & Biology 5, R277 125. 126. 127. 128. 129. 130. 131. 132. 133. 134. 78 135. Jiang, L., Majumdar, A., Hu, W., Jaishree, T. J., Xu, W., & Patel, D. J. (1999) Saccharide-RNA Recognition in a Complex Formed Between Neomycin B and an RNA Aptamer. Structure with Folding & Design 1999, 7, 817-827. http://www.mskcc.org/mskcc/html/11778.cfm Zimmermann, G. R., Jenison, R. D., Wick, C. L., Simorre, J-P., & Pardi, A. (1997) Interlocking Structural Motifs Mediate Molecular Discrimination by a Theophylline-Binding RNA. Nature Structure Biology 4, 644- 649. Zimmerman, G. R., Shields, T. P., Jenison, R. D., Wick, C. L., & Pardi, A. (1998) A Semiconserved Residue Inhibits Complex Formation by Stabilizing Interactions in the Free State of a Theophylline-Binding RNA. Biochemistry 37, 9186- 9192. Hermann, T. & Patel, D. J. (2000) Adaptive Recognition by Nucleic Acid Aptamers. Science 287, 820-825. Fan, P., Suri, A. K., Fiala, R., Live, D., & Patel, D. J. (1996) Molecular Recognition in the FMN RNA Aptamer Complex. Journal of Molecular Biology 258, 480-500. Lin, C. H. & Patel, D. J. (1997) Structural Basis of DNA Folding and Recognition in an AMP-DNA Aptamer Complex: Distinct Architectures but Common Recognition Motifs for DNA and RNA Aptamers Complexed to AMP. Chemistry and Biology 4, 817. Woese, C. R., Winker, S., & Gutell, R. R. (1990) Architecture of Ribosomal RNA: Constraints on the Sequence of "Tetra-Loops". Proceedings of the National Academy of Sciences of the United States of America 87, 8467-8471. Heus, H. A. & Pardi, A. (1991) Structural Features that Give Rise to the Unusual Stability of RNA Hairpins Containing GNRA Loops. Science 253, 181. Yang, Y., Kochoyan, M., Burgstaller, P., Westhof, E., & Famulok, M. (1996) Structural Basis of Ligand Discrimination by Two Related RNA Aptamers Resolved by NMR Spectroscopy. Science 272, 1343. Bock, L. C., Griffin, C. C., Latham, J. A., Verrnass, E. H., & Toole, J. J. (1992) Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature 355, 564-568. Macaya, R. F., Schultze, P., Smith, F. W., Roe, J. A., & Feigon, J. (1993) Thrombin-Binding DNA Aptamer Forms a Unimolecular Quadruplex Structure in Solution. Proceedings of the National Academy of Sciences of the United States of America 90, 3745-3749. 79 136. 137. 138. 139. 140. 141. 142. 143. 144. 145. 146. 147. Wang, K. Y., McCurdy, S. N., Shea, R. G., Swaminathan, S., & Bolton, P. H. (1993) A DNA aptamer which binds to and inhibits thrombin exhibits a new structural motif for DNA. Biochemistry 32, 1899-1904. Schultze, P., Macaya, R. F., & Feigon, J. (1994) Three-dimensional Solution Structure of the Thrombin-binding DNA Aptamer. Journal of Molecular Biology 235, 1532. Padmanaphan, K., Padmanaphan, K. P., Ferrara, J. D., Sadler, J. E., & Tulinsky, A. J. (1993) The Structure of -Thrombin Inhibited by a 15-Mer Single-Stranded DNA Aptamer. Journal of Biological Chemistry 268, 17651-17654. Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993) Selective optimization of the Rev-binding element of HIV-1. Nucleic Acids Research 23, 5509-5516. Xu, W. & Ellington, A. D. (1996) Anti-peptide Aptamers Recognize Amino Acid Sequence and Bind a Protein Epitope. Proceedings of the National Academy of Sciences of the United States of America 93, 7475-7480. Ye, X., Gorin, A., Ellington, A. D., & Patel, D. J. (1996) Deep Penetration of and Alpha-Helix into a Widened RNA Major Groove in the HIV-1 Rev Peptide-RNA Aptamer Complex. Nature Structure Biology 3, 1026. Ye, X., Gorin, A., Frederick, R., Hu, W., Majumdar, A., Xu, W., McLendon, G., Ellington, A. D., & Patel, D. J. (1999) RNA Architecture Dictates the Conformations of a Bound Peptide. Chemistry & Biology 6, 557 Jiang, F., Gorin, A., Hu, W., Maumdar, A., Baskerville, S., Xu, W., Ellington, A. D., & Patel, D. J. (1999) Anchoring an Extended HTLV-1 Rex Peptide Within an RNA Major Groove Containing Junctional Base Triples. Structure 7, 1461-1472. Convery, M. A., Rowsell S., Stonehouse, N. J., Ellington, A. D., Hirao, I., Murray, J. B., Peabody, D. S., Phillips, S. E., & Stockley P. G. (1998) Crystal Structure of an RNA Aptamer-Protein Complex at 2.8 A Resolution. Nature Structure Biology 5, 133-139. Rowsell, S., Stonehouse, N. J., Convery M. A., Adams, C. J., Ellington, A. D., Hirao, I., Peabody, D. S., Stockley, P. G., & Phillips, S. E. (1998) Crystal Structure of a Series of RNA Aptamers Complexed to the Same Protein Target. Nature Structure Biology 5, 970-975. Macaya, R. F., Schultze, P., Smith, F. W., Roe, J. A., & Feigon, J. (1993) Thrombin-Binding DNA Aptamer Forms a Unimolecular Quadruplex Structure in 80 148. 149. 150. 151. 152. 153. 154. 155. 156. 157. Solution. Proceedings of the National Academy of Sciences of the United States of America 90, 3745-3749. 158. Wang, K. Y., McCurdy, S. N., Shea, R. G., Swaminathan, S., & Bolton, P. H. (1993) A DNA aptamer which binds to and inhibits thrombin exhibits a new structural motif for DNA. Biochemistry 32, 1899-1904. Tan, R., Chen, L., Buettner, J. A.; Hudson, D., & Frankel, A. D. (1993) RNA Recognition by an Isolated Alpha Helix. Cell 73, 1031-1040. Battiste, J. L., Mao, H., Rao, N. S., Tan, R., Muhandiram, D. R., Kay, L. E., Frankel, A. D., & Williamson, J. R. (1996) Helix-RNA Major Groove Recognition in an HIV-1 Rev Peptide-RRE RNA Complex. Science 273, 1547. Hermann, T., & Westhof, E. (1999) Non-Watson-Crick Base Pairs in RNAProtein Recognition. Chemistry & Biology 6, R335. Borer, P. N., Lin, Y., Wang, S., Roggenbuck, M. W., Gott, J. M., Uhlenbeck, O. C., & Pelczer, I. (1995) Proton NMR and Structural Features of a 24-Nucleotide RNA Hairpin. Biochemistry 34, 6488. Uhlenbeck, O. C. (1998) A Coat for All Sequences. Nature Structure Biology 5, 174-176. Valegard, K. et al. (1997) The three-dimensional structures of two complexes between recombinant MS2 capsids and RNA operator fragments reveal sequencespecific protein-RNA interactions. Journal of Molecular Biology 270, 724-738. Valegard, K., Murray, J. B., Stockley, P. G., Stone-house, N. J., & Liljas, L. (1994) Crystal Structure of an RNA Bacteriophage Coat Protein-Operator Complex. Nature 371, 623-626. Patel, D. J. (1999) Adaptive Recognition in RNA Complexes with Peptides and protein Molecules. Current Opinions in Structural Biology 9, 74. Puglisi, J. D., Williamson, J. R. (1999) in The RNA World, Gesteland, R. F., Cech, T. R., Atkins, J. F. Eds. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2nd ed., pp. 403-425. Puglisi, J. D., Chen, L., Blanchard, S., & Frankel, A. D. (1995) Solution Structure of a Bovine Immunodeficiency Virus Tat-TAR Peptide-RNA Complex. Science 270, 1200. 159. 160. 161. 162. 163. 164. 165. 166. 167. 168. 81 169. Ye, X., Kumar, R. A., & Patel, D. J. (1995) Molecular Recognition in the Bovine Immunodeficiency Virus Tat Peptide-TAR RNA Complex. Chemistry & Biology 2, 827 Starikov, E. B. & Nilsson, L. (2002) Structural Basis of Biotin-RNA Aptamer Binding: A Theoretical Study. Chemistry & Physics Letters 363, 39-44. Fang, X., Cao, Z., Beck, T., & Tan, W. (2001) Molecular Aptamer for Real-Time Oncoprotein Platelet-Derived Growth Factor Monitoring by Fluorescence Anisotropy. Analytical Chemistry 73, 5752-5757. Babendure, J. R., Adams, S. R., & Tsien, R. (2003) Aptamers Switch on Fluorescence of Triphenylmethane Dyes. Journal of the American Chemical Society 125, 14716-14717. Merino, E. J. & Weeks, K. M. (2003) Fluorogenic Resolution of Ligand Binding by a Nucleic Acid Aptamer. Journal of the American Chemical Society 125, 12370-12371. Luzi, E., Minummi, M., Tombelli, S., & Mascini, M. (2003) New Trends in Affinity Sensing Aptamers for Ligand binding. Trends in Analytical Chemistry 22, 810-818. Stojanovic, M. N. & Landry, D. W. (2002) Aptamer-Based Colorimetric Probe for Cocaine. Journal of the American Chemical Society 124, 9678-9679. Ding, Y., Hofstadler, S. A., Swayze, E. E., Risen, L., & Griffey, H. (2003) Design and Synthesis of Paromomycin-Related Heterocycle-Substituted Aminoglycoside Mimetics Based on a Mass Spectrometry RNA-Binding Assay. Angewandte Chemie International Edition in English 42, 3409-3412. Michael, K. & Tor, Y. (1998) Designing Novel RNA Binders. Chemistry: A European Journal 4, 2091-2098. Davis, K. A., Abrams, B., Lin, Y., & Jayasena, S. D. (1996) Use of a high affinity DNA ligand in flow cytometry. Nucleic Acids Research 24, 702-706. Davis, K. A., Abrams, B.; Lin, Y., & Jayasena, S. D. (1998) Staining of cell surface human CD4 with 2'-F-pyrimidine-containing RNA aptamers for flow cytometry. Nucleic Acids Research 26, 3915-3924. Srisawat, C. & Engelke, D. R. (2002) Streptavidin Aptamers: Affinity Tags for the Study of RNAs and Ribonucleoprotein. Methods 26, 156- 161. 170. 171. 172. 173. 174. 175. 176. 177. 178. 179. 180. 82 181. Deng, Q., Watson, C. J., & Kennedy, R. T. (2003) Aptamer affinity chromatography for rapid assay of adenosine in microdialysis samples collected in vivo. Journal of Chromatography A 1005, 123-130. Kleinjung, F., Klussmann, S., Erdmann, V. A., Scheller, F. W., Furste, J. P., & Bier, F. F. (1998) High-Affinity RNA as a Recognition Element in a Biosensor. Analytical Chemistry 70, 328-331. Potyrailo, R. A., Conrad, R. C., Ellington, A. D., & Hieftje, G. M. (1998) Adapting Selected Nucleic Acid Ligands (Aptamers) to Biosensors. Analytical Chemistry 70, 3419-3425. German, I., Buchanan, D. D., & Kennedy, R. T. (1998) Aptamers as Ligands in Affinity Probe Capillary Electrophoresis. Analytical Chemistry 70, 4540-4545. Kotia, R. B., Li, L., & McGown, L. B. (2000) Separation of Nontarget Compounds by DNA Aptamers. Analytical Chemistry 72, 827-831. Romig, T. S., Bell, C., & Drolet, D. W. (1999) Aptamer Affinity Chromatography: Combinatorial Chemistry applied to Protein Purification. Journal of Chromatography B 731, 275-284. Deng, Q., German, I., Buchanan, D., & Kennedy, R. (2001) Retention and Separation of Adenosine and Analogues by Affinity Chromatography with an Aptamer Stationary Phase. Analytical Chemistry 73, 5415-5421. Rehder, M. A. & McGown, L. B. (2001) Open-tubular Capillary Electrochromatography of Bovine Beta-Lactoglobulin Variants A and B Using an Aptamer Stationary Phase. Electrophoresis 22, 3759-3764. Pavski, V. & Le, X. C. (2001) Detection of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Using Aptamers as Probes in Affinity Capillary Electrophoresis. Analytical Chemistry 73, 6070-6076. Michaud, M., Jourdan, E., Villet, A., Ravel A., Grosset, C., & Peyrin, E. (2003) A DNA Aptamer as a New Target-Specific Chiral Selector for HPLC. Journal of the American Chemical Society 125, 8672-8679. Michaud, M., Jourdan, E., Ravelet, C., Villet, A., Ravel, A., grosset, C., & Peyrin, E. (2004) Immobilized DNA Aptamers as Target-Specific Chiral Stationary Phases for Resolution of Nucleoside and Amino Acid Derivative Enantiomers. Analytical Chemistry 76, 1015-1020. 182. 183. 184. 185. 186. 187. 188. 189. 190. 191. 83 192. Murphy, M. B., Fuller, S. T., Richardson, P. M., & Doyle, S. A. (2003) Nucleic Acids Research An improved method for the in vitro evolution of aptamers and applications in protein detection and purification. 31, e110. Gold, L., Brown, D., He, Y. Y., Shtatland, T., Singer, B. S., & Wu, Y. (1997) From Oligonucleotide Shapes to Genomic SELEX: Novel Biological Regulatory Loops. Proceedings of the National Academy of Sciences of the United States of America 1997, 94, 59-64. Gold, L., Polisky, B., Uhlenbeck, O., & Yarus, M. (1995) Diversity of Oligonucleotide Functions. Annual Reviews in Biochemistry 64, 763-797. Keene, J. D. (1996) RNA Surfaces as Functional Mimetics of Proteins. Chemistry & Biology 3, 505-513. Gold, L., Singer, B., He Y.-Y., & Brody, E. (1997) SELEX and the Evolution of Genomics Current Opinion in Genetics & Development 7, 848-851. Singer, B. S., Shtatland, T., Brown, D., & Gold, L. (1997) Libraries for genomic SELEX. Nucleic Acids Research 25, 781-786. Brody, E. N. & Gold, L. (2000) Aptamers as Therapeutic and Diagnostic Agents. Reviews in Molecular Biotechnology 74, 5-13. Jayasena, S. D. (1999) Aptamers: An Emerging Class of Molecules that Rival Antibodies in Diagnostics. Clinical Chemistry 45, 1628-1650. Walter, G., Bussow, K., Lueking, A., & Glokler, J. (2002) Protein Arrays for Gene Expression and Molecular Interaction Screening. Trends in Molecular Medicine 8, 250-253. Eulberg, D. & Klussmann, S. (2003) Spiegelmers: Biostable Aptamers. ChemBiochem 4, 979-983. Pieken, W. A., Olsen, D. B., Benseler, F., Aurup, H., & Eckstein, F. (1991) Structure-Function Relationship of Hammerhead Ribozymes as Probed by 2'Modifications. Science 253, 314- 317. Lin, Y., Qiu, Q., Gill, S. C., & Yayasen, S. D. (1994) Modified RNA sequence pools for in vitro selection. Nucleic Acids Research 22, 5229- 5234. Gold, L., Polisky, B., Uhlenbeck, O., & Yarus, M. (1995) Diversity of Oligonucleotide Functions. Annual Review of Biochemistry 64, 763-797. 193. 194. 195. 196. 197. 198. 199. 200. 201. 202. 203. 204. 84 205. Green, L. S., Jellinek, D., Bell, C., Beebe, L. A., Feistner, B. D., Gill, S. C. Jucker, F. M., & Janjic, N. (1995) Nuclease-Resistant Nucleic Acid Ligands to Vascular Permeability Factor/Vascular Endothelial Growth Factor. Chemistry & Biology 2, 683- 695. Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellineck, D., & Dang, C. (1997) Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA Inhibitors of Keratinocyte Growth Factor. Nature Biotechnology 15, 68-73. Kubik, M. F., Bell, C., Fitzwater, T., Watson, S. R., & Tasset, D. M. (1997) Isolation and characterization of 2'-fluoro-, 2'-amino-, and 2'-fluoro- /aminomodified RNA ligands to human IFN-gamma that inhibit receptor binding. Journal of Immunology 159, 259-267. Jellineck, D., Green, L. S., Bell, C., Lynott, C. K., Gill, N., Vargeese, C.; Kirschenheuter, G., McGee, D. P. C., Abesinghe, P., Pieken, W. A., Shapiro, R., Rifkin, D. B., Moscatelli, D., & Janjic, N. (1995) Potent 2'-Amino-2'deoxypyrimidine RNA Inhibitors of Basic Fibroblast Growth Factor. Biochemistry 34, 11363-11372. Wiegand, T. W., Williams, P. B., Dreskin, S. C., Jouvin, M. H., Kinet, J. P., & Tasset, D. (1996) High-affinity oligonucleotide ligands to human IgE inhibit binding to Fc epsilon receptor I. The Journal of Immunology 157, 221-230. Kubik, M. F., Bell, C., Fitzwater, T., Watson, S. R., & Tasset, D. M. (1997) Isolation and characterization of 2'-fluoro-, 2'-amino-, and 2'-fluoro- /aminomodified RNA ligands to human IFN-gamma that inhibit receptor binding. The Journal of Immunology 159, 259-267. Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., et al. (1997) Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA Inhibitors of Keratinocyte Growth Factor. Nature Biotechnology 15, 68-73. Hicke, B. J., Watson, S. R., Koenig, A., Lynott, C. K., Bargatze, R. F., et al. (1996) DNA Aptamers Block L-Selectin Function In Vivo . Inhibition of Human Lymphocyte Trafficking in SCID Mice. Journal of Clinical Investigation 98, 2688-2692. Gold, L., Brown, D., He, Y. Y., Shtatland, T., Singer, B. S., & Wu, Y. (1997) From Oligonucleotide Shapes to Genomic SELEX: Novel Biological Regulatory Loops. Proceedings of the National Academy of Sciences of the United States of America 94, 59-64. Gold, L. (1995) Oligonucleotides as Research, Diagnostic, and Therapeutic Agents. Journal of Biological Chemistry 270, 13581-13584. 85 206. 207. 208. 209. 210. 211. 212. 213. 214. 215. Willis, M. C., Collins, B., Zhang, T., Green, L. S., Sebesta, P., Bell, C., Kellogg, E., Gill, S. C., Magallanez, A., Knauer, S., Bendele, R. A., Gill, P. S., & Janic, N. (1998) Liposome-Anchored Vascular Endothelial Growth Factor Aptamers. Bioconjugate Chemistry 9, 573-582. Williams, K. P., Liu, X.-H., Schumacher, T. N. M., Lin, H. Y., Ausiello, D. A., et al., (1997) Bioactive and Nuclease-Resistant L-DNA Ligand of Vasopressin. Proceedings of the National Academy of Sciences of the United States of America 94, 11285-11290. Klussmann, S., Nolte, A., Bald, R., Erdmann, V. A., & Furste, J. P. (1996) Mirror-Image RNA that Binds D-Adenosine. Nature Biotechnology 14, 11121115. Nolte, A., Klussmann, S., Bald, R., Erdmann, V. A., & Furste, J. P. (1996) Mirror-Design of L-Oligonucleotide Ligands binding to L-Arginine. Nature Biotechnology 14, 1116-1119. Charlton, J., Kirschenheuter, G. P., & Smith, D. (1997) Highly Potent Irreversible Inhibitors of Neutrophil Elastase Generated by Selection from a Randomized DNA-Valine Phosphonate Library. Biochemistry 36, 3018-3026. Hicke, B. J. & Stephens, A. W. (2000) Escort aptamers: a delivery service for diagnosis and therapy. Journal of Clinical Investigation 106, 923-928. Cerchia, L., Hamm, J., Libri, D., Tavitian, B., & Fransciscis, V. D. (2002) Nucleic acid aptamers in cancer medicine. FEBS Letters 528, 12-16. Martell, R. E., Nevins, J. R., & Sullenger, B. A. (2002) Optimizing Aptamer Activity for Gene Therapy Applications Using Expression Cassette SELEX. Molecular Therapy 6, 30-34. Wu, C. C. N., Castro, J. E., Motta, M., Cottam, H. B., Kyburz, D., Kipps, T. J., Corr, M., & Carson, D. A. (2003) Selection of Oligonucleotide Aptamers with Enhanced Uptake and Activation of Human Leukemia B Cells. Human Gene Therapy 14, 849-860. Ylera, F., Lurz, R., Erdmann, V. A., & Furste, J. P. (2002) Selection of RNA Aptamers to the Alzheimer's Disease Amyloid Peptide. Biochemical and Biophysical Research Communications 290, 1583-1588. Ulrich, H., Magdesian, M. H., Alves, M. J. M. & Colli, W. (2002) In Vitro Selection of RNA Aptamers That Bind to Cell Adhesion Receptors of 86 216. 217. 218. 219. 220. 221. 222. 223. 224. 225. Trypanosoma cruzi and Inhibit Cell Invasion. Journal of Biological Chemistry 277, 20756-20762. 226. Chaloin, L., Lehmann, M. J., Sczakiel, G., & Restle, T. (2002) Endogenous expression of a high-affinity pseudoknot RNA aptamer suppresses replication of HIV-1. Nucleic Acids Research 30, 4001-4008. Nickens, D. G., Patterson, J. T., & Burke, D. H. (2003) Inhibition of HIV-1 reverse transcriptase by RNA aptamers in Escherichia coli. RNA 9, 1029-1033. Darfeuille, F., Arzumanov, A., Gait, M. J., Primo, C. D., & Toulme, J.-J. (2002) 2'-O-Methyl-RNA Hairpins Generate Loop-Loop Complexes and Selectively Inhibit HIV-1 Tat-Mediated Transcription. Biochemistry 41, 12186-12192. Ito, Y., Suzuki, A., Kawazoe, N., & Imanishi, Y. (2001) In Vitro Selection of RNA Aptamers Carrying Multiple Biotin Groups in the Side Chains. Bioconjuate Chemistry 12, 850-854. Cox, J. C. & Ellington, A. D. (2001) Automated selection of anti-Protein aptamers. Bioorganic & Medicinal Chemistry 9, 2528-2531. Cox, J. C., Hayhurst, A., Hasselberth, J., Bayer, T. S., Georgiou, G., & Ellington, A. D. (2002) Automated selection of aptamers against protein targets translated in vitro: from gene to aptamer. Nucleic Acids Research 30, e108. Lato, S. M., Ozerova, N. D. S., He, K., Sergueeva, Z., Shaw, B. R., & Burke, D. H. (2002) Boron-containing aptamers to ATP. Nucleic Acids Research 30, 14011407. Heegaard, N. H. H. (2001) In Protein- Ligand interactions: hydrodynamics and calorimetry Harding, S. E. Chowdhry, B. Z. Eds., Oxford University Press: Oxford, New York pp 171-195. Mendonsa, S. D. & Bowser, M. T. (2004) In Vitro Evolution of Functional DNA Using Capillary Electrophoresis. Journal of the American Chemical Society 126, 20-21. Moreno, M., Rincon, E., Pineiro, D., Fernandez, G., Domingo, A., Jimenez-Ruiz, A., Salinas, M., & Gonzalez, V. M. (2003) Selection of aptamers against KMP-11 using colloidal gold during the SELEX process. Biochemical and Biophysical Research Communications 308, 214- 218. White, R., Rusconi, C., Scardino, E., Wolberg, J. L., Hoffman, M., & Sullenger, B. (2001) Generation of Species Cross-reactive Aptamers Using "Toggle" SELEX. Molecular Therapy 4, 567-573. 87 227. 228. 229. 230. 231. 232. 233. 234. 235. 236. 237. 238. Hamaguch, N., Ellington, A. & Stanton, M. (2001) Aptamer Beacons for the Direct Detection of Proteins. Analytical Biochemistry 294, 126-131. Li, J. J., Fang & X., Tan, W. (2002) Molecular Aptamer Beacons for Real-Time Protein Recognition. Biochemical and Biophysical Research Communications 292, 31-40. Rajendran, M. & Ellington, A. D. (2003) In vitro selection of molecular beacons. Nucleic Acids Research 31, 5700-5713. Jhaveri, S., Rajendran, M., & Ellington, A. D. (2000) In vitro selection of signaling aptamers. Nature Biotechnology 18, 1293-1297. Fang, X., Sen, A., Vicens, M., & Tan, W. (2003) Synthetic DNA Aptamers to Detect Protein Molecular Variants in a High-Throughput Fluorescence Quenching Assay. ChemBioChem 4, 829-834. Toume, J.-J., Darfeuille, F., Kolb, G., Chabas, S., & Staedel, C. (2003) Modulating Viral Gene Expression by Aptamers to RNA Structures. Biology of the Cells 95, 229-238. Vuyisich, M. & Beal, P. A. (2002) Regulation of the RNA-Dependent Protein Kinase by Triple Helix Formation. Chemistry & Biology 9, 907-913. Rusconi, C. P., Scardino, E., Layzer, J., Pitoc, G. A., Ortel, T. L., Monroe, D., & Sullenger, B. A. (2002) RNA aptamers as reversible antagonists of coagulation factor IXa. Nature 419, 90-94. McCauley, T. G., Hamaguchi, N., & Stanton, M. (2003) Aptamer-based biosensor arrays for detection and quantification of biological macromolecules. Analytical Biochemistry 319, 244-250. Yamana, K., Ohtani, Y., Nakano, H., Nakano, H., & Saito, I. (2003) Bioorganic & Medicinal Chemistry Letters Bis-pyrene labeled DNA aptamer as an intelligent fluorescent biosensor. 13, 3429-3431. Lozupone, C., Changayil, S., Majerfeld, I., & Yarus, M. (2003) Selection of the simplest RNA that binds isoleucine. RNA 9, 1315-1322. Liss, M., Peterson, B., Wolf, H., & Prohaska, E. (2002) An Aptamer-Based Quartz Crystal Protein Biosensor. Analytical Chemistry 74, 4488-4495. 239. 240. 241. 242. 243. 244. 245. 246. 247. 248. 88 249. Lu, Y., Liu, J., Li, J., Bruesehoff, P. J., Pavot, C. M.-B., & Brown, A. K. (2003) New highly sensitive and selective catalytic DNA biosensors for metal ions. Biosensors and Bioelectronics 18, 529-540. Borman, S. (2000) Catalytic DNA Used to Make Lead Biosensor. Chemical & Engineering News 78, 9-10. 250. 89 CHAPTER 2: IN VITRO SELECTION AND ANALYSIS OF AMINOGLYCOSIDE APTAMERS TO UNDERSTAND SEQUENCE SPECIFIC MOLECULAR RECOGNITION 2.0 INTRODUCTION Aminoglycoside antibiotics are natural products that block prokaryotic protein synthesis. Their ability to non-specifically bind RNA through electrostatic interactions was described over 20 years ago.1 The aminoglycosides are also capable of site-specific recognition of prokaryotic rRNA as illustrated by some footprinting experiments.2 It was found that aminoglycosides increase the affinity of tRNA to the ribosomal A-site,3 thus providing an attractive mechanism to explain their ability to decrease the fidelity of prokaryotic translation.4 A recent crystal structure of streptomycin, paromomycin, and spectinomycin bound to the Thermus thermophilus 30S ribosomal subunit confirms the location of the distinct binding sites and provided an illustration of how natural RNAaminoglycoside recognition occurs within a ribonucleoprotein complex.5 Most of the successful antibiotics are losing their potential since bacteria have acquired resistance genes.6 The structural and functional understandings as well as the sequence specific molecular recognition between the aminoglycosides and its target site allow us to design novel and more effective antibiotics that will have an improved fit within their ribosomal binding pockets. However, structural information cannot answer basic energetic questions involved in the binding of small molecules to the nucleic acids. For this purpose, equilibrium binding constants must be measured.6 90 Though there are groups who have isolated the RNA aptamers against kanamycin A,7 there are no reports on the isolation of ssDNA aptamers against kanamycin A or tobramycin. In this chapter, we will look at our findings on the RNA and ssDNA aptamers against kanamycin A as well as the ssDNA aptamer against tobramycin. We will compare the binding affinities of the RNA aptamer and ssDNA aptamer against kanamycin A. In addition, we will examine the sequences of the aptamers selected to understand the role of functional groups on sequence specific molecular recognition. It was previously shown that tobramycin is a better binder of natural RNA than kanamycin A due to the additional ammonium group and one less hydroxyl group.8 We will examine if this holds true in the case of aptamers. Finally, we show that these aptamers can be labeled with a fluorophore to carry out titrations to measure the Kds. However, at first, we will look at the role of aminoglycosides in living systems, the mode of aminoglycoside binding to natural nucleic acids and aptamers, and the use of fluorescence in measuring equilibrium constants between nucleic acids and their ligands. 2.1. ROLES OF AMINOGLYCOSIDES IN LIVING SYSTEMS In nature, aminoglycosides bind to various natural nucleic acids, inhibiting numerous cellular functions. Here, we will look at these inhibitory roles of aminoglycosides. The structures of numerous natural RNA- aminoglycoside complexes have been solved. As we go along, we will analyze some of these structures to understand the molecular recognition. 2.1.1 Aminoglycosides in Protein Synthesis Translation of mRNA into proteins requires the decoding of the genetic information, a process taking place at ribosomes.9 The fidelity of aminoacyl-tRNA 91 selection involves an initial selection and proofreading by the ribosome.10 Aminoglycosides interact with distinct sites in the 16S rRNA and disturb the decoding process and induce misreading of the genetic code.11,12 During decoding, the anticodon triplet pairs with its cognate codon on the mRNA and protects bases on 16S rRNA from chemical modification in the same region as the aminoglycosides. The decoding site is composed of nucleotides 1400-1410 and 1490-1500, which form a stem-loop-stem structure also known as the A-site of E. coli 16S rRNA. (Figure 2.1) Decoding is achieved by the interaction of the A-site with the backbone of the codon-anticodon helix, thereby protecting positions N1 of A1492 and A1493 from chemical modification.11 Mutating these positions to G is deleterious to tRNA binding, but can be compensated by 2' fluorine substitutions in the mRNA codon.13 Recent X-ray structure of the 30S and 70S complexes of Thermus thermophilus ribosomes give a three-dimensional picture, visualizing the decoding site in the ribosome architecture.14,15 The resolution of these structures was not high enough to analyze the contacts between the aminoglycosides and the decoding site. In an alternative method, the solution structure of a subdomain of the E.coli 16S rRNA complexed with aminoglycoside antibiotics was solved using NMR. Large RNAs are often composed of small domains that have the ability to fold into autonomous units enabling the dissection into small RNAs, as demonstrated with the decoding site of 16S rRNA.16,17 The NMR structure of a model A-site complexed with the aminoglycoside antibiotics paromomycin, neomycin B, and gentamycin was therefore carried out.17, 18 92 Figure 2.1: The secondary structure of the A-site RNA. The bases that are protected by chemical modification by neomycin-class antibiotics are indicated by the triangles. The asymmetric internal loop is the antibiotic-binding site. It is closed by the WatsonCrick base pair C1407-G1494 and by the non-canonical base pairs U1406-U1495 and A1408-A1493. The upper and lower stems are thus connected by a continuous but disturbed helix, which displays a widened major groove facilitating docking of the antibiotics. Although antibiotics have been used therapeutically for decades, it was not until recently that RNA was recognized as their target.19, 20 The mode of action of these antibiotics is poorly understood. Antibiotics that interfere with translation most often bind to ribosomal RNA. Many of these antibiotic translation inhibitors bind with an exceptional lack of specificity.21 One way to study the mode of action of RNA-binding antibiotics is to determine the structure of RNA-antibiotic complexes.22 Since naturally occurring target sites of RNA- binding antibiotics are too large, RNA-antibiotic interactions may be studied by reducing the length of the RNA. This can be achieved by dissecting the natural RNA to the antibiotic RNA-binding domain23 and through SELEX. 93 Aptamers have been selected against aminoglycosides tobramycin,24 lividomycin and kanamycin A,25 neomycin B,26 streptomycin,27 the peptide antibiotic viomycin,28 and chloramphenicol.29 Aptamer- aminoglycoside interactions on a structural level will be examined in detail later on in this chapter. 2.1.2 Aminoglycosides in Ribozyme Inhibition Aminoglycosides can also inhibit the activity of several ribozymes in vitro. Group I intron self-splicing,30 self-cleavage of the hammerhead,31 and the human hepatitis delta virus (HDV) ribozymes,32,33 the magnesium-induced self-cleavage reaction of the hairpin ribozyme,34 and the tRNA processing activity of RNase P RNA35 are all inhibited by the same aminoglycosides, mostly by neomycin B and tobramycin. In the case of inhibition of hammerhead ribozyme, neomycin B competes with a Mg++ and the inhibition is pH dependent, leading to the belief that the protanation of the amino groups in the aminoglycoside are important in inhibitory activity.36 The three dimensional structure of the hammerhead ribozyme in complex with the aminoglycoside37 gave insight into the binding. It showed a complementarity between positively charged amino groups of the aminoglycosides and the Mg++ binding site in the ribozyme core, suggesting that the bound neomycin B displaces numerous essential Mg++ from the catalytic core.38 The amino groups of neomycin B are also found to be important in inhibition of group I td intron splicing. Paromomycin, which differs from neomycin B at one position (change of one amino group to a hydroxyl group) is 100-fold less efficient in inhibiting splicing. The same can be said about several other similar aminoglycosides.39 Structural studies with sunY group I intron and neomycin B has shown that more than one 94 aminoglycoside molecule is bound to the RNA40 Backbone cleavage was prevented in the presence of neomycin B at the bulged nucleotide of the P7 stem in the core of the td intron. The mutation studies at these sites revealed an essential contact site between the aminoglycoside and the intron RNA.41 From the structural model studies, it was learned that the neomycin B is docked into the core of the intron.42,43 Figure 2.2 shows the three dimensional model of the intron bound to neomycin B.44 The docking of neomycin B into the ribozyme core demonstrate the overlap between the amino groups of neomycin B and the metal ions. The interactions between natural nucleic acids and aminoglycosides will be examined in more details in the next section. Figure 2.2: The three dimensional model of the td intron bound to Neomycin B. It shows the highlighted charged regions and two proposed metal ions. Negative surface charges are in red and positive surface charge is in blue. The metal ions in the ribozyme core are in green and neomycin B is in yellow. 95 2.1.3 Other Roles of Aminoglycosides in RNA Binding Aminoglycosides can also act as modulators. Streptomycin, for example, influences translation by increasing the translational errors.45 There has also been report of aminoglycosides promoting the cleavage reaction of the hairpin ribozyme in the absence of metal ions. Since, the divalent metal ion is necessary for the folding of the RNA, but not for the cleavage function, neomycin B can substitute the metal ion and thus stongly stimulate the cleavage activity.46, 47 Furthermore, these antibiotics interfere with human immunodeficiency virus (HIV) replication by disrupting essential RNA-protein contacts.48, 49 2.2 MODE OF AMINOGLYCOSIDE BINDING The flexibility of the aminoglycosides aids their accommodation into a binding pocket within internal loops of RNA helices or into ribozyme cores for making specific contacts. The majority of the aminoglycosides are composed of amino sugars linked to a 2-deoxystreptamine ring (ring II) (see structure below). The conserved elements among aminoglycosides are rings I and II and, within ring II, the ammonium groups at positions 1 and 3. These elements are essential for binding to the decoding site of the 16S rRNA. The 2-deoxystreptamine ring is substituted.48 Kanamycin A (2.1) differs from tobramycin (2.2) only at two positions. Tobramycin has an additional ammonium group and one less hydroxyl group. 96 OH HO H3 N O HO R1 R2 O O NH3 OH III I OH O H3N NH3 II R1 R2 Kanamycin A (2.1) OH OH Tobramycin (2.2) H NH3 Tobramycin binds to the RNA major groove at a stem-loop junction where the major groove and a bulged cytosine sandwich the bound antibiotic.50, 51 A wider major groove in a stem with the loop consensus GNRNA was found as the binding motif for neomycin, while a pseudoknot structure was found for the binding viomycin. For streptomycin, a conformational change of the aptamer was observed upon binding to the target. The knowledge about the molecular recognition of antibiotics by RNA will lead to the design and development of drugs that might escape resistance factors.50, 51 The hallmarks of molecular recognition between aminoglycosides and natural nucleic acids52 have been revealed by three-dimensional solution structures of ribosomal 16S A-site RNA constructs bound to paromomycin53 and gentamicin,54 and of RNA aptamers in complex with tobramycin,55, 56 and neomycin B.57 Despite the differences in the sequences and secondary structures of the aminoglycoside aptamer RNAs, many key features of the ligand-RNA interaction are conserved. The hydrophobic face of the alicyclic ring in both tobramycin and neomycin packs against the floor of the deep groove, aligned by non-Watson-Crick pairs and flanked by a single-stranded loop, which folds over the ligand in all three complexes.52 Binding of aminoglycosides to a 27mer A-site RNA containing their target site was found to result in the same footprint pattern as in the ribosome context.56 The NMR 97 structure of this RNA in complex with either paromomycin or with gentamycin is shown in Figure 2.3. The aminoglycoside-binding pocket is created by the base pair A1408A1493 and by the single bulged adenine A1492. The rings I and II of the In the complexes with aminoglycosides establish specific contacts with the RNA. paromomycin and gentamycin, ring I is stacked upon G1491 and ring II spans the base pairs U1406-U1495 and C1407-G1494. Rings III of these two aminoglycosides are positioned differently. Binding of the aminoglycosides to the RNA induces a conformational change in the RNA, displacing the two universally conserved residues A1492 and A1493 towards the minor groove, thereby probably switching the A-site into a high affinity state for mRNA-tRNA recognition and reducing the rejection rate of nearcognate tRNAs.57,58 The two conserved adenines seem to be pre-positioned by the aminoglycosides to contact the backbone of the codon-anticodon complex. This increased the affinity of the A-site for tRNAs in the presence of aminoglycosides might result in misreading of the genetic code. The decoding site might be an irregular helix that binds antibiotics via its major grove and might contact the codon-anticodon complex via its minor groove.54 The first evidence that the backbone of the codon-anticodon complex is contacted via the 2' hydroxyls in the mRNA for tRNA binding.59 This contact was demonstrated by the rescue of mutations in the A-site by 2' modification of the codon, suggesting a minor groove-minor groove interaction between the decoding site and the codon-anticodon duplex.60 98 Figure 2.3: NMR solution structures of E. coli decoding site of the 16S rRNA. (left) The A-sidte RNA complexed with paromomycin (in gold). (right) Gentamycin C1a (in red) bound to the A-site RNA.57,58 2.2.1 Types of Interactions When searching for common features in group I introns and in rRNA that explains their common inhibitors, scientists came across functional similarity between the decoding process and the binding of the slice site to the intron core. Both processes involve the docking of an RNA helix into a conserved internal asymmetric RNA loop.61 It became evident that both inhibitory mechanisms of aminoglycosides on decoding and self-splicing are very different. While the antibiotic-binding site in the decoding site consists of a helical domain with a widened major groove, the aminoglycoside binding site in ribozymes is a complex metal ion-containing pocket, surrounded by more than two 99 RNA strands. Thus, it was proposed that there are two types of aminoglycoside binding sites. The first consists of asymmetrical internal loops as in the decoding site54 in the RRE and Tar domains of HIV 62, 63 and in several aptamers. The second type of binding site is the metal ion binding pocket as found in the catalytic core of ribozymes. In the first type of binding sites, the mode of action is through a slight distortion of the RNA structure and interference with the binding of the functional substrate. In the second type, the aminoglycosides displaces the divalent metal ions. It was also learned that the ability of the aminoglycoside to bind to the RNA is significantly different in vitro and in vivo.64,65 2.2.2 Aminoglycoside- Aptamer Interactions As seen in Chapter 1, through the analysis of the NMR structure complexes of aminoglycosides and their aptamers, it was evident that though there are various types of binding pockets for aminoglycoside-RNA interactions, there are common features to these bindings. The aptamers exhibit a type I binding sites since they contain widened major grooves and are able to bind the aminoglycosides in vivo.66 In all the structurally characterized aminoglycoside aptamers, as well as the 16S rRNA decoding site, the ligands lie in the major groove site of an irregular helix. Aminoglycosides cannot bind to the major groove of a regular A-type RNA helix, because this groove is too narrow and deep.67 All aminoglycosides binding sites that are in helical domains display irregularities in the helix, which open up and widen the major groove.66 2.3 FLUORESCENCE: A TOOL TO MEASURE EQUILIBRIUM CONSTANTS Fluorescence is a phenomenon where a molecule absorbs light at a certain wavelength and emits at a longer wavelength. It is also known as Stokes fluorescence. 100 Fluorescence excitation spectrum is the distribution of wavelength-dependent intensity that causes fluorescence. Fluorescence emission spectrum is the distribution of wavelength-dependent intensity of emitted energy.68 During fluorescence, the light is absorbed by the molecule in about 10-15 seconds which causes the electrons to become excited to a higher electronic state. The electrons remain at the excited state for about 108 seconds. If all of the excess energy is not lost by collisions with other molecules, the electrons return to the ground state. During this return, energy is emitted in the form of light that is of a longer wavelength than the absorbed light, due to vibrational relaxation of the molecule prior to emission.69 Fluourescence has been used for numerous studies involving nucleic acids.70, 71 Upon the introduction of the ligand, aptamers usually undergoes a conformational change usually result in a more complex folded structure. If the aptamer is labeled with a fluorophore, the fluorescence intensity of the emission spectrum changes (usually decreases) upon the addition of the ligand till the solution is saturated with the ligand. In other words, the binding of the ligand to the aptamer is a function of ligand concentration, and so is the intensity of the fluorescence. The quantitation of the resulting binding isotherm gives a precise equilibrium dissociation constant and stoichiometry for the binding of different ligands. 2.4 RESULTS Here, the results of RNA in vitro selection against kanamycin A as well as ssDNA selections against kanamycin A and tobramycin are outlined. The sequencing results, binding assay results, structure analysis, and finally the dissociation constant measurements are analyzed. 101 2.4.1 Kanamycin A: RNA SELEX The selection was carried out for 13 rounds and the binding assays for the rounds are shown below (Figure 2.4). Starting round 10, the target bound RNAs started to dominate the selection pool. After 13 rounds of selection, the selected pool was cloned and sequenced. Out of the 29 sequences 18 of them were identical (Figure 2.5). The structures of the clones were analyzed using Mfold (Figure 2.6).72 Most structures contained a common stem loop secondary structure, with the loop being 7 or 8 membered. The predominant clone (1) along with another clone (2) from the pool was further analyzed for kanamycin A binding. As can be seen from the binding assay (Figure 2.7) clone 1 is a much better binder of the target than clone 2. Round Assay: RNA- Kanamycin A 30 25 % Bound 20 15 10 5 0 0 4 5 6 7 8 9 10 11 12 13 Resin Bound Target Bound Round Figure 2.4: Binding assay for the rounds kanamycin A RNA SELEX. In the first six rounds, the selection didn't yield many ligand binding species due to the lack of high stringency rounds. Starting round seven, stringency was increased through high salt wash and by decreasing the ligand concentration. 102 Family 1: (1) GGACUGUAGCGGACAGGUUUCUAUUUGAGCGAGUUAGUACGUC (18X) Family 2: (2) GAUGCAGCACGUGCAGUGAUA-- - UUGUACAAGGUCCUCACUGACUGGGUGCA (3) CCCUCAUCCCCACGUGCAUCCCACCGGUUGUA- GUGG- ACUCCCGGACUGGG Family 3: (4) CUGCGCACCAAGGAACGGACAUCUCG-GAUAACCACUGGUCCCCCGGGUAUGU (5) CCGACAUGUCGUGAUUU-CAUGCGUAGAUAACGUCCCACUCCAGUCUCAG Family 4: GCGAAA - - - GCGCGACUAUGGACAGUAGACGUUUGUGGCAAACGUUUGUCAGCCG (6) (7) CAACCCGGGAUGCACAAACCUGUCCAGCGAAAAUCUGGCGAAUAUGUCCA Family 5: (8) CGUUAACGUAAGCCUUGCUGCGCCCAGAGUGGUCUGUCGGUUCCCCGUUG (9) UAGGGCGACACGUGGGCGAAGCAAGCUAUGUAUCGCAGGUAUUGCCGUGA Figure 2.5: Aptamer Families and their Sequence Analysis. Clone 1 was isolated 18 times from a pool of 29 sequences. Other families with common sequences are also shown. 103 Clone 1 Clone 2 Clone 3 Clone 4 Clone 5 Clone 6 Clone 8 Clone 9 Clone 7 Figure 2.6: Possible Secondary Structures of Selected RNA Aptamers against Kanamycin A.72 All structures contain stem loops structures. 104 Clone assay- RNA Kan A 70 60 50 % Bound 40 30 20 10 0 % Resin Bound % Target Bound 1 Clone 2 Figure 2.7: Binding assay for the clones isolated from the RNA selection against kanamycin A. Clone 1 was the superior binder to clone 2 and was the predominant sequence in the final pool. Since it was learned that clone 1 is the superior kanamycin A binder it was selected for fluorescence analysis to determine the dissociation constant. The fluorescein conjugated aptamer was titrated with increasing concentrations of kanamycin A (Figure 3). In order to evaluate the specificity of the aptamer, a titration was also run using tobramycin. The normalized emission intensity at 518 nm was curve fitted to determine the Kd values (Figure 4). From these measurements (Table 2.1) it is clear that the aptamer is specific for kanamycin A (Kd of 5.0 x 10-8) and it doesn't bind very well to structurally similar tobramycin (Kd of 2.5 x 10-3). 105 Fluorescence Titration Curves Normalized Fluorescence 95 85 75 65 55 45 505 Aptamer alone 0.08 micro M Kan A 1.1 micro M Kan A 21.4 micro M Kan A 3 mM Kan A 510 515 520 525 530 535 Wavelength Figure 2.8: Titration Curves for Clone 1 RNA Aptamer against Kanamycin A. These particular curves are for the RNA aptamer against kanamycin A. As can be seen, there was a larger change in intensity from no ligands to 0.08 M ligand than 21.4 M ligand to 3 mM ligand. KanA: RNA Aptamer (clone 1) 100 100 Kan A: RNA aptamer (clone 1) Normalized Fluorescence Intensity Normalized Fluorescence Intensity 95 95 90 85 90 80 75 85 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 70 0 1 10 4 2 10 4 3 10 4 4 10 4 5 10 4 6 10 4 [Kanamycin A] (micro M) [Tobramycin] (micro M) Figure 2.9: Curve fitting of Normalized Fluorescence Intensity. Emission at 518 nm from the titration of fluoresceinated aptamer (clone 1) against kanamycin A (on the left) and tobramycin (on the right) were curve fitted for the determination of Kd. This curve fitting was done for the RNA aptamer against kanamycin A. Clone Kd against Kan A (M) Kd against Tobramycin (M) -8 (1) 5.0 x 10 2.5 x 10-3 Table 2.1: Kd values for the RNA aptamer against kanamycin A. From the measurements it can be seen that the selected aptamer is specific for kanamycin A, as it doesn't bind to tobramycin very well. 106 2.4.2 Kanamycin A : ssDNA SELEX The early rounds of ssDNA selection against kanamycin A were carried out using the covalently immobilized agarose system that was loaded at milli molar concentration. Thus, in the early rounds, stringency was only a function of the wash buffer (both the amount and the concentration of monovalent cations). To remove the bead binders, negative selection was also carried out against resin without the ligand immobilized. This process was necessary to build up the target binders. When the selection was started with the biotin-streptavidin system, bead binders started to dominate and eventually took over the population. After the first seven rounds (Figure 2.10) target binders started to dominate the population and the selection was carried out against biotin-streptavidin bead system which was loaded at a much lower concentration. After round seven, the stringency of the selection as well as the affinity and specificity of the selected pool was increased by increasing the concentration of monovalent cation of washing, lowering the target concentration to increase the competition between the nucleic acids, and by carrying out negative selections against structurally similar tobramycin. After nine rounds of selection, the pool was cloned and sequenced, but no families were visible. However, after four more rounds of selection, three families of aptamers were isolated from 25 sequences. The predominant sequence was a member of family 1 (Figure 2.11). The secondary structures were again analyzed for motifs (Figure 2.12).72 Clones 3, 4, 5, 7, and 8 were then further analyzed (fluorescence titrations) for their ability to bind kanamycin A (Figure 2.13). 107 Round Assay: ssDNA-Kanamycin A 40 35 30 % Bound 25 20 15 10 5 0 0 1 2 3 4 5 6 7 Round 8 9 10 11 12 13 % Resin Bound % Target Bound Figure 2.10: The binding assay for the rounds of ssDNA selection against kanamycin A. The target binders started to dominate the pool starting at round five. Increasing the stringency of the selection allowed the bead binders to decrease from round 8 to round 12. Family 1: (1) GGGGGCGGC- ATTGTGAA- GTCGTGTCCCAGTGCCAACTTTGTGTCGGCCC (2) GGGGGCGGCCATTGTGAA- GTCGTGTCCCATGTCACGCGTGGG (3) GGGGGCGGCCATTGTGAA- GTCGTGTCCCAAATCATGTCCGCCCGC (4) GCCGCCCCC ATTGTGAA- GTCGTGTCCCAGTGCTGTGGTCCCCC* (5) GGGGGCGGCCATTGTGAA- GTCGTGTCCCAGTGCTGTGGTCCCCC (2X) (6) GCCGCCCCC ATTGTGAAAGTCGTGTCCCATGCAAGGTCGCCCTGGCCCC Family 2: (7) GCCCACCGTAGGTGCATATCCCCTGTAGTTCCGCTGTACCTCCCCGCCCC (2X) Family 3: (8) GCCCGACAGCAGTACCCTGTGCACTCCACGCCTCATCAATCCCCCCGCCCC (2X) (9) GCCCGACAGCAGTGCCCTGTGCACTCCACGCCTCATCAATCCCC- - GCCCC Figure 2.11: The ssDNA Aptamer Families against Kanamycin A. Out of the 25 sequences, three families of aptamers were isolated. Three clones were repeated twice in the population. 108 Clone 1 Clone 5 Clone 3 Clone 8 Clone 9 Clone 6 Clone 7 Clone 2 Clone 4 Figure 2.12: Possible Secondary Structure of ssDNA Aptamers against Kanamycin A.72 All the structures contain stem loop structures like the RNA aptamers against the same ligand. However the loops are much larger in these aptamers. 109 Clone Assay: ssDNA- Kanamycin A 50 40 % Bound 30 20 10 0 3 4 5 7 8 % Resin Bound % Kanamycin A Bound % Tobramycin Bound Clone Figure 2.13: Binding assays for various ssDNA aptamers against kanamycin A. It can be seen that the clone 3 is the most specific among the aptamers. In order to measure the Kds, the fluoresceinated ssDNA aptamers underwent titrations with kanamycin A and tobramycin as seen above (Figure 2.14). From these measurements (Table 2.2), it can be seen that some of these clones (3 and 7) are extremely specific for kanamycin A. As we will see later on, clone 4 is the predominant ssDNA aptamer isolated against tobramycin and has similar Kds against kanamycin A and tobramycin, suggesting its low specificity. 110 Kan A: ssDNA Aptamer (clone 3) 100 100 Kan A: ssDNA Aptamer (clone 3) Normalized Fluourescence Intensity 95 Normalized Fluourescence Intensity 90 90 80 85 70 80 75 60 70 0 20 40 60 80 100 50 0 5000 1 10 4 1.5 10 4 2 10 4 2.5 10 4 [Kanamycin A] (micro M) [Tobramycin] (micro M) Kan A: ssDNA Aptamer (clone 4) 100 Kan A: ssDNA Aptamer (clone 4) 100 Normalized Fluourescence Intensity Normalized Fluorescence Intensity 95 95 90 90 85 85 80 80 75 75 70 0 50 100 150 200 250 300 350 400 70 0 20 40 60 80 100 [Kanamycin A] (micro M) [Tobramycin] (micro M) 111 Kan A: ssDNA Aptamer (clone 5) 100 100 Kan A: ssDNA Aptamer (clone 5) Normalized Fluorescence Intensity 98 Normalized Fluorescence Intensity 95 90 96 85 94 80 92 75 90 70 88 0 1 2 3 4 5 6 7 65 -1000 0 1000 2000 3000 4000 5000 [Kanamycin A] (micro M) [Tobramycin] (micro M) Kan A: ssDNA Aptamer (clone 7) 100 100 Kan A: ssDNA Aptamer (clone 7) Normalized Fluourescence Intensity 95 Normalized Fluorescence Intensity 90 90 80 85 70 80 60 75 50 70 0 100 200 300 400 500 40 -2000 0 2000 4000 6000 8000 1 10 4 [Kanamycin A] (micro M) [Tobramycin] (micro M) 112 Kan A: ssDNA Aptamer (clone 8) 100 105 Kan A: ssDNA Aptamer (Clone 8) Normalized Fluourescence Intensity 90 Normalized Fluorescence Intensity 95 100 95 85 90 80 85 75 70 80 65 0 100 200 300 400 500 75 -200 0 200 400 600 800 1000 1200 1400 [Kanamycin A] (micro M) [Tobramycin] (micro M) Figure 2.14: Curve Fittings for the ssDNA Aptamers Against Kanamycin A. Kd against Tobramycin (M) Clone Kd against Kanamycin A (M) (3) 7.0 x 10-7 1.0 x 10-2 -6 (4) 1.0 x 10 1.5 x 10-6 (5) 7.0 x 10-7 7.0 x 10-4 -7 (7) 6.0 x 10 2.0 x 10-3 (8) 1.5 x 10-6 2.5 x 10-5 Table 2.2: Kd Values of Various ssDNA Aptamers Against Kanamycin A. It is evident that most aptamers are specific for kanamycin A, except for clone 4, which is the predominant clone isolated from the ssDNA selection against tobramycin. 2.4.3. Tobramycin ssDNA SELEX The ssDNA selection against tobramycin was carried out under identical conditions as that of the ssDNA selection against kanamycin A. After thirteen rounds of selection (Figure 2.15) the pool was cloned and sequenced and out of 45 sequences 41 sequences were members of one of five families with the predominant sequence being isolated fifteen times (Figure 2.16). The secondary structures of these clones were analyzed (Figure 2.17).72 They were similar to that of the kanamycin A ssDNA structures with stem loops as the dominant motif. 113 Round Assay: ssDNA-Tobramycin 35 30 25 % Bound 20 15 10 5 0 % Resin Bound % Target Bound 0 1 2 3 4 5 6 7 8 9 10 11 12 13 Round Figure 2.15: The binding assay for the rounds of ssDNA selection against tobramycin. The target binders started to dominate the pool progressively from round 6 and started to level off around round 11. Family 1: (1) GCCGCCCCCATTGTGAAGTCGTGTCCCAGTGCTGTGGTCCCCC (15X) (2) GCCGCCCCCATTGTGAAGTCGTGTCCCATGCAAGGTCGCCCCGCCCCC (2X) (3) CCGCCCCCATTGTGAAGTCGTGTCCCAAATCATGTCCGCCCGCC Family 2: (4) GCCCGACCACACCAGACA- CTAGGATACCACCTTGCCGCATCCCACCGCCC (6X) (5) GCCCCACCACACCAGACATCTAGGATACCACCTTGCCGCATCCCACCGCCC (6) GCC- - ACCACACCAGACA- CTAGGATACCACCTTGCCGCATCCCACCGCCC Family 3: (7) GCC- - ACCACACTATGACATGCTACACACAATGATCACTTCACTGGGCGGGG (5X) (8) GCCCCACCACACTATGACATGCTACACACAATGATCACTTCACTGGGCGGGG Family 4: (9) GCCGGACGCGGATGCACTACACTGACTGTACATGAGTAACTCGATGCGGC (7X) Family 5: (10) GCCCGACAGCAGTACCCTGTGCACTCCNCGCCTCATCAATCCCCCCGCCC (2X) Figure 2.16: The Sequences of ssDNA Aptamers against Tobramycin. The predominant clone was a member of family 1. 41 out of 45 sequences were members of one of the five above families. 114 Clone 1 Clone 2 Clone 3 Clone 6 Clone 4 Clone 5 Clone 8 Clone 7 Clone 9 Clone 10 Figure 2.17: Possible Secondary structures of ssDNA Aptamers against Tobramycin.72 Like the Kanamycin ssDNA aptamers, the loops are bigger in size than the RNA aptamers. 115 Clones 1, 4, 6, 7, and 9 were then further analyzed for their binding affinities (Figure 2.18). To further analyze these clones, titrations were run using fluoresceinated ssDNA against tobramycin and kanamycin A. The curve fittings of these titrations are shown in Figure 2.19. Clones 6, 7, and 9 were found to be extremely specific (Table 2.3). Clone Assay: ssDNA- Tobramycin 40 35 30 % Bound 25 20 15 10 5 0 1 4 6 Clone 7 9 % Resin Bound % Kanamycin A Bound % Tobramycin Bound Figure 2.18: Binding Assays for ssDNA Aptamers against Tobramycin. Clones 6, 7, and 9 were shown to be more specific binder of tobramycin than clones 1 and 4. 116 Tobr: ssDNA Aptamer (Clone 4) 100 100 Tobr: ssDNA Aptamer (clone 4) Normalized Fluorescence Intensity Normalized Fluorescence Intensity 95 95 90 90 85 85 80 80 75 75 70 70 0 200 400 600 800 1000 65 0 20 40 60 80 100 [Kananycin A] (micro M) [Tobramycin] (micro M) Tobr: ssDNA Aptamer (clone 6) Tobr: ssDNA Aptamer (Clone 7) 100 100 Normalized Fluorescence Intensity Normalized Fluorescence Intensity 95 90 95 85 80 90 75 85 0 2 4 6 8 10 12 14 70 0 20 40 60 80 100 [Tobramycin] (micro M) [Tobramycin] (micro M) 117 Tobr: ssDNA Aptamer (Clone 9) 100 100 Tobr: ssDNA Aptamer (clone 9) Normalized Fluorescence Intensity 95 Normalized Fluorescence Intensity 95 90 90 85 85 80 75 0 1000 2000 3000 4000 5000 80 0 10 20 30 40 50 60 [Kanamycin] (micro M) [Tobramycin] (micro M) Figure 2.19: The Curve Fittings of the Tobramycin ssDNA Aptamer Titrations. The clones 6 and 7 didn't respond well enough to the addition of kanamycin A for curve fittings. Kd against Kanamycin A (M) Clone Kd against Tobramycin (M) (1) 1.5 x 10-6 1.0 x 10-6 -6 (4) 2.0 x 10 1.5 x 10-5 (6) 9.0 x 10-7 (too high to measure) -6 (7) 1.5 x 10 (too high to measure) (9) 1.5 x 10-6 1.5 x 10-3 Table 2.3: Kd measurements of various ssDNA aptamers against tobramycin. The Kds for clones 6 and 7 were too high to measure. Thus, these clones along with clone 9 are very specific for tobramycin. 2.5 DISCUSSION As expected, the RNA aptamer shows higher affinity (Kd of 50 nM) binding to its aminoglycoside ligand compared to its ssDNA counterpart, mainly due to the fact that RNA folds into more complex secondary structures than ssDNA. The selected sequences from the RNA selection including the predominant sequence had a consensus region that is similar to the previously reported RNA aptamer against Kanamycin A.73, 74 In an RNA 118 selection carried out using an N-30 pool under the buffer conditions of 250 mM NaCl, 50 mM tris, 1 mM MgCl2 at pH 7.6, the author reported the isolation of aptamers with consensus sequence GUUU*A*#AG where * is mainly purines and # is any one of the four nucleotides. We have isolated similar sequences such as GUUUGUCAG (clone 6, RNA aptamer) and GUUUCUAUU (clone 1, RNA aptamer). The previously reported aptamer structures contain a seven base loop similar to what is found in the secondary structure reported herein. There were no sequence similarities between the RNA and ssDNA aptamers, suggesting the role of overall folded structure of the aptamer along with the sequence in molecular recognition. It is also learned that aptamers, unlike natural nucleic acids do not show higher affinity binding towards aminoglycosides with more ammoniums and less hydroxyl groups (tobramycin). The ssDNA aptamers against both kanamycin A and tobramycin show similar binding affinities toward their ligands. Even though, it was reported that RNA aptamers against similar targets give similar sequences,74 there are more striking resemblances between the ssDNA aptamers that were selected against similar targets. The predominant ssDNA aptamer against tobramycin (clone 1) was also pulled out once from the ssDNA selection against kanamycin A (clone 4). This sequence has similar Kds against kanamycin A and tobramycin (1 and 1.5 M respectively). Family 1 from both ssDNA selections contains an 18 base long sequence that is identical (ATTGTGAAGTCGTGTCCC). This sequence is the complement of the 18.50 primer. It is hard to imagine these sequences having an advantage in amplification, since this primer is 5' biotinylated, and cannot be extended from this end. What is more interesting is that 119 the predominant tobramycin ssDNA aptamer (clone 1) is very similar in sequence to a predominant kanamycin ssDNA aptamer (clone 5). (Tobramycin clone 1) GCCGCCC -CCATTGTGAAGTCGTGTCCCAGTGCTGTGGTCCCCC (Kanamycin A clone 5) GGGGGCGGCCATTGTGAAGTCGTGTCCCAGTGCTGTGGTCCCCC The tobramycin aptamer is a base smaller than the kanamycin A aptamer and the few bases they differ in are all guanines and cytosines. Though this is the case, family 1 sequences from both ssDNA selections shows disparity in specificity binding. It is remarkable that even with these resemblances, the aforementioned kanamycin A clone discriminates between its ligands better than tobramycin clone as can be seen from the Kd measurements. It is probably due to the fact that a small change in sequence can often leads to a change in overall folding of the nucleic acid. Even though the most striking similarities were between the kanamycin A and tobramycin ssDNA aptamers, there were also other common short sequences between the other aptamers. For example both kanamycin families 2 and 3 as well as tobramycin family 2 and 5 contain a consensus sequence C*C#CCGCCC, where * is either T or C and # is either C or A. It may be that selections carried out against similar targets under identical conditions can lead to aptamers with similar sequences but the similarity in sequence is not necessarily correlated to affinity binding of their ligands due to the differences in folding of the aptamer. Clone 4 and Clone 6 from the ssDNA selection against tobramycin are members of the same family, with clone 6 having two nucleotide deletions from clone 4. However, it was evident from the fluorescence studies that clone 6 was more specific than clone 4. Upon, folding these two aptamers, it was found that clone 4 has an additional more 120 energetically favorable conformation than clone 6, (dG of -7.4 vs. -6.4). However, both contains a 15 member loop, which is a common motif found in aminoglycoside binding aptamers. 2.6 SUMMARIES AND FUTURE OUTLOOK We have seen that the selected ssDNA aptamers against similar targets yield similar aptamer sequences. The resemblances between these aptamer sequences are more striking than that of their RNA counterparts. As mentioned before, the folding of the RNA to form the secondary structures is more complex than that of the ssDNA. We have also seen that there are no sequence similarities between the RNA and ssDNA aptamer against the same ligand, suggesting that the overall structure plays an important role in molecular recognition. We saw that similar sequences can fold into completely different structures with very different specificity for their ligands, again suggesting the role of structure in binding ligands. their We have seen that the incorporation of fluorophore to the aptamers can be used to measure equilibrium dissociation constants. In the future, this can be used as sensing devices, on fluorescent chips for aminoglycosides. 2.7 MATERIALS AND METHODS Reagents. Both kanamycin A and tobramycin as well as the streptavidin- agarose resin were purchased from Sigma (St. Louis, MO). Sulfosuccinimidobiotin was purchased from Pierce (Rockford, IL). The 2% cross-linked glyoxal agarose resin was purchased from Agarose Bead Technologies (ABT, Tampa, FL). The solvents and the buffer salts were purchased from Sigma. The N-50 RNA pool was synthesized on an Expedite 8909 DNA synthesizer (PE Biosystems, Foster City, CA) using synthesis reagents from Glen Research (Sterling, VA). The primers were purchased from Integrated DNA 121 Technologies (Coralville, IA). Fluorescein hydrazide was purchased from Molecular Probes (Eugene, OR). Pool Construction and primers. randomized positions A single stranded DNA pool containing 50 5'-CATCAGTTAGTCATTACG-N50was synthesized (N50: ATTGTGAAGTCGTGTCCCTATAGTGAGTCGTATTAGAA-3') according to the previously reported methodology.75 The pool was PCR amplified using primers 5'-TTCTAATACGACTCACTATAGGGACACGACTTCACAAT-3' (38.50 primer) and 5'-CATCAGTTAGTCATTACGCTTACG-3' (24.50 primer), where the underlined residues are part of the T7 RNA polymerase promoter and is not transcribed. For the ssDNA selections, the biotinylated primer 5'-biotin- GGGACACGACTTCACAAT-3'(18.50 primer) was used in place of the 38.50 primer for streptavidin encapsulation. A fluoresceinated primer 5'-fluorescein CATCAGTTAGTCATTACGCTTACG-3' (24.50f primer) was used instead of 24.50 primer for the synthesis of fluoresceinated ssDNA aptamers. Target Immobilization. The biotinylation of the aminoglycosides are as follows (Scheme 2.1). To a 9 ml solution of 0.5 mM aminoglycoside at pH 8.0 was added 1 ml of 0.2 mM sulfosuccinimidobiotin. This solution was allowed to incubate for two hours at room temperature. The biotinylated product was characterized through mass spectrometry. A 5 ml sample of the aforementioned reaction mixture was then directly mixed with 5 mls of streptavidin agarose resin to obtain a 20 M loading. The resin was then washed with copious amount of water. To further remove any reagents and uncoupled ligands, further overnight washings were carried out. The drained resin was then suspended in the selection buffer. 122 O OH HO H2 N O OH O H2N HO H2N O OH NH2 HN NH O SO3Na O N S O NH2 + O NaHCO3 pH 8.0 2.1 OH HO H2 N O OH O H2N HO H2N O OH N H O 2.3 O O NH2 H N S NH O 2.4 Scheme 2.1: The process of biotinylation. The most basic amine on the structure is directly coupled to form an amide bond using the activated biotin under slightly basic pH. The direct coupling of kanamycin A and tobramycin on agarose resin were performed as follows (Scheme 2.2). To a 10 ml slurry of glyoxal agarose beads, 50 ml of cyanoborohydride coupling buffer (20 mM sodium phosphate at pH 8.0 and 3 g/L sodium cyanoborohydride) was added. To this mixture, 1 ml of 10 mM target (in 20 mM sodium phosphate buffer) was added for a 1 mM ligand loading. This reaction mixture was incubated for three hours and the beads were then drained and were subsequently washed with the coupling buffer. The success of immobilization was characterized with incubation of beads with pyrocatechol violet. The beads turned pink in the presence of aminoglycoside. In order to block the free aldehyde sites, the resins were then treated with 1 ml of methylamine (in 70 % MeOH) in the coupling buffer. After another three hours of incubation, the resins were drained and washed with the coupling buffer. Further over-night washes were carried out with water to remove any uncoupled amines or reagents from the beads. 123 OH HO H2 N O OH O H 2N HO H2N O OH NH2 O NH2 + O O H CNBH3 NaHCO3 pH 8.0 2.1 OH HO H2 N O OH O H2N HO H2N OH N H O 2.5 O O NH2 2.6 Scheme 2.2: The direct coupling of the aminoglycoside to the glyoxal agarose beads. This process was carried out under slightly basic pH using glyoxal agarose beads. In Vitro Selection. The selection was initiated with four pools of RNA or ssDNA. The RNA selection against kanamycin A was carried out using 50mM Tris, 100mM KCl, and 10 mM MgCl2 at pH 7.5. Since the ssDNA selections under these conditions were unsuccessful, they were carried out at 50mM Tris, 300 mM LiCl, and 5 mM MgCl2 at pH 7.6. The buffer conditions were determined by examining the optimum binding conditions of round 0 pools. The nucleic acid pools in the aforementioned buffer were initially denatured by heating at 72 C for two minutes and was cooled down to room temperature over 10 minutes. The RNA selection and amplification are carried out according to the standard protocols.76-78 The ssDNA selections were carried out under similar conditions, except the biotinylated primer (18.50 primer) was used in large scale PCR. The PCR product was then incubated with streptavidin- agarose (5 molar excess to the 18.50 primer). The resin was washed with 2 X SABY, 1 X SABX, and 1 X TE. SABY is consisted of 5 mM Tris, 1 M NaCl, 1 mM EDTA and 0.1% Tween-20 at pH 7.5. SABX is consisted of 500 mM NaCl 30 mM NaCl, and 1 mM EDTA at pH 7.4. The bound DNA is then strand separated in fresh 0.2 N NaOH (400 l) and was neutralized in 124 sodium acetate (80 l, 3 M, pH 5.2). The ssDNA was then ethanol precipitated and gel purified (6% acrylamide gel). In every round of negative and positive selections, the resin was incubated in the presence of RNA or ssDNA and was subsequently washed with selection buffer to remove any unbound and weak binding RNA. The volume of this wash was progressively increased from round one to round thirteen (30 bead volumes to 500 bead volumes). The monovalent ion concentration of the wash was also progressively increased from 1X to 10X. Negative selections were carried out using agarose resins that are blocked at all the glyoxal sites with methylamine. Starting round nine, negative selections were carried out using directly coupled agarose resins with either kanamycin A (for ssDNA selection against tobramycin) or tobramycin (for RNA and ssDNA selection against kanamycin A). The ssDNA selections were initially (first seven rounds) carried out using the glyoxal agarose bead system and were then switched over to the biotinstreptavidin system. Since the glyoxal agarose beads were over loaded (1 mM), the stringency of these early rounds was solely dependent on the wash. This was done to slowly increase the stringency of the selection and was necessary for the success of the selection process. The reverse transcription was carried out using SuperScriptTM II Reverse Transcriptase (Invitrogen, Carlsbad, CA), while PCR was carried out using homemade DNA Polymerase. The transcription was carried out using AmpliscribeTM High Yield Transcription Kit (Madison, WI). The round thirteen selected pool was cloned (TA Cloning Kit; Invitrogen) and sequenced using the Dye Terminator Cycle Sequencing Kit 125 (Beckman Coulter, Fullerton, CA) and a CEQ 2000 XL DNA sequencer (Beckman Coulter). Binding Assays. For the RNA selection, following every rounds of selection, the double stranded DNA pool was transcribed with [-32P]UTP (2.0 mCi, 3000 Ci/mmol; Easytides) and was gel purified (6% acrylamide gel). For the ssDNA selections, an ssDNA pool was created using the aforementioned strand separation method. The pool was then 5' end labeled using [-32P] ATP (2.0 mCi, 7000 Ci/mmol; ICN Biomedicals) at T4 Polynucleotide Kinase Kit. The pool was then gel purified using 6% acrylamide gel. Binding assays were performed similar to the selection itself, but the resin was only washed with 30 bead volumes of the selection buffer and fractions were collected. The radioactivity was quantified using a scintillation counter and the bound RNA to unbound RNA from one round to the next was compared. Fluorescent Measurements. The RNA aptamer was 3' labeled using published conditions.79 The ssDNA aptamers were created by the aforementioned strand separation method using 24.50f primer instead of the 24.50 primer. The fluorescein labeled All fluorescence aptamers were then purified on a 8% denaturing acrylamide gel. measurements were carried out on a PTI Quantamaster QM-4/2003SE spectrofluorimeter (Photon Technology International, Ontario, Canada). The aptamer (10 nM) was incubated at 72 C for 2 minutes and was allowed to cool down same as the selection conditions above. The fluorescence response was measured by exciting the samples at 494 nm (the ex for fluorescein) and emitting at 518 nm (the em for fluorescein). The response was instantaneous and the signal was steady after 2 minutes. The fluorescence 126 emission was then plotted with the incremental addition of targets. This emission data set was fit to the equation: y = 100 + AX/(X+B) Where y is the percent change in the fluorescence at a given target concentration, A is the fluorescence intensity at saturating target concentrations, X is the concentration of the target, and B is the apparent dissociation constant value. 2.8 REFERENCES 1. Dahlberg, A. D., Horodyski, F., & Keller, P. (1978) Interaction of Neomycin with Ribosomes and Ribosomal Ribonucleic Acid. Antimirobial Agents and Chemotherapy 13, 331-339. Moazed, D. & Noller, H. F. (1987) Interaction of Antibiotics with Functional Sites in 16S ribosomal RNA. Nature 327, 389-394. Pape, T., Wintermeyer, W., & Rodnina, M. V. (2000) Conformational Switch in the Decoding Region of 16S rRNA during Aminoacyl-tRNA Selection on the Ribosome. Nature Structure Biology 7, 104-107. Karimi, R. & Ehrenberg, M. (1994) Dissociation Rate of Cognate Peptidyl-tRNA from the A-site of Hyper-accurate and Error-prone Ribosomes. European Journal of Biochemistry 226, 355-360. Davies, J. & Davis, B. D. (1968) Misreading of Ribonucleic Acid Code Words Induced by Aminoglycoside Antibiotics. The Effect of Drug Concentration. Journal of Biological Chemistry 243, 3312-3316. Davies, J. (1994) Inactivation of Antibiotics and the Dissemination of Resistance Genes. Science 264, 375-382. Chun, S. M., Jung, S. J., Park, H. G., & Yoo, J. H. (2001) RNA Sequence Having Binding Specificity to Kanamycin A. Korean Kongkae Taeho Kongbo Wang, H. & Tor, Y. (1997) Electrostatic Interactions in RNA Aminoglycosides Binding. Journal of the American Chemical Society 119, 8734-8735. Green, R. & Noller, H. F. (1997) Ribosomes and Translation. Annual Review of Biochemistry 66, 679-716. 127 2. 3. 4. 5. 6. 7. 8. 9. 10. Pape, T.; Wintermeyer, W.; Rodina, M. (1999) Induced Fit in Initial Selection and Proofreading of Aminoacyl-tRNA on the Ribosome. EMBO Journal 18, 38003807. Moazed, D. & Noller, H. F. (1986) Transfer RNA Shields Specific Nucleotides in 16S Ribosomal RNA from Attack by Chemical Probes. Cell 47, 985-994. Woodcock, J., Moazed, D., Cannon, M., Davies, J., & Noller, H. F. (1991) Interaction of Antibiotics with A- and P-site-specific Bases in 16S Ribosomal RNA. EMBO Journal 10, 3099-3103. Yoshizawa, S., Fourney, D., & Puglisi, J. D. (1999) Recognition of the CodonAnticodon Helix by Ribosomal RNA. Science 285, 1722-1725. Cate, J. H., Yuspov, M. M., Yuspova, G. Z., Earnest, T. N., & Noller, H. F. (1999) X-ray Crystal Structures of 70S Ribosome Functional Complexes. Science 285, 2095-2104. Clemons, W. C. J., May, J. L. C., Wimberly, B. T., McCutcheon, J. P., Capel, M. S., & Ramakrishnan, V. (1999) Structure of a Bacterial 30S Ribosomal Subunit at 5.5A Resolution. Nature 400, 833-840. Murphy, F. L. & Cech, T. R. (1993) An Independently Folding Domain of RNA Tertiary Structure Within the Tetrahymena Ribozyme. Biochemistry 32, 52915300. Schroeder, R. (1994) Translation. Dissecting RNA Function. Nature 370, 597598. Fourmy, D., Recht, M. I., Blachard, S. C., & Puglisi, J. D. (1996) Structure of the A Site of Escherichia coli 16S Ribosomal RNA Complexed with an Aminoglycoside Antibiotic. Science 274, 1367-1371. Moazed, D. & Noller, F. (1987) Intermediate Sites in the Movement of Transfer RNA in the Ribosome. Nature 389. von Ashen, U.; Schroeder, R. (1990) Streptomycin and Self-Splicing. Nature 346, 801. Schroeder, R., von Ashen, U., Eckstein, F., & Lilley, D. M. J. (1996) "Nucleic Acids and Molecular Biology," Vol. 10, p.53. Springer-Verlag, Berlin. Michael, K. & Tor, Y. (1998) Designing Novel RNA Binders. Chemistry: A European Journal 4, 2091. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 128 22. 23. 24. 25. Wallace, S. T. & Schroeder, R. (2000) In Vitro Selection and Characterization of RNAs with High Affinity to Antibiotics. Methods in Enzymology, 318, 214. Purohit, P. & Stern, S. (1994) Interactions of a Small RNA with Antibiotic and RNA Ligands of the 30S Subunit. Nature 370, 659. Wang, Y. & Rando, R. R. (1995) Specific Binding of Aminoglycoside Antibiotics to RNA. Chemistry & Biology 2, 281. Lato, S. M.; Boles, A. R.; Ellington, A. D. (1995) In Vitro Selection of RNA Lectins: Using Combinatorial Chemistry to Interpret Ribozyme Evolution. Chemistry & Biology 2, 291. Wallis, M. G., von Ashen, U., Schroeder, R., & Famulok, M. (1995) A Novel RNA Motif for Neomycin Recognition. Chemistry & Biology 2, 543. Wallace, S. T.; Schroeder, R. (1998) In Vitro Selection and Characterization of Streptomycin-Binding RNAs: Recognition Discrimination Between Antibiotics. RNA 4, 112. Wallis, M. G., Streicher, B., Wank, H., von Ashen, U., Clodi, E., Wallace, S. T., Famulok, M., Schroeder, S. (1997) In Vitro Selection of a Viomycin-binding RNA Pseudoknot. Chemistry & Biology 4 357. Burke, D. H., Hoffman, D. C., Brown, A., Hansen, M., Pardi, A., & Gold, L. (1997) RNA Aptamers to the Peptidyl Transferase Inhibitor Chloramphenicol. Chemistry & Biology 4, 833. von Ashen, U., Davies, J., & Schroeder, R. (1991) Antibiotic Inhibition of Group I Ribozyme Function. Nature 353, 368-370. Stage, T. K., Hertel, K. J., & Uhlenbeck, O. C. (1995) Inhibition of the Hammerhead Ribozyme by Neomycin. RNA 1, 95-101. Rogers, J., Chang, A. H., von Ahsen, U., Schroeder, R., & Davies, J. (1996) Inhibition of the Self-Cleavage Reaction of the Human Hepatitis Delta Virus Ribozyme by Antibiotics. Journal of Molecular Biology 916-925. Chia, J. S., Wu, H. I., Wang, H. W., Chen, D. S., & Chen, P. J. (1997) Journal of Biomedical Science 4, 208-216. Earnshaw D. J. & Gait, M. J. (1998) Hairpin Ribozyme Cleavage Catalyzed by Aminoglycoside Antibiotics and the Polyamine Spermine in the Absence of Metal Ions. Nucleic Acids Research 26, 5551-5561. 129 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. Mikkelsen, N. E., Brannvall, M., Virtanen, A., & Kirsebom, L. A. (1999) Inhibition of RNase P RNA Cleavage by Aminoglycosides. Proceedings of National Academy of Science of the United States of America 96, 6155-6160. Clouet-d'Orval, B., Stage, T. K., & Uhlenbeck, O. C. (1995) Neomycin Inhibition of the Hammerhead Ribozyme Involves Ionic Interactions. Biochemistry 34, 11186-11190. Scott W. G., Murray, J. B., Arnold, J. R. P., Stoddard, B. L., & Klug, A. (1996) Capturing the Structure of a Catalytic RNA Intermediate: the Hammerhead Ribozyme Science 274, 2065-2069. Hermann, T. & Westhof, E. (1998) Aminoglycoside Binding to the Hammerhead Ribozyme: A General Model for the Interaction of Cationic Antibiotics with RNA. Journal of Molecular Biology 276, 903-912. von Ahsen, U.. Davies, J., & Schroeder, R. (1992) Non-Competitive Inhibition of Group I Intron RNA Self-Splicing by Aminoglycoside Antibiotics. Journal of Molecular Biology 226, 935-941. von Ahsen, U. & Noller, H. F. (1993) Footprinting the Sites of Interaction of Antibiotics with Catalytic Group I Intron RNA. Science 260, 1500-1503. Hoch, I., Berens, C., Westhof, E., & Schroeder, R. (1998) Antibiotic Inhibition of RNA Catalysis: Neomycin B binds to the Catalytic Core of the td Group I Intron Displacing Essential Metal Ions. Journal of Molecular Biology 282, 557-569. Michel, F. & Westhof, E. (1990) Modelling of the Three-Dimensional Architecture of Group I Catalytic Introns Based on Comparative Transcription Factor IIIA. Journal of Molecular Biology 216, 585-610. Lehnert, V., Jaeger, L., Michel, F., & Westhof, E. (1996) New Loop-loop Tertiary Interactions in Self-splicing Introns of Subgroup IC and ID: A Comparative 3D Model of the Tetrahymena Thermophila Ribozyme. Chemistry & Biology 3, 9931009. Streicher, B., Westhof, E., & Schroeder, R. (1996) The Environment of Two Metal Ions Surrounding the Splice Site of a Group I Intron. EMBO Journal 15, 2556-2564. Davies, J., Gorini, L., & Davis, B. D. (1965) Misreading of RNA Codewords Induced by Aminoglycoside Antibiotics. Molecular Pharmacology 1, 93-106. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 130 46. Nesbitt, S., Hegg, L. A., & Fedor, M. J. (1997) An Unusual pH-independent and Metal-ion-independent Mechanism for Hairpin Ribozyme Catalysis. Chemistry & Biology 1997, 4, 619-630. Earnshaw, D. J. & Gait, M. J. (1998) Hairpin Ribozyme Cleavage Catalyzed by Aminoglycoside Antibiotics and the Polyamine Spermine in the Absence of Metal Ions. Nucleic Acids Research 26, 5551-5561. Schroeder, R., Waldsich, C., & Wank, H. (2000) Modulation of RNA Function by Aminoglycoside Antibiotics. EMBO Journal 19, 1-9. Wallis, M. G. & Schroeder, R. (1997) The Binding of Antibiotics to RNA. Progress in Biophysics and Molecular Biology 67, 141-154. Jiang, L., Suri, K., Fiala, R., & Patel, D. J. (1997) Saccharide-RNA Recognition in an Aminoglycoside Antibiotic-RNA Aptamer Complex. Chemistry & Biology 4, 35. Jiang, L. & Patel, D. J. (1998) Solution Structure of the Tobramycin-RNA Aptamer Complex. Nature Structural Biology 5, 769. Herman, T. & Westhof, E. (1998) Saccharide-RNA Recognition. Biopolymers 48, 155. Fourmy, D., Recht, M. I., Blanchard, S. C., & Puglisi, J. D. (1996) Structure of the A site of Escherichia Coli 16S Ribosomal RNA Complexed with an Aminoglycoside Antibiotic. Science 274, 1367-1371. Yoshizawa, S., Fourny, D., & Puglisi, J. D. (1998) Structural Origins of Gentamicin Antibiotic Action. EMBO Journal 17, 6437. Jiang, L. (1999) Structure 7, 817. Recht, M. I., Fourmy, D., Blanchard, S. C., Dahlquist, K. D., Puglisi, J. D. (1996) RNA Sequence Determinants for Aminoglycoside Binding to an A-site rRNA Model Oligonucleotide. Journal of Molicular Biology 262, 421-436. Karimi, R. & Ehrenberg, M. (1994) Dissociation Rate of Cognate Peptidyl-tRNA from the A-site of Hyper-accurate and Error-prone Ribosomes. European Journal of Biochemistry 226, 355-360. Fourmy, D., Yoshizawa, S., & Puglisi, J. D. (1998) Paromomycin Binding Induces a Local Conformational Change in the A-site of 16 S rRNA. Journal of Molecular Biology 277, 333-345. 131 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. Potapov, A. P., Tiana-Alonso, F. J., & Nierhaus, K. H. (1995) Ribosomal Decoding Processes at Codons in the A or P Sites Depend Differently on 2'-OH Groups. Journal of Biological Chemistry 270, 17680-17684. Yoshizawa, S., Fourmy, D., & Puglisi, J. D. (1999) Recognition of the CodonAnticodon Helix by Ribosomal RNA. Science 285, 1722-1725. Schroeder R., Streicher, B., & Wank, H. (1993) Splice-Site Selection and Decoding: Are They Related? Science 260, 1443-1444. Zapp, M. L., Stern, S., & Green, M. R. (1993) Small Molecules that Selectively Block RNA Binding of HIV-1 Rev Protein Inhibit Rev Function and Viral Production. Cell 74, 969-978. Mei, H. Y., Galan, A. A., & Halim, N. S. (1995) Discovery of Selective, SmallMolecule Inhibitors of RNA Complexes: I. The Tat Protein/TAR RNA Complexes Required for HIV-1 Transcription. Bioorganic & Medicinal Chemistry Letters 5, 2755-2760. Holmes, D. J. & Cundiffe, E. (1991) Analysis of a Ribosomal RNA Methylase Gene from Streptomyces Tenebrarius Which Confers Resistance to Gentamycin. Molecular and General Genetics 229-237. Holmes, D. J., Drocourt, D., Tiraby, G., & Cundliffe, E. (1991) Cloning of an Aminoglycoside-Resistance-Encoding Gene, kamC, from Saccharopolyspora hirsute: Comparison with kamB from Streptomyces Tenebrarius. Gene 102, 1926. Werstuck, G. & Green, M. R. (1998) Controlling Gene Expression in Living Cells Through Small Molecule-RNA Interactions. Science 282, 296-298. Ellington, A. D. (1993) RNA Selection. Aptamers Achieve the Desired Recognition. Current Biology 3, 375-377. http://www. pti-nj.com/fluorescence_2.html. http://www.turnerdesigns.com/t2/doc/appnotes/998_0050/0050_c1.html. Ha, T. (2001) Single-molecule fluorescence methods for the study of nucleic acids. Current Opinion in Structural Biology 11, 287-292. Mollova, E. (2002) Single-molecule fluorescence of nucleic acids. Current Opinion in Chemical Biology 6, 823- 828. 132 60. 61. 62. 63. 64. 65. 66. 67. 69. 70. 71. 72. 73. 74. http://biotools.idtdna.com/mfold/mfold.asp Lato, S. M., Boles, A. R., & Ellington, A. D. (1995) In vitro selection of RNA lectins: using combinatorial chemistry to interpret ribozyme evolution. Chemistry & Biology 2, 291-303. Lato, S.M. Dissertation. Indiaana University. Robertson, M. P. & Ellington, A. D. (1999) In Vitro Selection of an Allosteric Ribozyme that Transduces Analytes to Amplicons. Nature Biotechnology 17, 6266. Luzi, E., Minunni, M., Tombelli, S., & Mascini, M. (2003) New Trends in Affinity Sensing Aptamers for Ligand Binding. Trends in Analytical Chemistry 22, 810-818. Osborne, S. E. & Ellington, A. D. (1997) Nucleic Acid Selection and the Challenge of Combinatorial Chemistry. Chemical Reviews 97, 349-370. Ellington, A. D.; Szostak, J. W. In Vitro Selection of RNA Molecules that Bind Specific Ligands. Nature 346, 818-822. Qin, P. Z.; Pyle, A. M. (1999) Site- Specific Labeling of RNA with Fluorophore s and Other Structural Probes. A Companion to Methods in Enzymology 18, 60-70. 75. 76. 77. 78. 79. 80. 133 CHAPTER 3: TUNING THE SPECIFICITY OF A SYNTHETIC RECEPTOR USING AN APTAMER 3.0 INTRODUCTION Molecular recognition is controleled by the energy and the information involved in the binding and selection of ligand(s) by a receptor; it may also involve a specific function.1 It implies a pattern recognition process through a structurally well-defined set of intermolecular interactions. Thus, it is the molecular storage and supramolecular read out of molecular information.2 In nature there exist numerous examples of molecular recognition between proteins3-7 and nucleic acids8-12 and various small organic ligands. Some of these interactions are strong while some others are weak, but most are highly specific. For a long time, supramolecular chemists have been studying molecular Even though these studies often result in 18-23 recognition using synthetic receptors.13-17 creating receptors showing high affinity, the receptors often fail to discriminate The between very structurally similar guests as do their biological counterparts. receptors have low to medium selectivity because they are relatively simple structures. Alternatively, the development SELEX allows chemists to create aptamers that are highly selective. Aptamers, however, show low affinity with small guests and with compounds that are anionic in character.24-26 The high selectivity results from binding within a complex secondary and tertiary structure. The low affinity results because the aptamers are formed from the same four monomers and are selected for specificity rather than affinity. 134 We postulated that by combining synthetic receptor technology and aptamer technology, the specificity of a synthetic receptor might be improved. In this chapter, we will look at tuning the specificity of a synthetic receptor using an aptamer. The result of combining these two technologies is a ternary complex shown schematically in Figure 3.1. However, before we look at this selection and results, we will look at natural and synthetic receptors and the principles of an in-line assay in secondary structure determination. A R 5' 3' Figure 3.1: A schematic diagram of the ternary complex. A is the analyte bound to the receptor (R) which is entrapped by the aptamer. 3.1 NATURAL RECEPTORS Biological receptors are formed by combining large numbers of simple monomeric building blocks with different functional groups. The building blocks for proteins are amino acids, for nucleic acids, they are nucleotides, and for carbohydrates, 135 they are monosaccharides. The resulting bound molecular complex forms three dimensional structures by specific intramolecular interactions between different parts of the linear structure. The molecular recognition site is formed by precise stereochemistry and the recognition process is very specific.27 Different regions and functional groups of the receptors are positioned in a well-defined array to provide a specific chemical microenvironment.28 3.2 SYNTHETIC RECEPTORS Synthetic receptors are obtained by organic synthesis that allows unlimited variation. The molecular recognition strategy focuses on the complementarity of functional groups between receptor and guest species. Whenever a new receptor needs to be created, a new synthetic pathway has to be developed.27 3.2.1 Origin of Binding in Synthetic Receptors The basis of interaction between a synthetic receptor and its target is the same as those found between biological macromolecules and their ligands and they are the noncovalent bonds. Combining a large number of non- covalent bonds with complementary elements within a limited area allows the formation of a specific association whose affinity maybe of the same order of magnitude as a weak covalent bond. These bonds include electrostatic and Van der Waals interactions, hydrogen bond, and stacking and hydrophobic interactions.29 Electrostatic interactions are pH dependent, especially in the presence of ionizable functionalities, which is evident in the affinity changes of the transmembrane carriers operating between two different pH media.30 Van der Waals interactions are a function of dipole moments of molecules. Hydrogen bonds are a type of dipolar interaction in which one of the dipoles is formed by a bond between an 136 electronegative atom and hydrogen, such that the proton can be approached by a loan pair of electrons. Stacking interactions are observed between planar aromatic compounds of complementary electrostatic surfaces. A hydrophobic molecule in water restrains a hydrogen bonding network between water molecules, thus entropy is diminished locally. When two hydrophobic compounds approach each other, the water molecules are liberated and thus the entropy is increased. molecular recognition. 3.2.2 Low Specificity in Synthetic Receptors Although synthetic receptors are selective for certain ligands, they usually aren't specific for a certain ligand. The receptor 3.1 developed by Shinkai is one of the earliest for the chiral saccharide recognition. It showed chiral discrimination ability for fructose (Kd = 4 x 10-4).31 It was recently shown that this receptor binds to tartrate (Kd = 7 x 10-4), malate (Kd = 8.3 x 10-3), and erythritol (Kd= 2.5 x 10-3) as well.32 This is the role of hydrophobicity in N OMe OMe N B(OH)2 B(OH)2 3.1 Receptor 3.2 was synthesized by Grawe and coworkers for the recognition of ammoniums and amidiniums.20 Complementarity in charges is thought to be the basis for recognition. However, it binds to a variety of diamines and amino acid methyl esters with similar binding affinities. For example, it binds to m-xylenediamine (Kd = 6 x 10-4), 1,3-diaminopropane (Kd = 4 x 10-4), 1,2-diaminocyclohexane (Kd = 7 x 10-4), lysine 137 methyl ester (Kd = 2 x 10-4), and arginine methyl ester (Kd = 6 x 10-4). Rensing and coworkers reported the use of the same receptor 3.2 (where R=H) for guanidinium recognition.22 O MeO R P O R O O OMe P O O P R OMe + 3 NBu4 R= H, CH3 3.2 Receptor 3.3 was synthesized for the sensing of amino acids. It shows selectivity towards aspartate, but binds to most amino acids with similar affinity.21 The sensing is mainly through charge pairing and H-bonding. It binds to aspartate (Kd = 7 x 10-6), glutamic acid (Kd = 5 x 10-5), asparagene (Kd = 4 x 10-5), phenylalanine (Kd = 1 x 10-3) and other amino acids. N N N Zn(II) N N HN H2 N NH2 3.3 H2 N NH NH2 138 The receptor 3.4 was another compound synthesized to bind amino acids.34 It binds to cadaverine dihydrocholoride (Kd = 8 x 10-5), 6-aminohexanoic acid (Kd = 6 x 10-5), and L-Lysine methyl ester dihydrochloride (Kd = 4 x 10-4). R = (CH2)3CH(CH3)2 3.4 Receptor 3.5 was synthesized to bind amides.34 The binding is mainly through Hbonding. It binds to various amides with binding constants around and below millimolar range. 3.5 These are only a few examples of synthetic receptors that are discussed in the literature. Even though there are synthetic receptors with good selectivity, these examples show that they do not achieve the specificity of natural receptors. 139 3.3 IN- LINE ASSAYS RNA under physiological conditions is unstable due to the spontaneous cleavage of phosphodiester linkage via intramolecular transesterification reactions (Scheme 3.1). In RNA, the protonation state of the 2'-hydroxyl group is critical in cleavage. The oxygen of the the 2'-hydroxyl group is nucleophilic and is held in proximity to the phosphodiester linkage. This is the basis for the lowered stability of RNA.35, 36 Many enzymes cleave RNA through an intramolecular phosphoester transfer reaction.37-40 The cleavage starts with a nucleophilic attack (3.6) of the 2' oxygen on the adjacent phosphorous center to form the cyclic phosphate center (3.7). This SN2 reaction like cleavage results in 2', 3'-cyclic phosphate (3.8) and 5'-hydroxy compound (3.9). B O B O O H H O O P O 5' 3' B O O H H B HO H H OH O H O O P H O O H OH H 2' O O H H H OH B O H H H O O O P O O O H H O 3.8 + B O H H O H H OH O H H O H H OH H 3.9 3.6 3.7 Scheme 3.1: The phosphodiester bond cleavage. This is an SN2 type reaction, in which the nucleophylic 2' hydroxyl oxygen attacks the phosphate center followed by the leaving of the 5' oxygen to form the cyclic phosphate (3.8) and 5'hydroxy compound (3.9). Various factors can accelerate the cleavage of RNA by the above shown mechanism. Bases that can deprotonated the 2'-hydroxyl group can catalyze this reaction by shifting the equilibrium between 2' hydroxyl group and 2' oxyanion group towards 140 the oxyanion. In the presence of an acid, protonation of the 5'-oxyanion leaving group and a nonbridging phosphate oxygen accelerate the transesterification reaction.38 The position of the attacking nucleophile relative to the leaving group also plays a role in transesterification.41 The nucleophile must be in a "near-attack conformation" for the reaction to proceed.42, 43 The transesterification is only allowed when the attacking 2' nucleophile is in line with the 5'-oxyanion leaving group, such that the oxyanion must be located directly on the opposite side of its target phosphorous center relative to the nucleophile. Divalent metal cations catalyze the 2'-hydroxyl mediated transesterification reaction promoting the cleavage in the variably structured regions of well-folded RNAs.44, 46 Wherever the RNA is double stranded, the 2'-oxyanion group and the adjacent 5'-oxyanion leaving group of each 3',5'-phosphodiester bond are precluded from adopting an in-line conformation, thus making RNA transesterification less favorable. On the other hand, open single stranded RNA structures have phosphodiester linkages that are free to undergo conformational changes, occasionally arriving at the reactive in-line structure, making them more susceptible to spontaneous or metalcatalyzed transesterification. This phenomenon was proven by the fact that the natural 3',5'-phosphodiester counterparts.47 RNA aptamers adopts complex tertiary folds with a variety of phosphodiester linkage conformations that are held in place by the overall RNA structure. Analyzing the cleavage patterns of the RNA can give information regarding the overall folding of the molecule. 141 bonds are more stable than their 2',5'-phosphodiester 3.4 EXPERIMENTAL DESIGN To explore our postulate, we choose a synthetic bis-boronic acid receptor (3.10), which is analogous to compound 3.12, which has been found to bind citrate with higher affinity than tartrate.48, 49 From our experience, it was learned that the guanidinium moiety itself as a functionality is not important in binding, but the presence of a positive charge is. Here, we report the formation of an aforementioned ternary complex reverses the binding tendencies, so that the complex between 3.10 and an aptamer binds to tartrate better than citrate. HO OH B OH N H NH2 3.10 HO B O HO O H H OH B OH N NaCNBH3, pH 8.0 2 hrs. HO B H N H N H N O 3.11 Scheme 3.2: Immobilization of the receptor on Agarose. The glyoxal agarose bead is readily loaded through reductive amination with the free amine on the receptor (3.6) in the presence of sodium cyanoborohydride. HO OH B OH N H HO B H N H N H N N H 3.12 142 Guest Citrate Tartrate Malate Glucose Fructose Lactate Succinate Gallic acid Catechin Kd (M) 5.5 x 10-6 7.1 x 10-6 6.7 x 10-5 2.0 x 10-3 2.5 x 10-3 2.0 x 10-3 6.7 x 10-3 1.0 x 10-4 2.0 x 10-3 Table 3.1: Kd values for 3.12 with various analytes. As can be seen on the table, the receptor binds to numerous analytes with similar affinity. It binds to citrate slightly better than tartrate. 3.5 RESULTS AND DISCUSSION In order to generate aptamers that could bind to both the receptor and the ligand, a selection was carried out that targeted the complex. One novel aspect of the selection was that it was carried out in the presence of 20% methanol, because 3.6 expresses higher affinity for its ligands in the presence of methanol (unpublished results). Nucleic acids are hydrophilic molecules and they prefer to be in water, but they do tolerate small percentage of organic solvents. While phage-displayed peptides have previously been selected in organic solvents,50 and while ribozymes and aptamers have shown to be either active in low concentrations of organic solvents51, 52 this is one of the first examples of a selection that has been carried out in the presence of such high concentrations of an 143 organic solvent. In order to increase the specificity of selected nucleic acid binding species for the complex, negative selections were carried out each round against an immobilized tris-amine compound (3.13), one of the precursors to the receptor that was incapable of binding tartrate. In addition, positive selections were carried out in the presence of 200 M tartrate to ensure that the immobilized organic receptor was presented as a complex. The stringency of the selection was progressively increased by increasing the concentration of salt wash (mainly LiCl) in the positive round washing as well as increasing the pool to target ratio. In the first four rounds, this high salt wash was not carried out to prevent the removal of any potential binders and to build them up. In rounds five and six, negative selections were carried out before and after the positive selection to improve upon the specificity. NH3 H3 N H N O 3.13 The progress of the selection was monitored by incorporating a radiolabel into the RNA pool and determining what fraction of the pool bound to the column (Figure 3.2). Starting round seven, target binding RNA started to dominate the pool. After thirteen rounds of selection, there was no further improvement in binding, and the selected RNA pool was cloned and sequenced. 144 Selection Assay 16 14 12 % Bound 10 8 6 4 2 0 0 1 2 3 4 5 6 7 Rounds 8 9 10 11 12 13 % resin bound % target bound Figure 3.2: The binding assay for different rounds. This assay gives an insight into the progress of the selection. In an ideal situation, one would like to see a progressive decrease in the % resin bound and an increase in % target bound as seen above as the selection moves forward. Out of the 21 sequences, seven distinct aptamer families were identified based on sequence similarities and target binding abilities, with one repeat sequence (clone #4) (Figure 3.3). All families contain two members except one that has three members. These sequences were then folded in IDT mFold (Figure 3.4) to further study the secondary structures.53 Most family members contained an eight to nine base bulge stem ten to thirteen base loop secondary structure. 145 Family # 1 (4) CCGACAUGUCGUG-AUUUCAUGCGUAGAUAACGUCCCACUCCAGUCUCAGC (8) GGCCAAGACACGG-GUGUAU-AGUUACGUAGAUGCCCUUCCGCCAUCAACCCA-C Family# 2 (9) ACGGAC-GUGUGAUACC-UACCCCGUCAGUCGACUUACUUGUGCUG (11)GGGCCAACAC-AACAGUGUAUCUGGGUACGACUUCCAUCGACUGGAGCUGC Family #3 (6) CCACAGGCC----UAGAAGGUAGCUCUGCAGCAGCACUGG-UCUACAAUCCCGCGC (10)CCCACAACCCUGUGUACUUCCCCGCAUCGCCACAGCAAUGGAUCUUCG--CC Family #4 (1) CCCCACGCGCUAACGUGUCACAUGAGCCACGCCACCUCA-UCC-CACACCGGC (5) ACACGCGCGGCUCUGGCACG-GAGGACCCAUACUUACUUCCGCAC--UGGC (2X) Family# 5 (1) CCCCACGCGCUAACGUGUCACAUG-AGCCACGCCACCUCAUCCCACACCGGC (2) GCCGCAUCGAGUUAC--UCAUGUACAGUCAGUGUAGUGCAUCCGCGUCCGGC (3) CCGCGGUGGUUUAAGGAUCUAUCC-ACUAAGAGAAUAGCA-CUUUCCCCGGC Family # 6 (6) CCACAGGCCAGAAGGUAGCUCUGCAGCAGCACUGGUCUACAAUCCCGCGC (7)GCCCCCGUAGACUACUUUUGGAAUGUGGGUGGUAACGUUGCAGUAGGGGC Family # 7 (12)AUGUAUCCGCAGGAAUCUACUCGAAACUGCACCGUCCCCACACUUGUCCUA (13) GGUAGUUAGAUGCCAAAUGAGUGAACCCCGCGCACUUUCCUC-UGUCC-ACAA Figure 3.3: The families of sequences resulted from the selection. The number in parenthesis, to the left of the sequence represents the clone # and any repeat sequences are noted in parenthesis to the right of the sequence. 146 Clone 5 Clone 1 Clone 3 Clone 2 Clone 8 Figure 3.4: Possible secondary structures of some of the selected clones. All the structures that were selected had a bulge-stem-loop structure.53 147 These families and their members were analyzed for their ability to bind to the bis-boronic acid receptor in the presence and absence of tartrate. A given RNA aptamer was radiolabeled, passed over an affinity column, washed with fifteen column bead volumes, and the fraction of RNA that bound was determined by scintillation counting (Figure 3.5). The aptamer families bound to the immobilized receptor, generally bound much better in the presence of tartrate, and could readily distinguish tartrate from citrate. Binding Assay of Families 30 25 % Bound 20 15 10 5 0 1 2 3 4 Family 5 6 7 Resin (R) R + tartrate (T) R+ host (H) R + H + T in 0% MeOH R + H + T in 20% MeOH R + H + citrate in 20% MeOH Figure 3.5: The binding assay of the families. This assay shows which family binds and discriminate the target better than the others. Different binding parameters have been examined. All seven families showed very little affinity towards the resin in the presence and absence of tartrate. All seven families exhibited a uniform affinity towards the host alone. The presence of methanol was only mattered greatly to family three, four, and seven. All families also expressed very little affinity toward citrate. Furthermore, binding appeared to be dependent on methanol (Figure 3.6). The optimum methanol concentration for binding was around 20% (v/v), and much less binding (4- 12 %) was observed in the presence of other organic solvents (Figure 3.7). 148 Solvents such as ethanol, THF, and DMF were not able to promote significant binding to the receptor. For example, clone #4 in the presence of 20% ethanol, about 3% of the aptamer was bound to the resin, and 4% of the aptamer was bound to the target. The discovery that aptamers can be selected to be dependent upon organic solvents is novel. [MeOH] on Ligand Binding 45 40 35 % Bound 30 25 20 15 10 5 0 0 5 10 15 20 25 % MeoH 30 40 50 70 Resin Bound Target Bound Figure 3.6: Assay for the effect of [MeOH] on Ligand Binding. The ligand binding was optimum at 20% MeOH, (the concentration of MeOH under selection conditions). Both ligand binders and resin binders started to increase above 50% of MeOH. It is due to the fact that the aptamer started to precipitate out at higher MeOH concentrations and did not wash away during the washing step. 149 Solvent Effect 14 12 10 % Bound 8 6 4 2 0 10 20 30 50 DMF- Bead Bound DMF- Target Bound EtOH- Bead Bound EtOH- Target Bound THF- Bead Bound THF- Target Bound % Solvent Figure 3.7: The effect of various solvents on ligand binding. In the presence of all the other organic solvent systems that were tried out, none showed as good binding affinity for the ligand as the methanol system. One of the aptamers (clone #5, a member of Family #4) that had the highest affinity and specificity for the receptor was chosen for further studies. In order to more precisely determine the binding constant of this aptamer for the receptor and tartrate complex, the aptamer was labeled at its 3' end with fluorescein,54 and changes in fluorescence intensity were observed as a function of receptor concentration. Tor and coworkers have recently shown a similar system, in which a pyrene labeled HIV-1 TAR (through a 2'-amino-butyryl linkage) was used to measure the Kd between aminoglycosides and RNA.55 The Kd value for the receptor could be extracted by fitting the titration curve (Figure 3.8). 150 Fluorescence 95 Normalized Fluorescence 85 75 65 55 45 35 0 200 400 600 800 1000 1200 Target Concentration ( M) Citrate No Ligands Tartrate W/O MeOH Tartrate Figure 3.8: Fluorescence measurements with clone #5 under various conditions. The receptor was added in increments to the fluorescein labeled RNA under the selection conditions with a constant concentration (200 M) of ligands (citrate or tartrate). On its own, the bis-boronic acid receptor is only slightly specific for tartrate (Kd (M) for tartrate = 7.1x10-6, Kd for citrate = 5.5x10-6). However, in the context of the aptamer the specificity of the receptor is dramatically altered. Tartrate is now bound with a Kd of 2.1x10-4, but citrate is bound with a Kd that is below the limit of detection (< 3x10-3) (Table 3.2). The simplest explanation for these results is that the aptamer has formed a pocket that can more precisely accommodate the receptor:tartrate complex, and can exclude citrate via steric or charge repulsion interactions. The discrimination ratio between tartrate and citrate goes from 1.17 (for citrate) in the absence of the aptamer to 15 (for tartrate) in the presence of the aptamer. Given that there is about a tweny-eight fold loss in the affinity of the receptor for tartrate in the context of the aptamer, an 151 additional possibility is that at least part of the tartrate-binding energy is used to generate an induced fit conformation. Analyte Tartrate Tartrate W/O MeOH No ligands Citrate Kd(M) 2.1 x 10-4 5.0 x 10-4 < 1.3 x 10-3 < 3.0 x 10-3 Table 3.2: Kds for the Aptamers under various Conditions. The dissociation constants of aptamer and the complexes formed from the receptor with tartrate or citrate, and the receptor alone. The formation of the ternary complex with tartrate, receptor, and aptamer is twice as likely in the presence of methanol compare to when there is no methanol. When the receptor is present alone, a ternary complex is not formed and the aptamer has much less affinity towards the receptor. In the presence of citrate, the affinity of aptamer for the receptor is even lower. In order to assess whether or not the selected aptamer:receptor complex underwent a conformational change upon binding tartrate, in-line assays were performed with radiolabeled aptamer. 35, 36, 44-46 These assays rely upon the enhanced cleavage rates that are observed at neutral pH in single-stranded versus double-stranded regions of structured RNA molecules. In-line assays have previously been extensively used to provide insights into whether portions of aptamers or other functional RNAs change upon ligand-binding.35, 36, 44-46 Numerous assays at different conditions were ran, and the predicted secondary structures53 of the aptamers were consistent with their observed digestion patterns. (Figure 3.9, Lanes 3, 4, and 5). The aptamer readily undergoes a conformational change upon the introduction of the receptor (Lanes 3, 4, and 5). To further investigate the dramatic change in cleavage patterns upon the introduction of the receptor, in-line assays were carried out after longer incubations of the controls (aptamer in the absence of the receptor). Similar cleavage patterns were observed upon incubation of the aptamer in selection buffer alone for a much longer time (Figure 3.10). The data 152 suggest that prior to receptor binding the aptamer has a tertiary structure (such a pseudo knot). However, upon the introduction of the receptor, there is a conformational change in the overall folding. On the other hand, in the presence of tartrate alone, the aptamer didn't undergo a conformational change, suggesting that tartrate does not independently bind to the aptamer. These results verify that the aptamer specifically recognizes the receptor:tartrate complex, and suggest a random kinetic mechanism for binding in which tartrate can bind to the receptor either before or after the receptor complexes with the aptamer. Most importantly, they confirm that a portion of the receptor-binding and tartrate-binding energy goes towards structural re-organization, and that this reorganization may assist in discrimination against citrate. 153 MeOH Tartrate Receptor + - + + - + + + + + + + A-53 A-53 C-35 A-43 G-23 C-35 G-23 U-11 Figure 3.9: The in-line assay results of clone #5. This assay was done using the 5' [-32P]ATP labeling. In the absence of receptor and tartrate (lane 1), there is uniform cleavage. The cleavage patterns are not changed in the presence of tartrate alone (lane 2). In the presence of the receptor (lanes 3, 4, and 5), there is a substantial change in cleavage, especially at the 5' end till G23 and around regions C35 to A53. This suggests that the aptamer undergoes a conformational change upon the introduction of the receptor. 154 MeOH Tartrate [Receptor] (mM) Incubation Time (hrs) + - + - + - + + - + 1 + + .001 + + .01 + + .1 + + 1 + 1 46 24 16 16 16 16 16 16 16 16 C-70 C-60 A-53 A-43 C-35 Figure 3.10. The effect of incubation time on cleavage patterns. Upon longer incubation times (lanes 1 and 2) the cleavage patterns of aptamer without the receptor, looked similar to the ones with the receptor. It suggests the existence of a more complex ternary structure prior to the receptor binding. 155 3.6 SUMMARY AND FUTURE DIRECTIONS Because of their relative simplicity, synthetic receptors often lack the selectivity observed for nucleic acid receptors (aptamers). Aptamers are not known for their binding ability for ligands that are anionic in nature, especially small ligands without heterocyclic character, due to the charge repulsion they present with the phosphodiester backbone. In vitro selection of RNAs against the bis-boronic acid host: tartrate complex resulted in RNA receptors that are capable of forming a ternary complex specific for tartrate. Not only is the specificity of the receptor reversed to bind tartrate, but specificity increased by a factor of about 15. The formation of this complex is also sensitive to the presence of methanol. The in-line assays reveal the change in the RNA conformation upon the introduction of the synthetic host. The utility of generating an aptamer:receptor complex for the recognition of small organic molecules is best attested by noting that tartrate is the smallest organic ligand ever recognized by an aptamer. This work serves as a model for future studies to improve the specificity of synthetic receptors and immediately suggests a novel route to the development of chimeric biosensors for small, otherwise hard-todetect organic analytes. The synthetic receptor technology and the aptamer technology complement each other in development of high specificity sensors for analytes that are of high interests, such as warfare agents and biomedical diagnostic compounds. 3.7 MATERIALS AND METHODS Reagents. The 2% cross-linked glyoxal agarose resin was purchased from Agarose Bead Technologies (ABT, Tampa, FL). The solvents and the buffer salts were purchased from Sigma (St. Louis, MO). The N-50 RNA pool was synthesized on an Expedite 8909 DNA synthesizer (PE Biosystems, Foster City, CA) using synthesis reagents from Glen 156 Research (Sterling, VA). Technologies (Coralville, IA). The primers were purchased from Integrated DNA Pool Construction. A single stranded DNA pool containing 50 randomized positions (N50: 5'-CATCAGTTAGTCATTACG-N50was synthesized ATTGTGAAGTCGTGTCCCTATAGTGAGTCGTATTAGAA-3') according to the previously reported methodology.9 The pool was PCR amplified using primers 5'-TTCTAATACGACTCACTATAGGGACACGACTTCACAAT-3' (38.50 primer) and 5'-CATCAGTTAGTCATTACGCTTACG-3' (24.50 primer), where the underlined residues are part of the T7 RNA polymerase promoter and is not transcribed. Target Immobilization. The immobilization of the bis-boronic acid receptor (1) and its tris-amine precursor were performed as follows. To a 10 ml slurry of glyoxal agarose beads, 50 ml of cyanoborohydride coupling buffer (20 mM sodium phosphate at pH 8.0 and 3 g/L sodium cyanoborohydride) was added. To this mixture, 1 ml of 200 M target (in 20 mM sodium phosphate buffer) was added. This reaction mixture was incubated for three hours and the beads were then drained and were subsequently washed with the coupling buffer. In order to block the free aldehyde sites, the resins were then treated with 1 ml of methylamine (in 70 % MeOH) in the coupling buffer. After another three hours of incubation, the resins were drained and washed with the coupling buffer. Further over-night washes were carried out with water to remove any uncoupled amines or reagents from the beads. In Vitro Selection. The selection was initiated with four pools of RNA. The RNA pools in selection buffer (100 mM tris, 20 mM MgCl2, and 100 mM LiCl at pH 7.6) were initially denatured by heating at 72 C for two minutes and was cooled down to room 157 temperature over 10 minutes. Methanol (20% final concentration) and tartrate (200 M final concentration) were then added for a total volume of 300 l and was then incubated with the resin at room temperature. The selection and amplification are carried out according to the standard protocols.10 In every round of negative and positive selection, the resin was incubated in the presence of RNA and was subsequently washed with selection buffer to remove any unbound and weak binding RNA. The volume of this wash was progressively increased from round one through round thirteen (30 bead volumes to 500 bead volumes). Negative selections were carried out using both trisamine loaded agarose resins (4), and with agarose resins that are blocked at all the glyoxal sites with methylamine. The reverse transcription was carried out using SuperScriptTM II Reverse Transcriptase (Invitrogen, Carlsbad, CA), while PCR was carried out using homemade DNA Polymerase. The transcription was carried out using AmpliscribeTM High Yield Transcription Kit (Madison, WI). The round thirteen selected pool was cloned (TA Cloning Kit; Invitrogen) and sequenced using the Dye Terminator Cycle Sequencing Kit (Beckman Coulter, Fullerton, CA) and a CEQ 2000 XL DNA sequencer (Beckman Coulter). Binding Assays. Following every rounds of selection, the double stranded DNA pool was transcribed with [-32P]UTP (2.0 mCi, 3000 Ci/mmol; Easytides). Binding assays were performed similar to the selection itself, but the resin was only washed with 30 bead volumes of the selection buffer and fractions were collected. The radioactivity was quantified using a scintillation counter and the bound RNA to unbound RNA from one round to the next was compared. 158 Fluorescent Measurements. The aptamers were 3' labeled using 5-(((2-carbohydrazino) methyl) thiol acetyl) aminofluorescein (Molecular Probes, Eugene, OR), under published conditions.11 The fluorescein labeled aptamer was then purified on a 8% denaturing acrylamide gel. All fluorescence measurements were carried out on a PTI Quantamaster QM-4/2003SE spectrofluorimeter (Photon Technology International, Ontario, Canada). The aptamer (10 nM) was incubated at 72 C for 2 minutes and was allowed to cool down same as the selection conditions above. The fluorescence response was measured by exciting the samples at 494 nm (the ex for fluorescein) and emitting at 518 nm (the em for fluorescein). The response was instantaneous and the signal was steady after 2 minutes. The fluorescence emission was then plotted with the incremental addition of targets. This emission data set was fit to the equation: y = 100 + AX/(X+B) Where y is the percent change in the fluorescence at a given target concentration, A is the fluorescence intensity at saturating target concentrations, X is the concentration of the target, and B is the apparent dissociation constant value. In -line Assays. The in-line assays were carried out using both 5' and 3' labeling of the aptamer. The aptamer was end-labeled using T4 polynucleotide kinase (Invitrogen) and [-32P] ATP (2.0 mCi, 7000 Ci/mmol; ICN Biomedicals) in exchange buffer (Invitrogen) and was gel purified (6% denaturing acrylamide gel). The in-line reactions were set-up under the selection condition with 500 pmoles of aptamer for a total volume of 20 l. They were then incubated for various times, and ran on an 8% denaturing acrylamide gel. The gel was dried and was visualized by autoradiography. 159 3.8 REFERENCES. 1. 2. 3. Lehn, J.-M. (1971) Structure Bonding 16, 1. Lehn, J.-M. (1995) Supramolecular Chemistry, VCH, New York. Humphries, J. E. & Yoshino, T. P. (2003) Cellular receptors and signal transduction in molluscan hemocytes: connections with the innate immune system of vertebrates. Integrative and Comparative Biology, 43, 305-312. Besanger, T. R. & Brennan, J. D. (2003) Ion Sensing and Inhibition Studies Using the Transmembrane Ion Channel Peptide Gramicidin A Entrapped in Sol-GelDerived Silica. Analytical Chemistry 75, 1094-1101. Van der Merwe, P. A. & Davis, S. J. (2003) Molecular interactions mediating T cell antigen recognition. Annual Review of Immunology 21, 659-684. Kyogoku, Y., Fujiyoshi, Y., Shimada, I., Nakamura, H., Tsukihara, T., Akutsu, H., Odahara, T., Okada, T., & Nomura, N. (2003) Structural Genomics of Membrane Proteins. Accounts of Chemical Research 36, 199-206. Sheridan, M. A., Kittilson, J. D., & Slagter, B. J. (200) Structure-function relationships of the siganaling system for the somatostatin peptide hormone family. American Zoologist 40, 269-286. Luedtke, N. W., Liu, Q. & Tor, Y. (2003) RNA-Ligand Interactions: Affinity and Specificity of Aminoglycoside Dimers and Acridine Connjugates to the HIV-1 Rev Response Element. Biochemistry 42, 11391-11403. Moravek, Z., Neidle, S., & Schneider, B. (2002) Protein and drug interactions in the minor groove of DNA. Nucleic Acids Research 30, 1182-1191. Stojanovic, M. N. & Landry, D. W. (2002) Aptamer-Based Colorimetric Probe for Cocaine. Journal of the American Chemical Society 124, 9678-9679. Berens, C., Thain, A. & Schroeder, R. (2001) A tetracycline-binding RNA aptamer. Bioorganic & Medicinal Chemistry 9, 2549-2556. Hermann, T. & Patel, D. J. (2000) Adaptive recognition by nucleic acid aptamers. Science 287, 820-825. Zhang, Y., Gu, H., Yang, Z., & Xu, B. (2003) Supramolecular Hydrogels Respond to Ligand-Receptor Interaction. Journal of the American Chemical Society 125, 13680-13681. 160 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. Wisner, J. A., Beer, P. D., Drew, M. G. B., & Sambrook, M. R. (2002) AnionTemplated Rotaxane Formation. Journal of the American Chemical Society 124, 12469-12476. de Jong, M. R., Knegtel, R. M. A., Grootenhuis, P. D. J., Huskens, J., & Reinhoudt, D. N. (2002) A method to identify and screen libraries of guest that complex to a synthetic host. Angewandte Chemie International Edition in English 41, 1004-1008. Fraser, H. & Rebek, J. (2002) Molecules within molecules: recognition through self-assembly. Proceedings of the National Academy of Sciences of the United States of America 99, 4775-4777. Hart, B. R. & Shea, K. J. (2001) Synthetic Peptide Receptors: Molecularly Imprinted Polymers for the Recognition of Peptides Using Peptide- Metal Interactions. Journal of the American Chemical Society 123, 2072-2073. Goshe, A. J., Steele, I. M., & Bosnich, B. (2003) Supramolecular Recognition. Terpyridyl Palladium and Platinum Molecular Clefts and Their Association with Planar Platinum Complexes. Journal of the American Chemical Society 125, 444451. Gray, C. W. & Houston, T. A. (2002) Boronic Acid Receptors for .alpha.Hydroxycarboxylates: High Affinity of Shinkai's Glucose Receptor for Tartrate. Journal of Organic Chemistry 67, 5426-5428. Grawe, T., Schrader, T., Zadmard, R., & Kraft, A. (2002) Self-Assembly of BallShaped Molecular Complexes in Water. Journal of Organic Chemistry 67, 37553763. Ait-Haddou, H., Wiskur, S. L., Lynch, V. M. & Anslyn, E. V. (2001) Achieving Large Color Changes in Response to the Presence of Amino Acids: A Molecular Sensing Ensemble with Selectivity for Aspartate. Journal of the American Chemical Society 123, 11296-11297. Rensing, S., Arendt, M., Springer, A., Grawe, T., & Schrader, T. (2001) Optimization of a Synthetic Arginine Receptor. Systematic Tuning of Noncovalent Intractions. Journal of Organic Chemistry 66, 5814-5821. Chen, C.-H. B., Chernis, G. A., Hoang, V. Q. & Landgraf, R. (2003) Inhibition of heregulin signaling by an aptamer that preferentially binds to the oligomeric form of human epidermal growth factor receptor-3. Proceedings of the National Academy of Sciences of the United States of America 100, 9226-9231. 15. 16. 17. 18. 19. 20. 21. 22. 23. 161 24. Jhaveri, S., Olwin, B., & Ellington, A. D. (1998) In vitro selection of phosphorrothiolated aptamers. Bioorganic & Medicinal Chemistry Letters 8, 2285-2290. Weigand, T. W., Williams, P. B., Dreskin, S. C., Jouvin, M.-H., Kinet, J.-P., & Tasset, D. (1996) High-affinity oligonucleotide ligands to human IgE inhibit binding to Fc.epsilon. receptor I. Journal of Immunology 157, 221-230. Jenison, R. D., Gill, S. C., Pardi, A., & Polisky, B. (1994) High-resolution molecular discrimination by RNA. Science 263, 1425. Groenen, L. C. & Reinhoudt, D. N. (1992) Calix[4]arenas, molecular platforms for supramolecular structures. In Supramolecular Chemistry by Balzani, V. & De Cola, L. Kluwer Academic Publishers, Boston. Hamilton, A. D. (1992) New Synthetic Receptors for Complexation and Catalysis. In Supramolecular Chemistry by Balzani, V. & De Cola, L. Kluwer Academic Publishers, Boston. Delaage, M. (1991) Molecular Recognition Mechanisms. VCH Publishers, Inc. New York. Sherman, D. & Henry, J. P. (1980) Role of the proton electrochemical gradient in monoamine transport by bovine chromaffin granules. Biochim. Biophys. Acta 601, 664-677. Takeuchi, M., Yoda, S., Imada, T., & Shinkai, S. (1997) Chiral sugar recognition by a diboronic-acid-appended binaphthyl derivative through rigidification effect. Tetrahedron 53, 8335-8348. Gray, Jr., C. W. & Houston, T. A. (2002) Boronic Acid Receptors for Hydroxycarboxylates: High Affinity of Shinkai's Glucose Receptor for Tartrate. Journal of Organic Chemistry 67, 5426-5428. Ballistreri, F. P., Notti, A., Pappalardo, S., Paris, M. F., & Pisagatti, I. (2003) Multipoint Molecular Recognition of Amino Acids and Biogenic Amines by Ureidoxalix[5]arene Receptors. Organic Letters 5, 1071-1074. Arduini, A., Secchi, A., & Pochini, A. (2000) Recognition of Amides by New Rigid Calix[4]arene-Based Cavitands. Journal of Organic Chemistry 65, 90859091. Soukup, G. A. & Breaker, R. R. (1999) Relationship between internucleotide linkage geometry and the stability of RNA. RNA 5, 1308-1325. 162 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. Li, Y. & Breaker, R. R. (1999) Kinetics of RNA degradation by specific base catalysis of transesterification involving the 2'-hydroxyl group. Journal of the American Chemical Society 121, 5364-5372. Kuimmelis, R. G. & McLaughlin, L. W. (1998) Mechanisms of ribozymemediated RNA cleavage. Chemical Reviews 98, 192-212. Oivanen, M., Kuusela, S., & Lonnberg, H. (1998) Kinetics and mechanisms for the cleavage and isomerization of the phosphodiester bonds of RNA by Bronsted acids and bases. Chemical Reviews 98, 961-990. Raines R. T. (1998) Ribonuclease A. Chemical Reviews 98, 1045-1065. Zhou, D.-M. & Taira, K. (1998) The hydrolysis of RNA: From theoretical calculations to the hammerhead ribozyme-mediated cleavage of RNA. Chemical Reviews 98, 991-1026. Westheimer, F. H. (1968) Pseudo-rotation in the hydrolysis of phosphate esters. Accounts in Chemical Research 1, 70-78. Lightstone, F. C. & Bruice T. C. (1996) Ground state conformations and entropic and enthalpic factors in the efficiency of intramolecular and enzymatic reactions. 1. Cyclic anhydride formation by substituted glutharates, succinate, and 3,6endoxo-D4-tetrahydrophthalate monophenyl esters. Journal of the American Chemical Society 118, 2595-2605. Bruice, T. C. & Lightstone, F. C. (1999) Ground state and transition state contributions to the rates of intramolecular and enzymatic reactions. Accounts in Chemical Research 32, 127-136. Ciesiolka, J., Lorenz, S., & Erdmann, V. A. (1992) Different conformational forms of Escherichia coli and rat liver 5S rRNA revealed by Pb(II)- induced hydrolysis. European Journal of Biochemistry. 204, 583-589. Welch, M., Majerfeld, I., & Yarus M. (1997) 23S rRNA similarity from selection for peptidyl transferase mimicry. Biochemistry 36, 6614-6623. Zagorowska, I., Kuusela, S., & Lonnberg H. (1998) Metal ion-dependent hydrolysis of RNA phosphodiester bonds within hairpin loops. A comparative kinetic study on chimeric ribo/2'-O-methylribo oligonucleotides. Nucleic Acids Research 26, 3392-3396. Usher, D. A. & McHale A. H. (1976) Hydrolitic stability of helical RNA: A selective advantage for the natural 3',5'-bond. Proceedings of the National Academy of Sciences of the United States of America 73, 1149-1153. 163 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. Wiskur, S. L., Floriano, P. N., Anslyn, E. V. (2003) A multicomponent sensing ensemble in solution: Differentiation between structurally similar analytes. Angewandte Chemie International Edition in English 42, 2070-2072. Wiskur, S. L. & Anslyn, E. V. (2001) Using a Synthetic Receptor to Create and Optical-Sensing Ensemble for a Class of Analytes: A Colorimetric Assay for the Aging of Scotch. Journal of the American Chemical Society 123, 10109-10110. Petrenko, V. A., Smith, G. P., Gong, X., & Quinn, T. (1996) A library of organic landscapes on filamentous phage. Protein Engineering, 9, 797-801. Hanna, M. & Szostak, J. W. (1994) Suppression of mutations in the core of the Tetrahymena ribozyme by spermidine, ethanol and by substrate stabilization. Nucleic Acids Research 22, 5326-5331. Seelig, B., Keiper, S., Stuhlmann, F., & Jaschke, A. (2000) Enantioselective ribozyme catalysis of a bimolecular cycloaddition reaction. Angewandte Chemie International Edition in English 39, 4576-4579 http://biotools.idtdna.com/mfold/ Qin, P. Z. & Pyle, A. M. (1999) Site-specific labeling of RNA with fluorophores and other structural probes. A Companion to Methods in Enzymology 18, 60-70 Blount, K. F. & Tor, Y. (2003) Using pyrene-labeled HIV-1 TAR to measure RNA-small molecule binding. Nucleic Acids Research 31, 5490-5500. 49. 50. 51. 52. 53. 54. 55. 164 CHAPTER 4: TOWARDS THE DEVELOPMENT OF AN AMINO ACID - NUCLEOTIDE INTERACTION DATABASE 4.0 INTRODUCTION Proteins are one of the most common ligands for nucleic acids in living systems as seen in chapter 1. Thus, there is a great need to understand the interactions between nucleic acids and proteins. Aptamers have been selected against proteins such as epidermal growth factor receptor,1,2 Ras protein,3 hepatitis B virus core protein,4 and HPV-16 E7 oncoprotein.5 There are numerous reviews on the use of peptide aptamers as potential therapeutics.6-10 Peptide aptamers have been selected to study proteins and protein networks.11-14 Different aspects of protein- nucleic acids interactions need to be understood to design better inhibitors and therapeutic agents. The development of an interaction database between primary structures (amino acids and nucleotides) can aid the medicinal chemists in developing better drug candidates. There exists such interaction databases, based on existing protein- nucleic acid structures in the protein data bank.15-17 However, it is well known that naturally occurring proteins are not necessarily the best binder of a given nucleic acid. Often, selected aptamers express the highest affinity and specificity for their ligands. A more useful database for the purpose of designing peptidomimetics can be created by analyzing aptamers selected against peptides and proteins. For example, selections that are carried out against the members of a tetrapeptide library can give information about nucleic acid molecular recognition of short peptides or a small segment of a large protein, such as the role and the position of a certain amino acid in molecular recognition. It is known that molecular recognition is a 165 function of folded structures of both nucleic acids and proteins. Thus, aptamers against individual amino acids are not that attractive for this purpose. In this chapter, we will look at our progress toward the development of an amino acid nucleotide interaction database using a synthetic tetrapeptide (4.1). Here, we seek to uncover the origin of selectivity in aptamer-peptide binding. A guanidine containing alkyl linker attached to a tetra peptide (4.1) was synthesized and selection was carried out against this target. The guanidine moiety was incorporated in 4.1 to enhance the binding to aptamers, as will be explained later. The amino acids in 4.1 also have high affinity for nucleic acids as seen in the "aant" database.15 Following the synthesis, this molecule was then used in RNA aptamer selection. From this selection, we seek to answer certain questions regarding protein-nucleic acid interactions. Would the binding affinity of an aptamer to a peptide containing ligand change as the length of the peptide decreases? If it does, which amino acids are important in binding? Do the positions of amino acids play a role in aptamer binding? The information gained from this work could be used as a foundation for future research, involving the development of a binding database of tetrapeptide libraries to aptamer libraries. However, before looking at the synthesis of the target and selection we will look at guanidiniums and their synthesis. 166 HO O O HO H N N H N O 4.1 H N O N H O H N O OH O N H NH3 O NH2 4.1 GUANIDINIUMS Strecker discovered the first guanidine (the deprotonated form of guanidinium) in 1861 and was named for its similarity to the purine base guanine.18 Guanidiniums are very weakly acidic molecules (pKa around 12.5) with the capacity to form intermolecular contacts mediated by H-bonding interactions.19 The guanidinium moiety is common in natural products20 and is important in processes in living systems,21, 22 On the other hand, toxic effects of guanidine compounds have also been observed.21 The guanidinium moiety is of interest due to its biological activity, hydrogen bonding capability, stability, and positive charge integrity over a wide pH range, due to its high pKa.22 Also, its molecular recognition features are used for DNA base pairing and in the active sites of many enzymes.23 There are many ways to synthesize guanidinium containing Guanidinium group compounds through solution phase and solid phase synthesis.23 containing molecules have been developed as chemosensors for nucleotide triphosphates such as ATP.24 4.1.1 Guanidiniums in Proteins Arginine, a naturally occurring amino acid with a guanidinium moiety is found in numerous enzyme active sites and cell recognition motifs. Horseradish Peroxidase,25 167 Fumarate Reductase,26 Creatine Kinase,27 and Malate Dehydrogenase,28 are just a few enzymes that have arginine containing active sites. Integrins are a family of transmembrane cell surface receptors that are involved in cell-cell and cell-matrix adhesion processes. The tripeptide sequence RGD (Arg-Gly-Asp) is a common cellrecognition motif, responsible for the binding of the integrin receptors.29 This sequence has been used as a lead for developing different integrin antagonists.30 4.1.2 Guanidiniums as Pharmaceutical Agents Nonpeptide cyclic cyanoguanidines are used as HIV-1 protease inhibitors,31 while carbocyclic guanidino analogues are used as influenza neuraminidase inhibitors.32 Guanidinium based molecules are also extensively used as cardiovascular drugs,33 antihistamines,34 anti-inflammatory agents,35,36 antidiabetic drugs,37 antibacterial and antifungal drugs,38 antiprotozoal and other antiparasitic drugs,39 anthelmintics,40 antineoplastic and antiviral drugs,41 and central nervous system drugs. Guanidinium containing molecules are used as the inhibitors of neuronal Na+ channels.42, 43 Ptilomycalin, a guanidine containing molecule is a Na+, K+, or Ca2+ ATPase inhibitor. It competitively interacts with ATP at its binding sites. Thus, it has become a tool for clarifying the ATP binding site in these enzymes.44 Gabexate, yet another guanidino compound, is a proteinase enzyme inhibitor that reduce insulin degradation and is useful in suppressing the progress of acute pancreatitis.45 Guanidinium derivatives are also used as histamine H3-receptor antagonists.46 Oligonucleotides incorporating 4-guanidino-2pyrimidinone nucleobases were designed to mimic the double hydrogen bond donor pattern of protonated cytosines in parallel triple helices.47 168 4.1.3 Guanidinums in Molecular Recognition Guanidiniums are widely used for molecular recognition purposes in supramolecular chemistry. Host compounds containing guanidiniums have synthesized to sense aromatic carboxylate anions,48 phosphodiesters,49 underivatized amino acids,50 and dinucleotides51 among others. 4.1.4 Other Uses of Guanidiniums Guanidinium containing compounds such as guanidinoacetic acid are used as artificial sweeteners.52 The cyclic dipeptide composed of L-phenylalanine and L- norarginine catalyze the enantioselective Strecker synthesis of (S)-phenylglycine derivatives from N-substituted aldimines and hydrogen cyanide.53 Modified guanidines are used as potential chiral superbases.54 4.2 SYNTHESIS OF GUANIDINIUMS There are numerous ways to synthesize guanidiniums through solid phase combinatorial chemistry.55 However, prior to carrying out a synthesis on solid phase, the synthesis is optimized in solution phase. Combinatorial solid-phase synthesis is gaining momentum throughout the pharmaceutical industry as a powerful tool for preparing libraries of drug-like organic molecules.56 4.2.1 Guanidiniums through Solid Phase Combinatorial Chemistry The advances in solid phase synthesis allow us to make guanidinium oligomers and other synthetically challenging compounds containing guanidine moieties in a short period of time. There are many methods known to synthesize guanidine moieties.57 The solid phase synthesis of guanidines mainly focuses on three different approaches, namely, the formation of resin-bound carbodiimides and their reaction with amines,58,59 the solid169 phase synthesis involving electrophiles in solution, and the reaction of supported thioureas with amines.60 4.2.2 Guanidinium from Thiourea Various methods exist for the synthesis of guanidiniums from different starting materials and reagents. One of the well-known methods is the conversion of thioureas into guanidiniums in the presence of a coupling reagent.23 Thiourea groups are used as a precursor for guanidinium groups, as well as peptidomimetics,61 a quencher,62 thiazolylhydantoines,63 and a precursor to 2-aminothiazole rings.64 The thiourea moiety is converted to guanidinium functionalities in the presence of different coupling reagents: N, N-diisopropylcarbodiimide (DIC),65 Mercury (II) chloride (HgCl2),66 Mercury (II) oxide (HgO),67 2-chloro-1-methyl pyridinium iodide (Mukaiyama's reagent),68 1-(3dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC),69 2,4- dinitrofluorobenzene (Sanger's reagent),70 and triphenylphosphine dichloride.71 4.2.2.1 The Synthesis The general sequence of synthesizing guanidiniums via a thiourea is illustrated in Scheme 4.1. At first, potassium thiocyanate is allowed to react with an acid chloride to give the protected thiocyanate (4.2). The yield and the efficiency of this step varies dramatically depending on the acid chloride used. For example, while the formation of Fmoc-NCS is a very clean reaction with a high yield, the formation of Cbz-NCS is very erratic with low yields and numerous side products. Addition of an amine to the protected thiocyanate (4.2) results in the formation of thiourea (4.3). An amine can then be coupled to the thiourea to form guanidine (4.4) with coupling reagents such as EDCl, 170 Sanger's reagent, Mukaiyama's reagent, and HgCl2. Deprotection of 4.4 then gives the guanidinium 4.5. O Cl O R1 K NCS 0 C, 3 hours o S O C N O R1 CH2Cl2 R2NH2 S R2 N H N H O O R1 1) EDCl, DMF, Et3N 2) R3NH2 4.2 R3 NH R2 N H N O O R1 R3 4.3 NH Deprotection R2 N H NH2 4.4 4.5 Scheme 4.1: General scheme for the synthesis of secondary guanidiniums. The commercially available acid chloride is reacted with potassium thiocyanate to yield the isothiocyante (4.2) which is readily converted to the thiourea (4.3) in the presence of a primary amine. The thiourea (4.3) can then be coupled in the presence of EDCI with another primary amine to yield the guanidine (4.4) that can be deprotected to give the guanidinium (4.5). 4.2.2.2 Protecting Groups for the Thiourea There are a few protected thiocyanates (4.2) that can be used for the guanylation process. The conversion of thioureas into guanidiniums is usually accomplished with an electron withdrawing protecting group on the thiourea. These protecting groups, such as Fmoc,23 and benzoyl,72 activate the thiourea for the coupling reaction. The protecting group is selected based on its ease of removal. The two most common protecting groups that are used for this purpose is fmoc and benzoyl. Fmoc group is removed under mild conditions (amine bases) while the deprotection of benzoyl group is under harsh conditions (HCl under reflux, 48 hrs.). Thus, there is a demand for protecting groups that can withstand mild conditions yet be removed fairly easily. Most thioureas that contain these activating groups can be only coupled with primary amines. Furthermore, the efficiency of guanylation depends on the group attached to the primary amine and the 171 yield in general is below 70%. Thioureas mostly react with primary amines attached to primary carbons due to the bulkiness of the protecting groups. The efficiency of guanylation also depends upon whether the group that is attached to the amine is electron withdrawing or electron donating. Amines attached to electron withdrawing groups tend to give lower yields in guanylation. Thus, there is also a demand for a protecting group that can yield high guanylation and do not discriminate based on the overall sterics and electronics of the primary amine. 4.2.2.2.1 A Novel Protecting Group for the Synthesis of Guanidiniums Before we started the synthesis of 4.1, we were interested in the use of ethyl thiocyanato formate (4.6) in guanidinium synthesis (Scheme 4.2), since it is commercially available and the corresponding thiourea (4.7) is readily prepared. We envisioned that the much smaller ethyl carbamate-protecting group could alleviate steric hindrance problems created by bigger carbamate groups such as Boc, Fmoc, and benzoyl. To investigate the electronic and steric limitations of the coupling in the presence of this protecting group, we decided to couple different amines to the carbamate protected benzyl thiourea. Here, we will look at our findings on the synthesis of ethyl carbamate protected guanidines using EDCl (Scheme 4.2), Mukaiyama's reagent, and Sanger's reagent. We will also look at the electronic and steric effects of different amines on the guanylation as well as their deprotection using trimethyl silyl bromide (Me3SiBr). 172 S NH2 + S C N O O O N H O CH2Cl2, 2 hrs. 98% HN N H R N H O O N H 4.6 1) 2 equiv. of EDC, 3 equiv. of Et3N, THF 2) H2N-R, 48 hrs. 4.7 HN R NH2 TMSBr DMF, Reflux 12 hrs. N H 4.8 4.9 Scheme 4.2: Guanidinium synthesis using ethyl carbamate protecting group. The commercially available isothiocyante (4.6) is readily converted to the thiourea (4.7) which is then coupled with an amine in the presence of EDCl to give the guanidine (4.8) and was deprotected with trimethylsilyl bromide under reflux to give the guanidine (4.9). The coupling of amines (A-I, Figure 4.1) to thiourea succeeds with EDCl coupling conditions without any major, undesirable side products after 48 hours. This same reaction was also attempted with Mukaiyama's and Sanger's reagent in place of EDCl under different reaction conditions. The use of Mukaiyama's reagent did not give any products. On the other hand, Sanger's reagent gave lower yields along with side products. The guanidines obtained via EDCl coupling were easily purified through flash chromatography. The yields of these guanidines are reported in Table 4.1. From the Table 4.1, it is evident that all the amines gave comparably similar and high yields. It was concluded that the ethyl carbamate protecting group is very efficient in the synthesis of guanidinium derivatives especially for coupling an amine that is attached to a secondary or tertiary carbon, and even aryl amines. 173 NH2 O NH2 NH2 A D O G NH2 H2 N O NH2 NH2 B E H NH2 O2N NH2 NH2 C F I Figure 4.1: The primary amines that were coupled to the thiourea. The amines were selected to study the sterics (G, H, and I) and the electronic effects (A-F). Amine % Yield of: HN N H R N H O O A B C D E F G H I 80 83 88 85 78 80 87 85 83 4.8 Table 4.1: The yield of various guanidines. As can be seen from the table, the EDCl coupling of thiourea 4.7 with various amines (A-I) resulted the guanidines in high yields. The removal of the ethyl carbamate group was carried out using Me3SiBr under reflux in DMF followed by protonation with methanol to give complete deprotection, as seen in Table 4.2, without cleaving the functional groups. The product was easily purified by an acid work up. The efforts to deprotect this group in the presence of reagents such as hydrazine monohydrate,73 HBr,74 Red-Al,75 and NaOH,76 that are known to cleave this group from amines, were unsuccessful. The use of ammonium hydroxide under mild 174 heating, that is known to deprotect ethyl carbamate group from the guanidine of guanosine77 also failed. Amine A B C D % Yield of: HN N H R 97 NH2 95 95 95 4.9 Table 4.2: The deprotection yields of guanidines 4.8. As can be seen from the table, the deprotection resulted in near quantitative yields. Even though, this protecting group strategy gives good coupling efficiency and high yields in deprotection, the conditions under which the deprotection was carried out was not suitable for the peptide chemistry. Thus, we decided to carry out the synthesis of 4.1 with benzoyl protecting group and leave out the deprotection. We envisioned that the aromatic protecting group might aid in binding. 4.3 SYNTHESIS OF TARGET 4.1 The synthesis of 4.1 is depicted in scheme 4.3 and scheme 4.4. All the primary amines in this synthesis are protected with fluorenyl methyl carbamate (fmoc), because fmoc is selectively deprotected without cleaving the resin using 20% piperidine. The boc-protecting group was not an option, since the resin is cleaved with trifluoro acetic acid (TFA). The diamine (4.10) is monoboc protected in 80 % yield (4.11) and is then reacted with benzoyl isothiocyanate to form the thiourea (4.12). The boc group was then removed (4.13) and replaced with an fmoc group (4.14) and was then EDCl coupled to 175 the chloro-trityl resin to yield guanidine 4.15. The fmoc group is deprtotected (4.16) and the amine was undergone standard peptide coupling with various amino acids followed by deprotection to eventually yield 4.20. The peptide was then cleaved off the resin (4.21) with trifluoro acetic acid and the benzyl protections of the peptides were removed (4.1) by palladium catalyzed hydrogenation. The free amine was then reacted with an activated biotin ester to produce the biotinylated target (4.22). This compound was then ready to be loaded on to the streptavidin resin. 176 O H2 N 4.10 O N H S N H 4.12 NH2 0.25 equiv. (Boc)2O H2 N CHCl3 80% O N O H 50% TFA CH2Cl2 95% O N H 4.14 N O H O N O H 4.11 NCS CHCl3 60% O Cl O N H S N H 4.13 NH2 DMF 90% O O N H S O O Cl EDCI, DMF NH2 O O Cl 4.15 H H N N N O NHFmoc 20% Piperidine DMF O O Cl O H H N N 4.16 N O FmocHN COONH2 1)Coupling: HOBt, TBTU, NMM DMF 2)Deprotection: 20% Piperidine in DMF O O Cl 4.17 HO N NH2 O H H N N N O O FmocHN COO- O O O Cl 4.18 FmocHN COO1) Coupling 2) Deprotection 1) Coupling 2) Deprotection H H N N N O HO O O N N O H NH2 O Cl O H H N N N O 4.19 O HO O O N N O H HN NH2 O O NH2NH2COO O NHFmoc 1) Coupling 2) Deprotection TBTU= O-(Benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium tetrafluoroborate HOBt= N-Hydroxybenzotriazole Scheme 4.3: The synthesis of the synthetic peptide. The diamine (4.10) was monoboc protected (4.11) in high yield and was subsequently converted to the thiourea (4.12). The boc group was then deprotected to yield 4.13, and was replaced with fmoc group (4.14). This compound was then coupled to the preloaded chlorotrityl resin to yield 4.15. The fmoc group was then deprotected to yield 4.16 and was then undergone standard peptide coupling to yield 4.19. 177 O O O Cl H N N H N O H N O O N H O NH2 NH2 NH O O H N O O TFA, TIS DMF 4.20 O O HO H N HN H N O H N O O N H O NH2 NH3 NH O O O H N O H2/ Pd(OH)2 THF/ MeOH 4.21 O O H N HN H N O HO H N O HO O N H H N O OH O N H NH3 O NH2 OH H N HN H N O HO H N O O N H H N O H N O O O N H HN S O NH + NaO3S O O O (CH2)5 NH S (CH2)4 HN NH O N O O 0.3 equiv. 4.1 O O pH 8.5 H 2O N O HH 2N OH 4.22 Scheme 4.4: Cleavage and deprotection of the synthetic peptide. The peptide that has been synthesized on the solid support (4.20) was cleaved off the resin (4.21) and the benzyl protecting groups were removed under palladium catalyzed hydrogenation to yield 4.1. It was then coupled to a biotin to yield 4.22. 4.4 AUTOMATED SELECTION AGAINST 4.1 After the successful completion of 4.22, using an N-30 RNA pool, automated selection (Figure 4.2)78 was carried out against it. The selection was carried out using a Biomek 2000 Laboratory Automation Workstation (Beckman Coulter, Fullerton, CA). Unlike the manual selection we have seen in the previous chapters, the automated 178 selection uses magnetic beads that are derivatized with streptavidin. The buffer conditions were 50 mM Tris, 100 mM KCl, and 10 mM MgCl2 at pH 7.5. The RNA pool is initially incubated with the target captured on magnetic beads. The beads were then washed and the bound species were then eluted and amplified. Unlike the manual selection, beads were filtered using a Millipore HV filter plate, and bound RNA species is eluted through thermal denaturation (98 C for 3 minutes). In addition, no gel purification was carried out after the transcription. After numerous rounds of selection, no high affinity target binders or families of sequences evolved from the selection. After 18 rounds of selection, two families of sequences were isolated (Figure 4.2). However, both of these sequences were bead binders. Aliquot of bound target Incubation for biotin capture Removal of unbound target via magnets incubation Addition of pool Transfer to vacuum manifold Wash Vacuum filtration Transfer to thermalcycler Denaturation Magnetic bead Target RNA Transcription PCR Thermalcycling Reverse Transcription Figure 4.2: Automated Selection Scheme. The selection is carried out on a Biomek 2000 Laboratory Automation Workstation using streptavidin bound magnetic beads. Just like the manual selection, the RNA pool is incubated with the immobilized target, and the beads were washed and the bound RNA species were then eluted. The eluted RNA is then amplified for the next round. 179 Family 1 GCGCGATCGTACAGAGCCTCTCG-ATCATAG (17 X) Family 2 GTATTACCTGTCACTGCCTCTTGCATCACG- (5 X) Figure 4.3: Families from the automated selection against 4.1. Both sequences were the predominant clones from the round 18 pool. However, both were bead binders. 4.5 A NEW MODIFIED TARGET Since the automated selection on the synthetic peptide 4.1 failed, we decided to modify the compound. In order to make the target more attractive for the RNA, our original goal was to use a linker with two guanidiniums linked in parallel and to synthesize 4.29. The synthesis of this compound starts with the formation of fmoc NCS (4.24)79,80 from fmoc chloride (4.23) and potassium thiocyanate. Then, the dithiourea 4.25 was prepared from 4.24 and diaminopropane. Coupling of 4.25 to a preloaded chloro-trityl resin (4.26) resulted in the first guanidinium linkage (4.27). The terminal thiourea was then coupled with xylene-1, 4- diamine to form the second guanidinium linkage (4.28). In both coupling reactions, EDC was the coupling agent. Serine was then coupled to the terminal amine, and the peptide was formed through amino acid coupling using TBTU and HOBT. Following the cleavage of Fmoc group, all the amines were protonated through an acid wash, and the terminal ammonium ion was preferentially deprotonated with a triethylamine wash in order to avoid the coupling of amino acid to the amine on the guanidinium. After the four rounds of amino acid coupling, deprotection, and acid/base wash 4.29 was yielded. After every round of solid phase synthesis, a small amount of the resin was cleaved and was analyzed using mass spectrometry for the presence of corresponding product. However, at the end we were 180 mainly left with fragments of this target and side products. The side products could have been created at different steps. The p-xylene diamine used for the synthesis of 4.28 wasn't mono-protected, due to the fact that the intermediate created prior to the formation of the mono fmoc protected xylene diamine was insoluble in all the solvent systems that were tried out. This might have given some cross-linked side products. Even though, the unprotected guanidines aren't as reactive as the amino acid amines, some side products might have developed in the presence of such a large amount of reactants (amino acids and coupling agents) used for solid phase synthesis. 181 O O Cl S C N K H2N NH2 S Fmoc HN N H N H S NHFmoc Ethyl acetate 48hrs 75% O O N C S 2.5 equiv. 4.23 4.24 THF 4hrs, 91% 4.25 O O Cl NH2 3 equiv. of 4.25, 3 equiv. of EDC DMF, 48hrs. O O Cl H N H N NHFmoc H N S NHFmoc 4.26 4.27 5 equiv of H2N NH2 O O Amino acid coupling Cl H N H N NHFmoc H N HN Deprotection NHFmoc 5 equiv. of EDC, DMF, 72hrs 4.28 NH2 O O O Cl H N H N NH2 H N H N NH2 O N H HO HO H N O HO O N H H N O NH2 NH2 4.29 Scheme 4.5: The synthesis target with two parallel linked guanidiniums. Initially, the fmoc NCS (4.24) was created from 4.23 and potassium thiocyanate. The dithiourea (4.25) was then developed using 4.24. The guanylation of this thiourea was then carried out with the preloaded resin (4.26) to yield 4.27. In a second guanylation step xylene diamine was coupled to yield 4.28. Standard amino acid coupling was carried out on the free amine 4.28 and eventually yielded 4.29. 4.5.1. A New Scheme for the Synthesis of 4.29 Since the synthesis of 4.29 wasn't successful, a new approach (Scheme 4.6) was tried out but was not completed due to the inconsistency of one of the steps. The alloc group can be deprotected through palladium catalyzed hydrogenation. Since, we already 182 use palladium catalyzed hydrogenation to remove the benzyl groups at the end of the synthesis, we envisioned that we can remove the alloc group in the same step. The only limitation to this synthetic scheme is the synthesis of alloc chloride (4.30). This synthesis using a patented procedure is very erratic and often end up in less than 5% yield with numerous impurities, though once in a while (one out of about 15 times), we got yields closer to 50%. Once the isothiocyanate is synthesized, it was converted to the thiourea 4.31 using 4.11. As seen before, the boc group was then be deprotected (4.32) and was replaced with an fmoc group (4.33). Then this thiourea was coupled to the preloaded resin to form a guanidine linkage (4.34). Upon deprotection, another 4.33 can be coupled to the free amine to form the secondary guanidine. However, due to the inadequate procedure for the sufficient synthesis of 4.30, this synthesis was halted. 183 O K NCS + Cl O O Quinoline, NaOAc H2 O 0 - r.t. S C N 4.30 O O + H2N 4.11 N H O 0 - 50% S CH2Cl2 60% S 40% TFA N H 4.31 AllocHN NHBoc CH2Cl2 95% AllocHN N H 4.32 NH2 O O CH2Cl2 90% Cl O AllocHN S N H 4.33 O Cl NHFmoc EDCI, DMF NH2 O O Cl H N H N NHAlloc 1) Fmoc Deprotection NHFmoc Bis-guanidine 2) 4.33, EDCl, DMF Scheme 4.6: Alternative synthetic scheme for the modified target. This strategy makes use of the alloc protecting group. However, the synthesis of alloc- isothiocyanate (4.30) is not very dependable and thus the synthesis was halted. 4.6 SUMMARIES AND FUTURE OUTLOOK Proteins are some of the common ligands for nucleic acids. Thus, it is very important to study the interactions between nucleotides and amino acids. In an attempt to synthesize a peptide ligand that has high affinity for nucleic acids, we have developed a new and efficient methodology to synthesize secondary guanidines. The automated in vitro selection against the synthetic peptide 4.1 did not yield any aptamers. Maybe a manual selection against this target under optimized buffer conditions might produce 4.34 184 some aptamers. Our attempts to synthesize the target with two guanidiniums that are linked in parallel (4.29) haven't succeeded. 4.7 MATERIALS AND METHODS The chemicals were purchased from Aldrich, except for the Fmoc-chloride, resin, and all the amino acids. Fmoc-chloride was purchased from BACHEM and the amino acids and resin (1.19 mmol/g loading) were purchased from Nova Biochem. The products were placed under high vacuum for at least 12 hours prior to spectral analysis. 1 H NMR and 13C NMR were obtained on a varian Unity Plus 300 MHz spectrometer. A Finnigan VG analytical ZAB2-E spectrometer was used for the high resolution mass spectra. Ethoxy-N-{[benzylamino]thioxomethyl}carboxamide (4.7). Benzylamine (2.3g, 21.6mmol) was added to ethyl isothiocyanatoformate (1.8g, 13.7mmol) dissolved in 10mL of dichloromethane (DCM). A gas evolution was noticed and a yellow solid was formed immediately. The product was purified through flash chromatography (silica gel; eluant, dichloromethane/hexanes (2:3)) to give a 98% yield. 1H NMR (300 MHz, CDCl3) 9.86 (br, 1H), 8.05 (br, 1H), 7.21 (m, 5H), 4.77 (br, 2H), 4.12 (q, J= 6.92 Hz, 2H), 1.19 (t, J= 7.17 Hz, 3H); 13C {H} NMR (125 MHz, CDCl3) 179.3, 152.7, 136.2, 128.7, 127.7, 127.6, 62.6, 49.3, 14.0; HRMS CI+ m/z calcd. 239.0854, obsd. 239.0846. General protocol for the synthesis of guanidiniums with ethyl carbamate protecting groups, through EDC coupling. The thiourea 4.7 (0.5g, 2.1 mmol) was dissolved in DCM and Et3N (3 mL, 41.5 mmol) and EDC (0.5 g, 2.6mmol) were added to it. At room 185 temperature, after 30 minutes, R-NH2 (2.1mmol) was added. The reaction was run for 38 hours. Ethyl [2E]-2-aza-3, 3-bis [benzylamino] prop-2-enoate (4.8A). 4.8A was prepared according to the procedure above using benzylamine (0.23g, 2.1mmol). The product (off-white solid) was isolated through flash chromatography (DCM/hexanes(2:3)) to give a 80% yield. 1H NMR (300 MHz, CDCl3) 7.19 (m, 10H), 4.41 (br, 4H), 4.10(q, J=7.17 Hz, 2H), 1.26 (t, J= 7.17 Hz, 3H); 13C {H} NMR (125 MHz, CDCl3) 164.1, 159.9, 136.9, 128.5, 127.3, 126.9, 60.4, 44.8, 14.4; HRMS CI+ m/z calcd. 342.1712, obsd. 342.1713. Ethyl [2Z]-3-{[(4-aminophenyl) methyl] amino}-2-aza-3- [benzylamino] prop-2enoate (4.8B). 4.8B was prepared according to the procedure above using 4(aminomenthyl)phenylamine (0.26g, 2.1mmol). The product (reddish oil) was isolated through flash chromatography (DCM/hexanes (2:1)) to give a 83% yield. 1H NMR (300 MHz, CDCl3) 7.28 (t, J= 7.68 Hz, 3H), 7.16 (m, 4H), 6.58 (d, J=8.19 Hz, 2H), 4.41 (br, 4H), 4.27 (br, 2H), 4.09 (q, J=7.17 Hz, 2H), 1.23 (t, J=7.17 Hz, 3H); 13C {H} NMR (125 MHz, CDCl3) 163.6, 159.2, 145.7, 137.2, 127.9, 127.7, 126.4, 114.3, 59.9, 44.1, 44.0, 13.9; HRMS CI+ m/z calcd. 327.1821, obsd. 327.1823. Ethyl (2Z)-2-aza-3- {[(4-nitrophenyl) methyl] amino}-3-[benzylamino] prop-2enoate (4.8C). 4.8C was prepared according to the procedure above using 4(nitrophenyl)methylamine (0.32g, 2.1mmol). The product (reddish oil) was isolated through flash chromatography (DCM/hexanes(1:1)) to give a 88% yield. 1H NMR (300 MHz, CDCl3) 7.98 (d, J=8.2 Hz, 2H), 7.22 (m, 7H), 4.52 (br, 2H), 4.38 (br, 2H), 4.01 (q, J=7.18 Hz, 2H), 1.19 (t, J= 6.92 Hz, 3H); 13C {H} NMR (125 MHz, CDCl3) 163.7, 186 159.6, 146.2, 128.2, 128.0, 127.1, 127.0, 126.4, 123.0, 60.4, 44.4, 43.4, 14.0; HRMS CI+ m/z calcd. 357.1563, obsd. 357.1574. Ethyl (2Z)-2-aza-3- {[{4-methoxyphenyl) methyl] amino}-3-[benzylamino] prop-2enoate (4.8D). 4.8D was prepared according to the procedure above using (4methoxyphenyl)methylamine (0.29g, 2.1mmol). The product (off-white oil) was isolated through flash chromatography (DCM/hexanes(2:3)) to give a 85% yield. 1H NMR (300 MHz, CDCl3) 7.15 (m, 8H), 6.78 (d, J=8.45 Hz, 1 H), 4.40 (br, 2H), 4.32 (br, 2H), 4.07 (q, J= 6.92 Hz, 2H), 3.74 (br, 3H), 1.25 (t, J=7.17 Hz, 3H); 13C {H} NMR (125 MHz, CDCl3) 160.3, 129.1, 128.9, 128.8, 127.9, 127.7, 127.5, 114.5, 61.0, 55.5, 45.4, 45.0, 14.9; HRMS CI+ m/z calcd. 342.1818, obsd. 342.1824. Ethyl (2Z)-2-aza-3-{[(2,4-dimethoxyphenyl)methyl]amino}-3-[benzylamino]prop-2enoate (4.8E). 4.8E was prepared according to the procedure above using (2,4dimethoxyphenyl)methylamine (0.35g, 2.1mmol). The product (yellowish oil) was isolated through flash chromatography (DCM/hexanes(2:3)) to give a 78% yield. 1H NMR (300 MHz, CDCl3) 7.24 (m, 8H), 4.43 (br, 2H), 4.41(br, 2H), 4.10 (q, J=6.9 Hz, 2H), 3.70 (br, 6H), 1.21 (t, J=7.16 Hz, 3H); 13C {H} NMR (125 MHz, CDCl3) 163.7, 160.0, 159.4, 129.8, 128.1, 128.0, 127.0, 126.9, 128.8, 126.7, 97.8, 59.4, 54.7, 44.6, 14.1; HRMS CI+ m/z calcd. 372.1923, obsd. 372.1926. Ethyl(2Z)-2-aza-3-{[(2-methylphenyl)methyl]amino-3-[benzylamino]prop-2-enoate (4.8F). 4.8F was prepared according to the procedure above using (2- methylphenyl)methylamine (0.25g, 2.1mmol). The product (off-white solid) was isolated through flash chromatography (DCM/hexanes (2:3)) to give a 80% yield. 1H NMR (300 MHz, CDCl3) 7.16 (m,9H) 4.41 (br,4H), 4.05 (q, J= 7.17Hz, 2H), 2.10 (br, 3H), 1.25 (t, 187 J= 4.35 Hz, 3H); 13C {H} NMR (125 MHz, CDCl3) 163.9, 159.7, 135.5, 130.0, 128.2, 128.1, 127.1, 127.0, 126.9, 126.7, 125.7, 60.2, 44.5, 42.3, 18.3, 14.1; HRMS CI+ m/z calcd. 326.1869, obsd. 326.1877. Ethyl (2Z)-2-aza-3-(phenylamino)-3-[benzylamino]prop-2-enoate(4.8G). 4.8G was prepared according to the procedure above using phenylamine (0.2g, 2.1mmol). The product (off-white solid) was isolated through flash chromatography (DCM/hexanes(2:3)) to give a 87% yield. 1H NMR (300 MHz, CDCl3) 7.27 (m, 10H), 4.58 (br, 2H), 4.16 (q, J=6.92 Hz, 2H), 1.3 (t, J=7.17, 3H), 13C {H} NMR (125 MHz, CDCl3) 137.6, 129.4, 128.6, 128.1, 128.0, 126.9, 126.8, 124.8, 114.5, 60.4, 44.3, 14.1; HRMS CI+ m/z calcd. 298.1556, obsd. 298.1562. Ethyl (2Z)-2-aza-3-[(methylethyl)amino]-3-[benzylamino]prop-2-enoate (4.8H). 4.8H was prepared according to the procedure above using prop-2-ylamine (0.12g, 2.1mmol). The product (off-white solid) was isolated through flash chromatography (DCM/hexanes(2:3)) to give a 85% yield. 1H NMR (300 MHz, CDCl3) 7.24 (m, 5H), 4.40(br, 2H), 4.04 (q, J=7.17 Hz, 2H), 1.21 (t, J= 7.17 Hz, 3H), 1.07 (br, 3H), 1.05 (br,3H); 13C {H} NMR (125 MHz, CDCl3) 163.3, 158.3, 127.7, 126.5, 126.4, 117.5, 59.6, 44.0, 41.7, 21.9, 13.7; HRMS CI+ m/z calcd. 264.1712, obsd. 264.172. Ethyl (2Z)-2-aza-3-[(tert-butyl)amino]-3-3[benzylamino]prop-2-enoate (4.8I). 4.8I was prepared according to the procedure above using 2-methylprop-2-ylamine (0.15g, 2.1mmol). The product (off-white solid) was isolated through flash chromatography (DCM/hexanes(2:3)) to give a 83% yield. 1H NMR (300 MHz, CDCl3) 7.25 (m, 5H), 4.42 (br, 2H), 4.04 (q, J=6.88 Hz, 2H), 1.27 (br, 9H), 1.22 (t, J=8.73Hz, 3H); 13C {H} 188 NMR (125 MHz, CDCl3) 163.5, 158.9, 128.1, 127.9, 126.9, 126.7, 126.5, 60.0, 44.5, 28.9, 14.1; HRMS CI+ m/z calcd. 278.1869, obsd. 278.1867. General protocol for the deprotection of the ethyl carbamate group: The protected guanidinium (0.42 mmol) and trimethyl slily bromide (0.32 g, 2.1 mmol) were dissolved in DMF and the solution was refluxed overnight. The DMF was rotory evaporated and the residue was resuspended into 2 M HCl and was washed with ether. The solution was then free based by adding NaOH and the guanidine was extracted with dichloromethane and was then rotary evaporated to give the product. N, N'-Dibenzyl-guanidine (4.9A). 4.9A was prepared according to the procedure above using 4.8A. 1H NMR (300 MHz, CDCl3) 7.30 (m, 13H), 4.31 (s, 4H); 13C {H} NMR (125 MHz, CDCl3) 158.6, 139.2, 128.4, 127.1, 127.0; HRMS CI+ m/z calcd. 240.1500, obsd. 278.1497. N-(4-Amino-benzyl)-N-benzyl-guanidine (4.9B). 4.9B was prepared according to the procedure above using 4.8B. 1H NMR (300 MHz, CDCl3) 7.1 (m, 5H), 6.8 (m, 2H), 6.2 (m, 2H), 3.9 (t, 4H), 2.1 (s, 2H); 13C {H} NMR (125 MHz, CDCl3) 162.3, 147.1, 144.3, 153.2, 128.2, 127.7, 126.8, 126.3, 115.2, 47.3; HRMS CI+ m/z calcd. 254.33, obsd. 254.17. N-Benzyl-N'-(4-nitro-benzyl)-guanidine (4.9C). 4.9C was prepared according to the procedure above using 4.8C. 1H NMR (300 MHz, CDCl3) 8.1 (m, 2H), 7.3 (m, 2H), 7.1 (m, 5H), 3.9 (t, 4 H), 2.3 (s, 2H); 13C {H} NMR (125 MHz, CDCl3) 162.1, 148.3, 146.2, 142.5, 129.3, 128.7, 128.1, 123.1, 47.2; HRMS CI+ m/z calcd. 284.31, obsd. 284.14. 189 N-Benzyl-N'-(4-methoxy-benzyl)-guanidine (4.9D). 4.9D was prepared according to the procedure above using 4.8D. 1H NMR (300 MHz, CDCl3) 7.1 (m, 5H), 6.9 (m, 2H), 6.6 (m, 2H), 3.9 (t, 4 H), 3.7 (s, 3H), 2.0 (s, 2H) 13C {H} NMR (125 MHz, CDCl3) 162.1, 160, 142.1, 138.7, 129, 18.6, 128.3, 113.1, 58.2, 58.3; HRMS CI+ m/z calcd. 269.34, obsd. 269.15. (3-Aminomethyl-benzyl)-carbamic acid tert-butyl ester (4.11). 4.11 was synthesized according to the literature procedure.81 chromatography (MeOH/DCM (1:3)). [3-(3-Benzoyl-thioureidomethyl)-benzyl]-carbamic acid tert-butyl ester (4.12). The product was purified by column Monoboc Xylene diamine (4.11) (5 g, 21.2 mmol) was dissolved in 50 ml of chloroform and benzoyl NCS was added to this mix. The reaction was instantaneous. After two hours the chloroform was rotary evaporated and the product was isolated through flash chromatography (DCM/ ethyl acetate (1:2)), for 5.2 g (62%) yield. 1H NMR (300 MHz, DMSO) 1.40 (m,9H) 2.0 (s, 1H) 4.22 (t, 2H) 4.25 (t, 2H) 7.0 (m, 9H) 8.0 (s, 2H); 13C {H} NMR (125 MHz, DMSO) 184.1, 169.7, 157.8, 143.2, 134.4, 132.5, 128.2, 127.3, 127.2, 71.2, 56.8, 51.2, 29.3; HRMS CI+ m/z calcd. 399.51, obsd. 399.18. 1-(3-Aminomethyl-benzyl)-3-benzoyl-thiourea (4.13). The thiourea (4.12) (5 g, 12.5 mmol) was dissolved in 25 ml of 50% trifluoro acetic acid in dichloromethane and was stirred for about two hours. Upon the rotary evaporation of the solvent, the product was free based using sodium carbonate solution (pH ~ 9, 50 ml), washed with ether and was extracted with chloroform to yield a thick oil (3.6 g, 95% yield). 1H NMR (300 MHz, CDCl3) 8.0 (s, 1H), 7.5 (m, 4H), 7.0 (m, 4H), 4.7 (t, 2H), 3.9 (t, 2H), 2.0 (s, 3H); 13C 190 {H} NMR (125 MHz, CDCl3) 184.2, 169.7, 141.2, 131.4, 133.2, 129.2, 128.5, 126.9, 126.5, 125.7, 125.1, 55.8, 48.1; HRMS CI+ m/z calcd. 299.39, obsd. 299.12. [3-(3-Benzoyl-thioureidomethyl)-benzyl]-carbamic acid 9H-fluoren-9-ylmethyl ester (4.14). To a solution of 4.13 (3 g, 10 mmol) in 50 mls of DMF and 3 mls of The solution was stirred for 3 triethylamine, was added fmoc-NCS (3.1 g, 12 mmol). hours and the DMF was rotary evaporated and the crude was recrystallized in ethanol to give (4.7 g, 90% yield) the product. 1H NMR (300 MHz, DMSO) 8.0 (s, 2H), 7.95 (m, 3H), 7.5 (m, 5H), 7.3 (m, 4H), 7.0 (m, 4H), 4.7 (t of t, 4H), 4.2 (t, 2H), 4.4 (s, 1H), 2.0 (s, 1H); 13C {H} NMR (125 MHz, DMSO) 184.2, 169.8, 157.8, 142.2, 138.7, 135, 134.1, 129.2, 128.7, 128.4, 127.2, 73.1, 57.4, 50.8, 38.2; HRMS CI+ m/z calcd. 521.63, obsd. 521.20. General procedures for solid phase synthesis: Normal wash sequence: DCM (1x1min), MeOH (1x1min), DCM (2x1min). Cleavage from the resin: The resins were shrunk in MeOH and dried under high vacuum for at least 4hrs prior to cleavage. They were cleaved with 5% TFA and 5% triisopropylsilane (TIS) in DCM for 2 hrs at room temperature. The cleavage solution was removed by filtration. The resin was washed with alternating DCM and MeOH and the filtrate was concentrated in vacuo. The synthetic peptide target (4.1). HRMS CI+ m/z calcd. 898.98, obsd. 298.42 Biotinylated synthetic peptide (4.22). CI+ m/z calcd. 1220.38, obsd. 1219.53. Fluorenyl methyloxycarbonyl isothiocyanate (4.24). Fluorenyloxycarbonyl chloride (4.23) (5 g, 19.33 mmol) was dissoled in 30 mL of anhydrous ethyl acetate. This solution was added dropwise to a suspension of dry powdered potassium thiocyanate (5.63g, 191 57.98 mmol) over one hour at 0 C. The solution was then allowed to warm to room temperature over several hours. The reaction was monitored by thin layer chromatography (dichloromethane/ hexanes 2:3) for the disappearance of Fmoc-chloride (3 days). The reaction mixture was then passed through a Celite pad to remove any residual salts, and the ethyl acetate was removed by rotary evaporation. The resulting solid was then redissolved in dichloromethane (10mL) and was passed through a Celite pad to remove any left over salts from previous filtration. The crude product was purified through flash chromatography (silica gel; dichloromethane/hexanes 1:2) to yield yellow oil after high-vac drying (4.11 g, 76 % yield) which, upon sitting at room temperature for one or two hours, solidified to give an off-white solid. 1H NMR (300 MHz, CDCl3) 7.85(d, J=7.5 Hz, 2H), 7.65 (d, J= 7.5 Hz, 2H), 7.55(t, J= 7.5Hz, 2H), 7.4 (t, J=7.5 Hz, 2H), 4.45(d, J=7.4Hz, 2H), 4.28 (t, J=7.4 Hz, 1H); 13C {H} NMR (125 MHz, CDCl3) 150.5, 147.4, 142.9, 141.4, 128.2, 127.4, 125.2, 120.3, 70.8, 46.4. IR 3054.0, 2985.8, 1966.8 (N=C=S stretch), 1746.1, 1449.3, 1264.6, 1085.7, 739.3; HRMS CI+ m/z calcd. 281.0511, obsd. 281.0501. (fluoren-9-ylmethoxy)-N-({[3-[{{(fluoren-9-ylmethoxy)carbonylamino] thioxomethyl} amino) propyl] propylamino}thioxomethyl)carboxamide (4.25). To a solution of 4.24 (4.4 g, 15.7mmol) in 250 mL DCM at 0 C was added propane-1, 3diamine (0.26g, 3.5 mmol). After 2 hours, the solvent was rotary evaporated and the solid was washed with ethanol followed by diethyl ether. The resulting off-white solid was dried under reduced pressure to give 16 in 90% product. 1H NMR (300 MHz, DMSO) 9.68 (br, 2H), 8.29 (br, 2H), 7.74 (d, J=7.4 Hz, 4H), 7.51 (d, J=7.46 Hz, 4H), 7.32 (t, J=7.45Hz, 4H), 7.28(t, J=6.4Hz, 4H), 4.44 (d, J=6.66 Hz, 4H), 4.2 (t, J=6.66 Hz, 192 1H), 3.70 (q, J=7.17 Hz, 4 H), 2.02 (p, 2H); 13C {H} NMR (125 MHz, DMSO) 179.5, 152.4, 142.8, 142.2, 128.9, 127.2, 124.8, 120.1, 68.2, 46.4, 42.7, 27.6. Carbon(isothiocyanatidic) acid, 2-propenyl ester (4.30). To a solution of potassium thiocyanate in water (50 ml), 104 micro l of quinoline and 57 mg of sodium acetate were added (To 162 parts of solvent, 2 parts of quinoline and 2.8 parts of sodium acetate is added). The solution was cooled down to 10 C. 10 mls of alloc chloride (94.2 mmol) was then added to this mixture dropwise over 10 minutes. It was allowed to warm to temperature after 2 hrs and after 5 hrs it was stopped. The two layers were separated by washing the mixture with dichloromethane. The dichloromethane was then rotary evaporated. Due to its low boiling point, often it was directly used for the next step. In order to purify, it was undergone fractional distillation, though it lowers the yield. (Yield 0-50 %). 1H NMR (300 MHz, CDCl3) 5.8 (d of t, 1H), 5.2 (d, 2H), 4.8 (d, 2H); 13C {H} NMR (125 MHz, CDCl3) 180.4, 161.3, 137.3, 115.1, 66.8; HRMS CI+ m/z calcd. 143.16, obsd. 143.09. Monoboc Alloc thiourea (4.31). 4.31, 4.32, and 4.33 were synthesized using the same procedure for the synthesis of 4.12, 4.13, and 4.14 respectively. They all give the same yield. The yield of 4.31 is much lower when the 4.30 used is unpurified. 1H NMR (300 MHz, DMSO) 8.0 (s, 2H), 7.0 (m, 1H) 6.8 (m, 4H), 5.8 (t, 1H), 5.2 (d, 2H), 4.7 (d, 4H), 4.2 (d, 1H), 1.4 (s, 9H); 13C {H} NMR (125 MHz, DMSO) 183.2, 159.3, 157.8, 142.2, 137.5, 128.1, 125.3, 115.1, 70.6, 67.6, 55.8, 50.4, 28.7; HRMS CI+ m/z calcd. 379.47, obsd. 379.16. Deprotected thiourea (4.32). 1H NMR (300 MHz, CDCl3) 8.1 (s, 2H), 7.0 (m, 1H), 6.8 (m, 4H), 5.9 (dd, 1H), 5.2 (d, 2H), 4.7 (d, 2H), 3.9 (t, 2 H), 2.0 (s, 2H); 1H NMR (300 193 MHz, CDCl3) 183.1, 159.3, 142.2, 137.5, 125.1, 115.1, 67.6, 55.8, 48.1; HRMS CI+ m/z calcd. 279.36, obsd. 279.10. Fmoc protected thiourea (4.33). 1H NMR (300 MHz, DMSO) 8.0 (s, 2H), 7.8 (m, 2H), 7.5 (m, 2H), 7.3 (m, 4H), 7.0 (m, 4H), 5.8 (dd 1H), 5.2 (d, 2H), 4.7 (m, 5H), 4.4 (t, 1H), 4.2 (d, 2H); {H} NMR (125 MHz, DMSO) 183.4, 159.3, 142.2, 141.9, 137.5, 136.4, 128.1, 127.9, 126.5, 125.5, 115.1, 73.1, 67.6, 57.8, 55.8, 50.4, 37.9. HRMS CI+ m/z calcd. 501.60, obsd. 501.17. 4.8 REFERENCES 1. Buerger, C., Nagel-Wolfrum, K., Kunz, C., Wittig, I., Butz, K., Hoppe-Seyler, F., & Groner, B. (2003) Sequence-specific Peptide Aptamers, Interacting with the Intracellular Domain of the Epidermal Growth Factor Receptor, Interfere with Stat3 Activation and Inhibit the Growth of Tumor Cells. Journal of Biological Chemistry 278, 37610-37621. Bueger, C. & Groner, B. (2003) Bifunctional Recombinanat Proteins in Cancer Therapy: Cell Penetrating Peptide Aptamers as Inhibitors of Growth Factor Signaling. Journal of Cancer Research and Clinical Oncology 129, 669-675. Xu, C., W., & Luo, Z. (2002) Inactivation of Ras Function by Allele-Specific Peptide Aptamers. Oncogene 21, 5753-5757. Butz, K., Denk, C., Fitscher, B., Crnkovic-Mertens, I., Ullmann, A., Schroder, C. H., & Hoppe-Seyler, F. (2001) Oncogene 20, 6579-6586. Nauenburg, S., Zwerschke, W., & Jansen-Durr, P. (2001) Induction of Apoptosis in Cervical Carinoma Cells by Peptide Aptamers that Bind to the HPV-16 E7 Oncoprotein. EASEB Journal 15, 592-594. Crawfor, M., Woodman, R., & Ferrigno, P. K. (2003) Peptide Aptamers: Tools for Biology and Drug Discovery. Briefings in Functional Genomics & Proteomics 2, 72-79. Hoppe-Seyler, F. & Butz, K. (2000) Peptide Aptamers: Powerful New Tools for Molecular Medicine. Journal of Molecular Medicine 78, 426-430. Brody, E. N., & Gold, L. (2000) Aptamers as Therapeutic and Diagnostic Agents. Reviews in Molecular Biotechnology 74, 5-13. 194 2. 3. 4. 5. 6. 7. 8. 9. 10. Jayasena, S. D. (1999) Aptamers: An Emerging Class of Molecules that Rival Antibodies in Dignostics. Clinical Chemistry 45, 1628-1650. Arenz, C. & Schepers, U. (2003) RNA Interference: From an Ancient Mechanism to a State of the Art Therapeutic Application? Naturwissenschaften 90, 345-359. Walter, G., Bussow, K., Lueking, A., & Glokler, J. High- throroughput Protein Arrays: Prospects for Molecular Diagnostics. Trends in Molecular Medicine 8, 250-253. Finley, R. L. Jr., Soans, A. H., & Stanyon, C. A. (2002) Peptide Aptamers to Study Proteins and Protein Networks. Protein-Protein Interactions 489-505. Hoppe-seyler, F., Crnkovic-Mertens, I., Denk, C., Fischer, B. A., Klevenz, B., Tomai, E., & Butz, K. (2001) Peptide Aptamers: New Tools to Study Protein Interactions. Journal of Steroid Biochemistry and Molecular Biology 78, 105-111. Blum, J. H., Dove, S. L., Hochschild, A., & Mekalanos, J. J (2001) Isolation of Peptide Aptamers that Inhibit Intracellular Processes. Proceedings of the National Academy of Sciences of the United States of America 98, 3750-3755. Blum, J. H., Dove, S. L., Hochschild, A., & Mekalanos, J. J. (2000) Isolation of Peptide Aptamers that Inhibit Intracellular Processes. Proceedings of the National Academy of Sciences of the United States of America 97, 2241-2246. http://aant.icmb.utexas.edu http://gibk26.bse.kyutech.ac.jp/jouhou/jouhoubank.html http://www.ucsf.edu/frankel/nail/public_html/aboutlib.html Mori, A., Cohen, B.D., & Koide, H., Guanidines-Further Explorations of the Biological and Clinical Significance of Guanidino compounds. (1987) Plenum Press, N.Y. Burgess, K. & Chen, J. (2000) Solid- Phase Organic Synthesis, Burgess, K. Ed.; John Wiley & Sons; New York. Greenhill, J. V. & Lue, L. (1993) In Progress in Medicinal Chemistry, Ellis, G.P. & Luscombe, D.K. Eds. Elsevier Science; New York Vol. 30. Mori, A., Cohen, B. D., & Lowenthal, A. (1985) Guanidines- Historical, Biological, Biochemical, and Clinical Aspects of the Naturally Occurring Guanidino Compounds. Plenum Press, N.Y. 195 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. Hannon, C. L. & Anslyn, E. V. (1993) Bioorganic Chemistry Frontiers; SpringerVerlag: Berlin, Heidelberg Vol. 3, pp 193-255. Schneider, S.E., Bishop, P.A., Salazar, M. A., Bishop, O.A., & Anslyn, E.V. (1998) Solid Phase Synthesis of Oligomeric Guanidiniums. Tetrahedron, 54, 15063-15086. Schneider, S.E., O'Neil, S.N., & Anslyn, E.V. (2000) Journal of the American Chemical Society 122, 542-543. Rodriguez-Lopez, J. N., Lowe, D. J., Hernandez-Ruiz, J., Hiner, A. N. P., GarciaCanovas, F., & Thorneley, R. N. F. (2001) Mechanism of Reaction of Hydrogen Peroxide with Horseradish Peroxidase: Identification of Intermediates in the Catalytic Cycle. Journal of the American Chemical Society 123, 11838-11847. Mowat, C. G., Moysey, R., Miles, C. S., Leys, D., Doherty, M. K., Taylor, P., Walkinshaw, M. D., Reid, G. A., & Chapman, S. K. (2001) Kinetic and Crystallographic Analysis of the Key Active Site Acid/base Arginine in a Soluble Fumarate Reductase. Biochemistry 40, 12292-12298. Wang, P., McLeish, M. J., Kneen, M. M., Lee, G., & Kenyon, G. L. (2001) An unusually low pK(a) for Cys282 in the active site of human muscle creatine kinase. Biochemistry 40, 11698-11705. Bell, J. K., Yennawar, H. P., Wright, S. K., Thompson, J. R., R. Viola, E., & Banaszak, L. J. (2001) Structural analyses of a malate dehydrogenase with a variable active site.Journal of Biological Chemistry 276, 31156-31162. Haubner, R., Finsinger, D., & Kessler, H. (1997) Stereoisomeric peptide libraries and peptidomimetics for designing selective inhibitors of the integrin for a new cancer therapy. Angewandte Chemie International Edition in English 36, 13741389. Sulyok, G. A., Gibson, C., Goodman, S. L., Holzemann, Wiesner, G. M., Kessler, H. (2001) Solid-phase synthesis of a nonpeptide RGD mimetic library: new selective alphavbeta3 integrin antagonists. Journal of Medicinal Chemistry 44, 1938-1950. Jadhav, P. K., Woerner, F. J., Lam, P. Y. S., Hodge, C. N., Eyermann, C. J., Man, H., Daneker, W. F., Bacheler, L. T., Rayner, M. M., Meek, J. L., Viitanen, S. E., Jackson, D. A., Calabrese, J. C., Schadt, M., & Chang, C. (1998) Nonpeptide cyclic cyanoguanidines as HIV-1 protease inhibitors: synthesis, structure-activity relationships, and X-ray crystal structure studies. Journal of Medicinal Chemistry 41, 1446-1455. 196 24. 25. 26. 27. 28. 29. 30. 31. 32. Kim, C. U., Williams, M. A., Wu, H., Zhang, L, Chen, X., Escarpe, P. A., Mendel, D. B., Laver, W. G., & Stevens, R. J. (1998) Structure-activity relationship studies of novel carbocyclic influenza neuraminidase inhibitors. Journal of Medicinal Chemistry 41, 2451-2460. Short, J. H., Ours, C. W. & Ranus, Jr., W. J. (1968) Sympathetic nervous system blocking agents. V. Derivatives of isobutyl-, tert-butyl-, and neopentylguanidine. Journal of Medicinal Chemistry 11, 1129-1135. Satoh, T., Muramatu, M., Ooi, Y., Miyatake, H., Nakajima, T., & Umeyama, M. (1985) Medicinal chemical studies on synthetic protease inhibitors, trans-4guanidinomethylcyclohexanecarboxylic acid aryl esters. Chemical & Pharmaceutical Bulletin 33, 647-654. Miyamoto, Y., Hirose, H., Matsuda, H., Nakano, S., Ohtani, M., Kaneko, M., Sishigaki, K., Nomura, F., Kitamura, H., & Kawashima, Y.(1985) Trans. Am. Soc. Artif. Int. Organs 31, 508-511. Okamura, K., Kiyohara, Y., Komada, F., Iwakawa, S., Hiral, M., & Fuwa, T. (1990) Improvement in wound healing by epidermal growth factor (EGF) ointment. I. Effect of nafamostat, gabexate, or gelatin on stabilization and efficacy of EGF. Pharmaceutical Research 7, 1289-1293. Muramatsu, I., Oshita, M., & Yamanaka, K. (1983) Selective alpha-2 blocking action of DG-5128 in the dog mesenteric artery and rat vas deferens. Journal of Pharmacology and experimental therapeutics 227, 194-198. Umezawa, S., Takahashi, Y., Usui, T., & Tsuchiya, T. (1974) Synthesis of 4'deoxykanamycin and its resistance to kanamycin phosphotransferase II. Journal of Antibiotics 27, 997- 999. Greenhill, J. V. & Lue, P. (1993) in Progress in Medicianl Chemistry, Ellis, G. P. & Luscombe D. K. (Eds), Elsevier, New York. Marriner, S. (1986) Vet. Rec. 118, 181-184. Colpaert, F. C., Lenaerts, F. M., Niemegeers, C. J. E., & Janssen, P. A. (1975) A critical study on RO-4-1284 antagonism in mice. Archives Internationales de Pharmacodynamie et de therapie 215, 40-90. Freedlander, B. L. & French, F. A. (1958) Carcinostatic action of polycarbonyl compounds and their derivatives. II. Glyoxal bis(guanylhydrazone) and derivatives. Cancer Research 18, 360- 363. Horisberger, J.-D. & Giebish, G. (1987) Potassium-sparing diuretics. Renal physiology 10, 198- 200. 197 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. Maillard, M. C., Perlman, M. E., Amitay, O., Baxter, D., Berlove, D., Connaughton, S., Fischer, J. B., Guo, J. Q., Hu, L., McBurney, R. N., Nagy, P. I., Subbarao, K., Yost, E. A., Zhang, L., & Durant, G. J. (1998) Design, synthesis, and pharmacological evaluation of conformationally constrained analogues of N,N'-diaryl- and N-aryl-N-aralkylguanidines as potent inhibitors of neuronal Na+ channels. Journal of Medicinal Chemistry 41, 3048-3061. Ohizumi, Y., Sasaki, S., Kusumi, T., & Ohtani, I. I. (1996) Ptilomycalin A, a novel Na+, K(+)- or Ca2(+)-ATPase inhibitor, competitively interacts with ATP at its binding site. European Journal of Pharmacology 310, 95-98. Iwatsuki, K., Horiuchi, A., Yonekura, H., Ren, L. M., & Chiba, S. (1990) E-3123, a new synthetic protease inhibitor, protects against deoxycholic acid-induced acute pancreatitis in dogs. Archives Internationales de Pharmacodynamie et de Therapie 308, 168- 177. Linney, I. D., Buck, I. M., Harper, E. A., Kalindjin, S. B., Pether, M. J., Shankley, N. P., Watt, G. F., & Wright, P. T. (2000) Design, Synthesis, and StructureActivity Relationships of Novel Non-Imidazole Histamine H3 Receptor Antagonists. Journal of Medicinal Chemistry 43, 2362-2370. Robles, J., Grandas, A., & Pedroso, E. (2003) 4-Guanidino-2-pyrimidinone Nucleobases: Synthesis and Hybridization Properties. Nucleotides & Nucleic Acids 22, 5-8. Echavarren, A., Galan, A., Lehn, J.-M., & Mendoza, J. (1989) Chiral recognition of aromatic carboxylate anions by an optically active abiotic receptor containing a rigid guanidinium binding subunit. Journal of the American Chemical Society 111, 4994-4995. Kneeland, D. M., Ariga, K., Lynch, V. M., Huang, C., Anslyn, E. V. (1993) Bis(alkylguanidinium) receptors for phosphodiesters: effect of counterions, solvent mixtures, and cavity flexibility on complexation. Journal of American Chemical Society 115, 10042-10055. Metzger, A., Gloe, K., Stephen, H., & Schmidtchen, F. P. (1996) Molecular Recognition and Phase Transfer of Underivatized Amino Acids by a Foldable Artificial Host. Journal of Organic Chemistry 61, 2051-2055. Galan, A., Mendoza, J., Bruiz, C. M., Deslongchamps, G., & Rebek, J. (1991) A synthetic receptor for dinucleotides. Journal of the Americal Chemical Society 113, 9424-9425. 44. 45. 46. 47. 48. 49. 50. 51. 198 52. Chen, J., Pattarawarapan, M., Zhang, A. J., & Burgess, K. (2000) Solution- and Solid-Phase Syntheses of Substituted Guanidinocarboxylic Acids. Journal of Combinatorial Chemistry 2, 276- 281. Kowalski, J. A. & M. A. Lipton (1996) Solid phase synthesis of a diketopiperazine catalyst containing the unnatural amino acid (S)-norarginine. Tetrahedron Letters 37, 5839- 5840. Isobe, T., Fukuda, K., Tokunga, T., Seki, H., Yamaguchi, K., & Ishikawa, T. (2000) Journal of Organic Chemistry 65, 7774-7778. Nefzi, A., Dooley, C., Ostresh, J. M., & Houghten, R. A. (1998) Combinatorial chemistry: from peptides and peptidomimetics to small organic and heterocyclic compounds. Bioorganic Medicinal Chemistry Letters 8, 2273- 2278. Gordon, E. M., Gallop, M. A., & Patel, D. V. (1996) Strategy and Tactics in Combinatorial Organic Synthesis. Application to Drug Discovery. Accounts in Chemical Research 29, 144-154. Dodd, D. S. & Kozikowski, A. P. (1994) Conversion of Alcohols to Protected Guanidines Using the Mitsunobu Protocol. Tetrahedron Letters 35, 977- 980. Wang, F., & Hauske, J. R. (1997) An approach to enantiomerically pure inverse -turn mimetics for use in solid-phase synthesis. Tetrahedron Letters 38, 86518654. Gelbard, G., & Vielfaure-Joly, F. Polynitrogen Strong Bases : 1 - New Syntheses of Biguanides and their Catalytic Properties in Transesterification Reactions. Tetrahedron Letters 39, 2743-2746. Brase, S. & Dahmen, S. (2000) Solid-phase synthesis of urea and amide libraries using the T2 triazene linker. Organic Letters 2, 3563-3565. Smith, J., Liras, J. L., Schneider, S. E., & Anslyn, E. V. (1996) Solid and Solution Phase Organic Syntheses of Oligomeric Thioureas. Journal of Organic Chemistry 61, 8811- 8818. Booth, R. J. & Hodges, J. C. (1997) Polymer-Supoorted Quenching Reagents for Parallel Purification. Journal of the American Chemical Society 119, 4882-4886. Stadlwieser, J., Ellmerer-Muller, E. P., Tako, A., Maslouh, N., & Bannwarth, W. (1998) Combinatorial solid-phase synthesis of structurally complex thiazolylhydantoins. Angewandte Chemie International Edition 37, 1402-1404. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 199 64. 65. 66. 67. Kearney, P. C., Fernandez, M., & Flygare, J. A. (1998) Solid-Phase Synthesis of 2-Aminothiazoles. Journal of Organic Chemistry 63, 196-200. Robinson, S. & Roskamp, E. J. (1997) Solid Phase Synthesis of Guanidines. Tetrahedron 53, 6697- 6705. Levallet, C., Lerpiniere, J., & Ko, S. Y. (1997) The HgCl2-promoted guanylation reaction: the scope and limitations. Tetrahedron 53, 5291. Linkletter, B. A., Szabo, I. E., Bruice, T. C. (1999) Solid-phase synthesis of oligopurine deoxynucleic guanidine (DNG) and analysis of binding with DNA oligomers. Journal of American Chemical Society 121, 3888- 3896. Yong, Y. F., Kowalski, J. A., & Lipton, M. A. (1997) Facile and Efficient Guanylation of Amines Using Thioureas and Mukaiyama's Reagent. Journal of Organic Chemistry 62, 1540. Albert, J. S., Pecauh, M. W., & Hamilton, A. D. (1997) Design, synthesis and evaluation of synthetic receptors for the recognition of aspartate pairs in an alphahelical conformation. Bioorganic Medicinal Chemistry 5, 1455. Lammin, S. G., Pedgrift, B. L., & Ratcliffe, A. J. (1996) Conversion of anilines to bis-Boc protected N-methylguanidines. Tetrahedron Letters 37, 6815. Kilbrun, J. P., Lau, J., & Jones, R. C. F. (2002) A novel facile solid-phase strategy for the synthesis of N,N',N''-substituted guanidines. Tetrahedron 58, 1739-1743. Su, W. (1996) An efficient procedure for the guanylation of amines using N,N'bis(benzyloxycarbonyl)-S-methylisothiourea. Synthetic Communications, 26, 407. Koren, B., Stanovnik, B., & Tisler, M. (1987) Heterocycles. CXXXIII. Indazoles in organic synthesis. Formation of some fused heterocycles. Heterocycles, 26, 689. Wani, M. C., Campbell, H. F., Brine, G. A., Kepler, J. A., & Wall, M. E. (1972) Plant antitumor agents. IX. Total synthesis of dl-camptothecin. Journal of the American Chemical Society 94, 3631-3632. Lenz, G. R. (1988) Synthesis of 7-oxygenated aporphine alkaloids from a 1benzylideneisoquinoline enamide. Journal of Organic Chemistry 53, 4447. Sudarsanan, V., Nagarajan, K., & Gokhale, N. G. (1982) Nitroimidazoles: Part XVII. 5-Aminoimidazoles. Indian Journal of Chemistry Section B 21, 1087. 68. 69. 70. 71. 72. 73. 74. 75. 76. 200 77. 78. 79. Groziak, M.P. & Townsend, L. B. (1986) A new and efficient synthesis of guanosine. Journal of Organic Chemistry 51, 1277. Cox, J. C. & Ellington, A. D. (2001) Automated Selection of Anti-Protein Aptamers. Biorganic & Medicinal Chemistry 9, 2525-2531. Linton, B. R., Carr, A. J., Orner, B. P., & Hamilton, A.D. (2000) A Versatile OnePot Synthesis of 1,3-Substituted Guanidines from Carbamoyl Isothiocyanates. Journal of Organic Chemistry 65, 1566-1568. Kearney, P. C., Fernandez, M., & Flygare, J.A. (1998) Traceless Solid-Phase Synthesis of 2-Aminothiazoles. Journal of Organic Chemistry 63, 196-200. Callahan, J. F., Ashton-Shue, D., Bryan, H. G., Heckman, G. D., Kintler, L. B., McDonald, J. E., Moore. M. L., Schmidt, D. B., Silvestri, J. S., Stassen, F. L., Sulat, L., Yim, N. C. F., & Huffman, W. F. (1989) Journal of Medicinal Chemistry 32, 391-396. 80. 81. 201 Bibliography Ait-Haddou, H., Wiskur, S. L., Lynch, V. M. & Anslyn, E. V. (2001) Achieving Large Color Changes in Response to the Presence of Amino Acids: A Molecular Sensing Ensemble with Selectivity for Aspartate. Journal of the American Chemical Society 123, 11296-11297. Albert, J. S., Pecauh, M. W., & Hamilton, A. D. (1997) Design, synthesis and evaluation of synthetic receptors for the recognition of aspartate pairs in an alpha-helical conformation. Bioorganic Medicinal Chemistry 5, 1455. Arenz, C. & Schepers, U. (2003) RNA Interference: From an Ancient Mechanism to a State of the Art Therapeutic Application? Naturwissenschaften 90, 345-359. Arduini, A., Secchi, A., & Pochini, A. (2000) Recognition of Amides by New Rigid Calix[4]arene-Based Cavitands. Journal of Organic Chemistry 65, 9085-9091. Babendure, J. R., Adams, S. R., & Tsien, R. (2003) Aptamers Switch on Fluorescence of Triphenylmethane Dyes. Journal of the American Chemical Society 125, 1471614717. Besanger, T. R. & Brennan, J. D. (2003) Ion Sensing and Inhibition Studies Using the Transmembrane Ion Channel Peptide Gramicidin A Entrapped in Sol-Gel-Derived Silica. Analytical Chemistry 75, 1094-1101. Baker, T. J., Luedtke, N. W., Tor, Y., & Goodman, M. (2000) Synthesis and Anti-HIV Activity of Guanidino Glycoside. Journal of Organic Chemistry 65, 9054-9058. Ballistreri, F. P., Notti, A., Pappalardo, S., Paris, M. F., & Pisagatti, I. (2003) Multipoint Molecular Recognition of Amino Acids and Biogenic Amines by Ureidoxalix[5]arene Receptors. Organic Letters 5, 1071-1074. Banerjee, A. R., Jaeger, J. A., & Turner, D. H. (1993) Thermal unfolding of a group I ribozyme: the low-temperature transition is primarily disruption of tertiary structure. Biochemistry 32, 153-163. Bartel, D. P., Zapp, M. L., Green, M. R., & Szostak, J. W. (1991) HIV-1 Rev Regulation Involves Recognition of Non-Watson-Crick Base Pairs in Viral RNA. Cell 67, 529. Bartel, D. P. & Szostak, J. W. (1993) Isolation of New Ribozymes from a Large Pool of Random Sequences. Science 261, 1411-1418. 202 Battiste, J. L., Mao, H., Rao, N. S., Tan, R., Muhandiram, D. R., Kay, L. E., Frankel, A. D., & Williamson, J. R. (1996) Helix-RNA Major Groove Recognition in an HIV-1 Rev Peptide-RRE RNA Complex. Science 273, 1547. Battle, D. J. & Doudna, J. A. (2002). Specificity of RNA-RNA Helix Recognition. Proceedings of the National Academy of Sciences of the United States of America 99, 11676-11681. Bell, J. K., Yennawar, H. P., Wright, S. K., Thompson, J. R., R. Viola, E., & Banaszak, L. J. (2001) Structural analyses of a malate dehydrogenase with a variable active site.Journal of Biological Chemistry 276, 31156-31162. Berens, C., Thain, A. & Schroeder, R. (2001) A tetracycline-binding RNA aptamer. Bioorganic & Medicinal Chemistry 9, 2549-2556. Binkley, J., Allen, P., Brown, D. M., Green, L., Tuerk, C., & Gold, L. (1995) RNA Ligands to Human Nerve Growth Factor. Nucleic Acids Research 23, 3198-3205. Blackburn, E. H. (1998) "Telomerase RNA structure and function" in RNA structure and function. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 669-693. Blount, K. F. & Tor, Y. (2003) Using pyrene-labeled HIV-1 TAR to measure RNA-small molecule binding. Nucleic Acids Research 31, 5490-5500. Blum, J. H., Dove, S. L., Hochschild, A., & Mekalanos, J. J. (2000) Isolation of Peptide Aptamers that Inhibit Intracellular Processes. Proceedings of the National Academy of Sciences of the United States of America 97, 2241-2246. Blum, J. H., Dove, S. L., Hochschild, A., & Mekalanos, J. J (2001) Isolation of Peptide Aptamers that Inhibit Intracellular Processes. Proceedings of the National Academy of Sciences of the United States of America 98, 3750-3755. Borer, P. N., Lin, Y., Wang, S., Roggenbuck, M. W., Gott, J. M., Uhlenbeck, O. C., & Pelczer, I. (1995) Proton NMR and Structural Features of a 24-Nucleotide RNA Hairpin. Biochemistry 34, 6488. Borman, S. (2000) Catalytic DNA Used to Make Lead Biosensor. Chemical & Engineering News 78, 9-10. Blackwell, T. K. & Weintraub, H. (1990) Sequence-Specific DNA Binding by the c-Myc Protein. Science 250, 1104. 203 Bock, L. C., Griffin, C. C., Latham, J. A., Verrnass, E. H., & Toole, J. J. (1992) Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature 355, 564-568. Booth, R. J. & Hodges, J. C. (1997) Polymer-Supoorted Quenching Reagents for Parallel Purification. Journal of the American Chemical Society 119, 4882-4886. Botto, R. E. & Coxon, B. (1983) Nitrogen-15 Nuclear Magnetic Resonance Spectroscopy of Neomycin B and Related Aminoglycosides. Journal of the American Chemical Society 105, 1021-1028. Brase, S. & Dahmen, S. (2000) Solid-phase synthesis of urea and amide libraries using the T2 triazene linker. Organic Letters 2, 3563-3565. Brody, E. N. & Gold, L. (2000) Aptamers as Therapeutic and Diagnostic Agents. Reviews in Molecular Biotechnology 74, 5-13. Bruice, T. C. & Lightstone, F. C. (1999) Ground state and transition state contributions to the rates of intramolecular and enzymatic reactions. Accounts in Chemical Research 32, 127-136. Bueger, C. & Groner, B. (2003) Bifunctional Recombinanat Proteins in Cancer Therapy: Cell Penetrating Peptide Aptamers as Inhibitors of Growth Factor Signaling. Journal of Cancer Research and Clinical Oncology 129, 669-675. Buerger, C., Nagel-Wolfrum, K., Kunz, C., Wittig, I., Butz, K., Hoppe-Seyler, F., & Groner, B. (2003) Sequence-specific Peptide Aptamers, Interacting with the Intracellular Domain of the Epidermal Growth Factor Receptor, Interfere with Stat3 Activation and Inhibit the Growth of Tumor Cells. Journal of Biological Chemistry 278, 37610-37621. Burgstaller, P. & Famulok, M. (1994) Isolation of RNA Aptamers for Biological Cofactors by In Vitro Selection. Angewandte Chemie International Edition in English 33, 1084. Burgess, K. & Chen, J. (2000) Solid- Phase Organic Synthesis, Burgess, K. Ed.; John Wiley & Sons; New York. Burke, D. H., Hoffman, D. C., Brown, A., Hansen, M., Pardi, A., & Gold, L. (1997) RNA Aptamers to the Peptidyl Transferase Inhibitor Chloramphenicol. Chemistry & Biology 4, 833. Butz, K., Denk, C., Fitscher, B., Crnkovic-Mertens, I., Ullmann, A., Schroder, C. H., & Hoppe-Seyler, F. (2001) Oncogene 20, 6579-6586. 204 Callahan, J. F., Ashton-Shue, D., Bryan, H. G., Heckman, G. D., Kintler, L. B., McDonald, J. E., Moore. M. L., Schmidt, D. B., Silvestri, J. S., Stassen, F. L., Sulat, L., Yim, N. C. F., & Huffman, W. F. (1989) Journal of Medicinal Chemistry 32, 391-396. Cate, J. H., Yuspov, M. M., Yuspova, G. Z., Earnest, T. N., & Noller, H. F. (1999) X-ray Crystal Structures of 70S Ribosome Functional Complexes. Science 285, 20952104. Cech, T. R. (2000) Structural Biology. The Ribosome is a Ribozyme. Science 289, 878879. Cech, T. R. & Golden, B. L. (1999) "Building a catalytic active site using only RNA" in The RNA World, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 321349. Cerchia, L., Hamm, J., Libri, D., Tavitian, B., & Fransciscis, V. D. (2002) Nucleic acid aptamers in cancer medicine. FEBS Letters 528, 12-16. Chaloin, L., Lehmann, M. J., Sczakiel, G., & Restle, T. (2002) Endogenous expression of a high-affinity pseudoknot RNA aptamer suppresses replication of HIV-1. Nucleic Acids Research 30, 4001-4008. Charlton, J., Kirschenheuter, G. P., & Smith, D. (1997) Highly Potent Irreversible Inhibitors of Neutrophil Elastase Generated by Selection from a Randomized DNA-Valine Phosphonate Library. Biochemistry 36, 3018-3026. Chen, C.-H. B., Chernis, G. A., Hoang, V. Q. & Landgraf, R. (2003) Inhibition of heregulin signaling by an aptamer that preferentially binds to the oligomeric form of human epidermal growth factor receptor-3. Proceedings of the National Academy of Sciences of the United States of America 100, 9226-9231. Chen, J., Pattarawarapan, M., Zhang, A. J., & Burgess, K. (2000) Solution- and SolidPhase Syntheses of Substituted Guanidinocarboxylic Acids. Journal of Combinatorial Chemistry 2, 276- 281. Cheong, C., Varani, G., & Tinoco, I., Jr. (1990) Solution structure of an unusually stable RNA hairpin, 5GGAC(UUCG)GUCC. Nature 346, 680. Chia, J. S., Wu, H. I., Wang, H. W., Chen, D. S., & Chen, P. J. (1997) Journal of Biomedical Science 4, 208-216. Chow, C. S. & Bogdan, F. M. (1997) A Structural Basis for RNA-Ligand Interactions. Chemical Reviews 97, 1489-1513. 205 Chun, S. M., Jung, S. J., Park, H. G., & Yoo, J. H. (2001) RNA Sequence Having Binding Specificity to Kanamycin A. Korean Kongkae Taeho Kongbo Ciesiolka, J., Gorski, J., & Yarus, M. (1995) Selection of an RNA domain that binds Zn2+. RNA 1, 538-550. Ciesiolka, J., Lorenz, S., & Erdmann, V. A. (1992) Different conformational forms of Escherichia coli and rat liver 5S rRNA revealed by Pb(II)- induced hydrolysis. European Journal of Biochemistry. 204, 583-589. Clemons, W. C. J., May, J. L. C., Wimberly, B. T., McCutcheon, J. P., Capel, M. S., & Ramakrishnan, V. (1999) Structure of a Bacterial 30S Ribosomal Subunit at 5.5A Resolution. Nature 400, 833-840. Clouet-d'Orval, B., Stage, T. K., & Uhlenbeck, O. C. (1995) Neomycin Inhibition of the Hammerhead Ribozyme Involves Ionic Interactions. Biochemistry 34, 1118611190. Colpaert, F. C., Lenaerts, F. M., Niemegeers, C. J. E., & Janssen, P. A. (1975) A critical study on RO-4-1284 antagonism in mice. Archives Internationales de Pharmacodynamie et de therapie 215, 40-90. Conn, M. M., Prudent, J. R., & Schultz, P. G. (1996) Porphyrin Metalation Catalyzed by a Small RNA Molecule. Journal of the American Chemical Society 118, 70127013. Convery, M. A., Rowsell S., Stonehouse, N. J., Ellington, A. D., Hirao, I., Murray, J. B., Peabody, D. S., Phillips, S. E., & Stockley P. G. (1998) Crystal Structure of an RNA Aptamer-Protein Complex at 2.8 A Resolution. Nature Structure Biology 5, 133-139. Correll, C. C. & Swinger, K. (2003). Common and Distinctive Features of GNRA Tetraloops Based on a GUAA Tetraloop Structure at 1.4 Resolution. RNA 9, 355-363. Cox, J. C. & Ellington, A. D. (2001) Automated selection of anti-Protein aptamers. Bioorganic & Medicinal Chemistry 9, 2528-2531. Cox, J. C., Hayhurst, A., Hasselberth, J., Bayer, T. S., Georgiou, G., & Ellington, A. D. (2002) Automated selection of aptamers against protein targets translated in vitro: from gene to aptamer. Nucleic Acids Research 30, e108. Crameri, A., Stemmer, W. P. C. (1993) 10(20)-fold aptamer library amplification without gel purification. Nucleic Acids Research 21, 4410. 206 Crawfor, M., Woodman, R., & Ferrigno, P. K. (2003) Peptide Aptamers: Tools for Biology and Drug Discovery. Briefings in Functional Genomics & Proteomics 2, 72-79. Conrad, R. C., Giver, L., Tian, Y., & Ellington, A. D. (1996) In Vitro Selection of Nucleic Acid Aptamers that Bind Proteins. Methods in Enzymology 267, 336-367. Dahlberg, A. D., Horodyski, F., & Keller, P. (1978) Interaction of Neomycin with Ribosomes and Ribosomal Ribonucleic Acid. Antimirobial Agents and Chemotherapy 13, 331-339. Darfeuille, F., Arzumanov, A., Gait, M. J., Primo, C. D., & Toulme, J.-J. (2002) 2'-OMethyl-RNA Hairpins Generate Loop-Loop Complexes and Selectively Inhibit HIV-1 Tat-Mediated Transcription. Biochemistry 41, 12186-12192. Davies, J. (1994) Inactivation of Antibiotics and the Dissemination of Resistance Genes. Science 264, 375-382. Davies, J. & Davis, B. D. (1968) Misreading of Ribonucleic Acid Code Words Induced by Aminoglycoside Antibiotics. The Effect of Drug Concentration. Journal of Biological Chemistry 243, 3312-3316. Davies, J., Gorini, L., & Davis, B. D. (1965) Misreading of RNA Codewords Induced by Aminoglycoside Antibiotics. Molecular Pharmacology 1, 93-106. Davis, J. H. & Szostak, J. W. (2002) Isolation of High-affinity GTP Aptamers from Partially Structured RNA Libraries. Proceedings of the National Academy of Sciences of the United States of America 99, 11616-11621. Davis, K. A., Abrams, B., Lin, Y., & Jayasena, S. D. (1996) Use of a high affinity DNA ligand in flow cytometry. Nucleic Acids Research 24, 702-706. Davis, K. A., Abrams, B.; Lin, Y., & Jayasena, S. D. (1998) Staining of cell surface human CD4 with 2'-F-pyrimidine-containing RNA aptamers for flow cytometry. Nucleic Acids Research 26, 3915-3924. de Jong, M. R., Knegtel, R. M. A., Grootenhuis, P. D. J., Huskens, J., & Reinhoudt, D. N. (2002) A method to identify and screen libraries of guest that complex to a synthetic host. Angewandte Chemie International Edition in English 41, 10041008. Delaage, M. (1991) Molecular Recognition Mechanisms. VCH Publishers, Inc. New York. 207 Deng, Q., German, I., Buchanan, D., & Kennedy, R. (2001) Retention and Separation of Adenosine and Analogues by Affinity Chromatography with an Aptamer Stationary Phase. Analytical Chemistry 73, 5415-5421. Deng, Q., Watson, C. J., & Kennedy, R. T. (2003) Aptamer affinity chromatography for rapid assay of adenosine in microdialysis samples collected in vivo. Journal of Chromatography A 1005, 123-130. Dieckmann, T., Butcher, S. E., Sassanfar, M., Szostak, J. W., & Feigon, J. (1997) Mutant ATP-binding RNA aptamers reveal the structural basis for ligand binding. Journal of Molecular Biology 273, 467- 478. Dieckmann, T., Suzuki, E., Nakamura, G. K., & Feigon, J. (1996) Solution structure of an ATP-binding RNA aptamer reveals a novel fold. RNA 2, 628-640. Ding, Y., Hofstadler, S. A., Swayze, E. E., Risen, L., & Griffey, H. (2003) Design and Synthesis of Paromomycin-Related Heterocycle-Substituted Aminoglycoside Mimetics Based on a Mass Spectrometry RNA-Binding Assay. Angewandte Chemie International Edition in English 42, 3409-3412. Dodd, D. S. & Kozikowski, A. P. (1994) Conversion of Alcohols to Protected Guanidines Using the Mitsunobu Protocol. Tetrahedron Letters 35, 977- 980. Dorman, D. E., Paschal, J. W., & Merkel, K. E. (1976) Nitrogen-15 nuclear magnetic resonance spectroscopy. The nebramycin aminoglycosides. Journal of the American Chemical Society 98, 6885-6888. Earnshaw D. J. & Gait, M. J. (1998) Hairpin Ribozyme Cleavage Catalyzed by Aminoglycoside Antibiotics and the Polyamine Spermine in the Absence of Metal Ions. Nucleic Acids Research 26, 5551-5561. Echavarren, A., Galan, A., Lehn, J.-M., & Mendoza, J. (1989) Chiral recognition of aromatic carboxylate anions by an optically active abiotic receptor containing a rigid guanidinium binding subunit. Journal of the American Chemical Society 111, 4994-4995. Ekland, E. H. & Bartel, D. P. (1995) The secondary structure and sequence optimization of an RNA ligase ribozyme. Nucleic Acids Research 23, 3231-3238. Ellington, A. D. (1993) RNA Selection. Aptamers Achieve the Desired Recognition. Current Biology 3, 375-377. Ellington, A. D. & Green, R. in "Current Protocols in Molecular Biology" (1989) (F. M. Ausbel, Brent, R.; Kingston, R. E., Moore, D. D.; Seidman, J. G.; Smith, J. A.; Struhl, K. eds.), p. 2. Wiley, New York. 208 Ellington, A. D. & Szostak, J. W. (1992) Nature Selection in vitro of single-stranded DNA molecules that fold into specific ligand-binding structures. 355, 850-852. Ellington, A. D.; Szostak, J. W. In Vitro Selection of RNA Molecules that Bind Specific Ligands. Nature 346, 818-822. Eulberg, D. & Klussmann, S. (2003) Spiegelmers: Biostable Aptamers. ChemBiochem 4, 979-983. Fan, P., Suri, A. K., Fiala, R., Live, D., & Patel, D. J. (1996) Molecular Recognition in the FMN RNA Aptamer Complex. Journal of Molecular Biology 258, 480-500. Fang, X., Cao, Z., Beck, T., & Tan, W. (2001) Molecular Aptamer for Real-Time Oncoprotein Platelet-Derived Growth Factor Monitoring by Fluorescence Anisotropy. Analytical Chemistry 73, 5752-5757. Fang, X., Sen, A., Vicens, M., & Tan, W. (2003) Synthetic DNA Aptamers to Detect Protein Molecular Variants in a High-Throughput Fluorescence Quenching Assay. ChemBioChem 4, 829-834. Feig, A. L. & Uhlenbeck, O. C. (1999) "The role of metal ions in RNA biochemistry" in The RNA World, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1999, 287-319. Fields, B. N., Knipe, D. M., & Hwley, P. M. (EDS). (1996) Fundamental Virology, Lippincott- Raven, Philadelphia. Finger, L. D., Trantirek, L., Johansson, C., & Feigon, (2003) Solution Structures of StemLoop RNAs that Bind to the Two N-Terminal RNA-Binding Domains of Nucleonlin. Nucleic Acids Research 31, 6461-6472. Finley, R. L. Jr., Soans, A. H., & Stanyon, C. A. (2002) Peptide Aptamers to Study Proteins and Protein Networks. Protein-Protein Interactions 489-505. Fourmy, D., Recht, M. I., Blachard, S. C., & Puglisi, J. D. (1996) Structure of the A Site of Escherichia coli 16S Ribosomal RNA Complexed with an Aminoglycoside Antibiotic. Science 274, 1367-1371. Fourmy, D., Yoshizawa, S., & Puglisi, J. D. (1998) Paromomycin Binding Induces a Local Conformational Change in the A-site of 16 S rRNA. Journal of Molecular Biology 277, 333-345. 209 Fraser, H. & Rebek, J. (2002) Molecules within molecules: recognition through selfassembly. Proceedings of the National Academy of Sciences of the United States of America 99, 4775-4777. Freedlander, B. L. & French, F. A. (1958) Carcinostatic action of polycarbonyl compounds and their derivatives. II. Glyoxal bis(guanylhydrazone) and derivatives. Cancer Research 18, 360- 363. Gal, S. W., Amontov, S., Urvil, P. T., Vishnuvardhan, D., Nishikawa, F., Kumar, P. K., & Nishikawa, S. (1998) Selection of a RNA Aptamer that Binds to Human Activated Protein C and Inhibits its Protease Function. European Journal of Biochemistry 252, 553. Galan, A., Mendoza, J., Bruiz, C. M., Deslongchamps, G., & Rebek, J. (1991) A synthetic receptor for dinucleotides. Journal of the Americal Chemical Society 113, 9424-9425. Garrett & Grisham Biochemistry 2nd Ed. (1995) Saunders College Pub. Fort Worth. Gaspin, C., & Westhof, E. (1995) Modeling the Three-Dimensional Structure of RNA Using Discreete Nucleotide Conformational Sets. Journal of Molecular Biology 229, 1049-1064. Geiger, A., Burgstaller, P., von der Eltz, H., Roeder, A., & Famulok, M. (1996) RNA Aptamers That Bind L-arginine with Sub-Micromolar Dissociation Constants and High Enantioselectivity. Nucleic Acids Research 24, 1029. Gelbard, G., & Vielfaure-Joly, F. Polynitrogen Strong Bases : 1 - New Syntheses of Biguanides and their Catalytic Properties in Transesterification Reactions. Tetrahedron Letters 39, 2743-2746. German, I., Buchanan, D. D., & Kennedy, R. T. (1998) Aptamers as Ligands in Affinity Probe Capillary Electrophoresis. Analytical Chemistry 70, 4540-4545. Giver, L., Bartel, D., Zapp, M., Pawul, A., Green, M., & Ellington, A. D. (1993) Selective optimization of the Rev-binding element of HIV-1. Nucleic Acids Research 23, 5509-5516. Gold, L. (1995) Oligonucleotides as Research, Diagnostic, and Therapeutic Agents. Journal of Biological Chemistry 270, 13581-13584. Gold, L., Brown, D., He, Y. Y., Shtatland, T., Singer, B. S., & Wu, Y. (1997) From Oligonucleotide Shapes to Genomic SELEX: Novel Biological Regulatory Loops. Proceedings of the National Academy of Sciences of the United States of America 1997, 94, 59-64. 210 Gold, L., Polisky, B., Uhlenbeck, O., & Yarus, M. (1995) Diversity of Oligonucleotid Functions. Annual Review of Biochemistry 64, 763-797. Gold, L., Singer, B., He Y.-Y., & Brody, E. (1997) SELEX and the Evolution of Genomics Current Opinion in Genetics & Development 7, 848-851. Gordon, E. M., Gallop, M. A., & Patel, D. V. (1996) Strategy and Tactics in Combinatorial Organic Synthesis. Application to Drug Discovery. Accounts in Chemical Research 29, 144-154. Goshe, A. J., Steele, I. M., & Bosnich, B. (2003) Supramolecular Recognition. Terpyridyl Palladium and Platinum Molecular Clefts and Their Association with Planar Platinum Complexes. Journal of the American Chemical Society 125, 444-451. Grawe, T., Schrader, T., Zadmard, R., & Kraft, A. (2002) Self-Assembly of Ball-Shaped Molecular Complexes in Water. Journal of Organic Chemistry 67, 3755-3763. Gray, C. W. & Houston, T. A. (2002) Boronic Acid Receptors for .alpha.Hydroxycarboxylates: High Affinity of Shinkai's Glucose Receptor for Tartrate. Journal of Organic Chemistry 67, 5426-5428. Gray, Jr., C. W. & Houston, T. A. (2002) Boronic Acid Receptors for Hydroxycarboxylates: High Affinity of Shinkai's Glucose Receptor for Tartrate. Journal of Organic Chemistry 67, 5426-5428. Gray, N. K. & Wickens, M. (1998) Control of Translation Initiation in Animals. Annual Review of Cell and Developmental Biology 14, 399- 458. Greenhill, J. V. & Lue, L. (1993) In Progress in Medicinal Chemistry, Ellis, G.P. & Luscombe, D.K. Eds. Elsevier Science; New York Vol. 30. Green, L. S., Jellinek, D., Bell, C., Beebe, L. A., Feistner, B. D., Gill, S. C. Jucker, F. M., & Janjic, N. (1995) Nuclease-Resistant Nucleic Acid Ligands to Vascular Permeability Factor/Vascular Endothelial Growth Factor. Chemistry & Biology 2, 683- 695. Green, R. & Noller, H. F. (1997) Ribosome and Translation. Annual Reviews in Biochemistry 66, 679- 716. Groenen, L. C. & Reinhoudt, D. N. (1992) Calix[4]arenas, molecular platforms for supramolecular structures. In Supramolecular Chemistry by Balzani, V. & De Cola, L. Kluwer Academic Publishers, Boston. 211 Groziak, M.P. & Townsend, L. B. (1986) A new and efficient synthesis of guanosine. Journal of Organic Chemistry 51, 1277. Ha, T. (2001) Single-molecule fluorescence methods for the study of nucleic acids. Current Opinion in Structural Biology 11, 287-292. Hamaguch, N., Ellington, A. & Stanton, M. (2001) Aptamer Beacons for the Direct Detection of Proteins. Analytical Biochemistry 294, 126-131. Hamilton, A. D. (1992) New Synthetic Receptors for Complexation and Catalysis. In Supramolecular Chemistry by Balzani, V. & De Cola, L. Kluwer Academic Publishers, Boston. Han, K. & Byun, Y. (2003) PseudoViewer2: Visualization of RNA Pseudoknots of any Type. Nucleic Acids Research 31, 3432-3440. Hanna, M. & Szostak, J. W. (1994) Suppression of mutations in the core of the Tetrahymena ribozyme by spermidine, ethanol and by substrate stabilization. Nucleic Acids Research 22, 5326-5331. Hannon, C. L. & Anslyn, E. V. (1993) Bioorganic Chemistry Frontiers; Springer-Verlag: Berlin, Heidelberg Vol. 3, pp 193-255. Harada, K.; Frankel, A. D. (1995) Identification of Two Novel Arginine Binding DNAs. EMBO Journal 14, 5798-5811. Hart, B. R. & Shea, K. J. (2001) Synthetic Peptide Receptors: Molecularly Imprinted Polymers for the Recognition of Peptides Using Peptide- Metal Interactions. Journal of the American Chemical Society 123, 2072-2073. Hartford, J. B. & Rouault, T. A. (1998) "RNA structure and function in cellular iron homeostasis" in RNA Structure and Function, Cold Spring Harbor Laboratory Press, Cold Springs Harbor, 575-602. Haubner, R., Finsinger, D., & Kessler, H. (1997) Stereoisomeric peptide libraries and peptidomimetics for designing selective inhibitors of the integrin for a new cancer therapy. Angewandte Chemie International Edition in English 36, 1374-1389. Heegaard, N. H. H. (2001) In Protein- Ligand interactions: hydrodynamics and calorimetry Harding, S. E. Chowdhry, B. Z. Eds., Oxford University Press: Oxford, New York pp 171-195. Hendrix, M., Alper, P. B., Priestley, E. S., & Wong, C.-H. (1997) Hydroxyamines as a New Motif for the Molecular Recognition of Phosphodiester: Implications for 212 Aminoglycoside-RNA Interactions. Angewandte Chemie International Edition in English 36, 95-98. Hendrix, M., Priestley, E. S., Joyce, G. F., & Wong, C.-H. (1997) Direct Observation of Aminoglycoside-RNA Interactions by Surface Plasmon Resonance. Journal of the American Chemical Society 119, 3641-3648. Hentze, M. W. & Kuhn, L. C. (1996) Molecular Control of Vertebrate Iron Metabolism: mRNA-based Regulatory Circuits Operated by Iron, Nitric Oxide, and Oxidative Stress. Proceedings of the National Academy of Sciences of the United States of America 93, 8175-8182. Hermann, T. & Patel, D. J. (2000) Adaptive Recognition by Nucleic Acid Aptamers. Science 287, 820-825. Hermann, T. & Westhof, E. (1998) Aminoglycoside binding to the hammerhead ribozyme: a general model for the interaction of cationic antibiotics with RNA. Journal of Molecular Biology 276, 903-912. Hermann, T., & Westhof, E. (1999) Non-Watson-Crick Base Pairs in RNA-Protein Recognition. Chemistry & Biology 6, R335. Herman, T. & Westhof, E. (1998) Saccharide-RNA Recognition. Biopolymers 48, 155. Heus, H. A. & Pardi, A. (1991)Structural Features That Give Rise to the Unusual Stability of RNA Hairpins Containing GNRA Loops. Science 253, 191. Hicke, B. J. & Stephens, A. W. (2000) Escort aptamers: a delivery service for diagnosis and therapy. Journal of Clinical Investigation 106, 923-928. Hicke, B. J., Watson, S. R., Koenig, A., Lynott, C. K., Bargatze, R. F., et al. (1996) DNA Aptamers Block L-Selectin Function In Vivo . Inhibition of Human Lymphocyte Trafficking in SCID Mice. Journal of Clinical Investigation 98, 2688-2692. Hoch, I., Berens, C., Westhof, E., & Schroeder, R. (1998) Antibiotic Inhibition of RNA Catalysis: Neomycin B binds to the Catalytic Core of the td Group I Intron Displacing Essential Metal Ions. Journal of Molecular Biology 282, 557-569. Holmes, D. J. & Cundiffe, E. (1991) Analysis of a Ribosomal RNA Methylase Gene from Streptomyces Tenebrarius Which Confers Resistance to Gentamycin. Molecular and General Genetics 229-237. Holmes, D. J., Drocourt, D., Tiraby, G., & Cundliffe, E. (1991) Cloning of an Aminoglycoside-Resistance-Encoding Gene, kamC, from Saccharopolyspora 213 hirsute: Comparison with kamB from Streptomyces Tenebrarius. Gene 102, 1926. Hoppe-Seyler, F. & Butz, K. (2000) Peptide Aptamers: Powerful New Tools for Molecular Medicine. Journal of Molecular Medicine 78, 426-430. Brody, E. N., & Gold, L. (2000) Aptamers as Therapeutic and Diagnostic Agents. Reviews in Molecular Biotechnology 74, 5-13. Hoppe-seyler, F., Crnkovic-Mertens, I., Denk, C., Fischer, B. A., Klevenz, B., Tomai, E., & Butz, K. (2001) Peptide Aptamers: New Tools to Study Protein Interactions. Journal of Steroid Biochemistry and Molecular Biology 78, 105-111. Horisberger, J.-D. & Giebish, G. (1987) Potassium-sparing diuretics. Renal physiology 10, 198- 200. http://aant.icmb.utexas.edu http://biotools.idtdna.com/mfold/mfold.asp http://gibk26.bse.kyutech.ac.jp/jouhou/jouhoubank.html http://scor.lbl.gov/help/RZResLocationHelp.html http://www.mskcc.org/mskcc/html/11778.cfm http://www.pti-nj.com/fluorescence_2.html. http://www.sciencemag.org/feature/data/pharmacia/1998/Cate.shl http://www.turnerdesigns.com/t2/doc/appnotes/998_0050/0050_c1.html. http://www.ucsf.edu/frankel/nail/public_html/aboutlib.html Huang, Z. & Szostak, J. W. (2003) Evolution of aptamers with a new specificity and new secondary structures from an ATP aptamer. RNA 9, 1456-1463. Huizenga, D. E. & Szostak, J. W. (1995) A DNA Aptamer That Binds Adenosine and ATP. Biochemistry 34, 656-665. Humphries, J. E. & Yoshino, T. P. (2003) Cellular receptors and signal transduction in molluscan hemocytes: connections with the innate immune system of vertebrates. Integrative and Comparative Biology, 43, 305-312. Huynen, M. A. (1996) Exploring Phenotype Space through Neutral Evolution. Journal of Molecular Evolution 43, 165-169. 214 Huynen, M. A., Stadler, P. F., & Fontana, W. (1996) Smoothness Within Ruggedness: The Role of Neutrality in Adaptation. Proceedings of the National Academy of Sciences of the United States of America 93, 397-401. International Human Genome Sequencing Consortium. (2001) Initial sequencing and analysis of the human genome. Nature 409, 860- 921. Irvine, D., Tuerk, C., & Gold, L. (1991) SELEXION. Systematic Evolution of Ligands by Exponential Enrichment with Integrated Optimization by Non-linear Analysis. Journal of Molecular Biology 222, 739-761. Isobe, T., Fukuda, K., Tokunga, T., Seki, H., Yamaguchi, K., & Ishikawa, T. (2000) Journal of Organic Chemistry 65, 7774-7778. Ito, Y., Suzuki, A., Kawazoe, N., & Imanishi, Y. (2001) In Vitro Selection of RNA Aptamers Carrying Multiple Biotin Groups in the Side Chains. Bioconjuate Chemistry 12, 850-854. Iwatsuki, K., Horiuchi, A., Yonekura, H., Ren, L. M., & Chiba, S. (1990) E-3123, a new synthetic protease inhibitor, protects against deoxycholic acid-induced acute pancreatitis in dogs. Archives Internationales de Pharmacodynamie et de Therapie 308, 168- 177. Jadhav, P. K., Woerner, F. J., Lam, P. Y. S., Hodge, C. N., Eyermann, C. J., Man, H., Daneker, W. F., Bacheler, L. T., Rayner, M. M., Meek, J. L., Viitanen, S. E., Jackson, D. A., Calabrese, J. C., Schadt, M., & Chang, C. (1998) Nonpeptide cyclic cyanoguanidines as HIV-1 protease inhibitors: synthesis, structure-activity relationships, and X-ray crystal structure studies. Journal of Medicinal Chemistry 41, 1446-1455. Jayasena, S. D. (1999) Aptamers: An Emerging Class of Molecules that Rival Antibodies in Diagnostics. Clinical Chemistry 45, 1628-1650. Jellineck, D., Green, L. S., Bell, C., Lynott, C. K., Gill, N., Vargeese, C.; Kirschenheuter, G., McGee, D. P. C., Abesinghe, P., Pieken, W. A., Shapiro, R., Rifkin, D. B., Moscatelli, D., & Janjic, N. (1995) Potent 2'-Amino-2'-deoxypyrimidine RNA Inhibitors of Basic Fibroblast Growth Factor. Biochemistry 34, 11363-11372. Jenison, R. D., Gill, S. C., Pardi, A., & Polisky, B. (1994) High-resolution molecular discrimination by RNA. Science 263, 1425. Jhaveri, S., Olwin, B., & Ellington, A. D. (1998) In vitro selection of phosphorrothiolated aptamers. Bioorganic & Medicinal Chemistry Letters 8, 2285-2290. 215 Jhaveri, S., Rajendran, M., & Ellington, A. D. (2000) In vitro selection of signaling aptamers. Nature Biotechnology 18, 1293-1297. Jiang, F., Gorin, A., Hu, W., Maumdar, A., Baskerville, S., Xu, W., Ellington, A. D., & Patel, D. J. (1999) Anchoring an Extended HTLV-1 Rex Peptide Within an RNA Major Groove Containing Junctional Base Triples. Structure 7, 1461-1472. Jiang, F., Kumar, R. A., Jones, R. A., & Patel, D. J. (1996) Structural basis of RNA folding and recognition in an AMP RNA aptamer complex. Nature 382, 183186. Jiang, L. (1999) Structure 7, 817. Jiang, L., Majumdar, A., Hu, W., Jaishree, T. J., Xu, W., & Patel, D. J. (1999) Saccharide-RNA Recognition in a Complex Formed Between Neomycin B and an RNA Aptamer. Structure with Folding & Design 1999, 7, 817-827. Jiang, L. & Patel, D. J. (1998) Solution Structure of the Tobramycin-RNA aptamer Complex. Nature Structure Biology 5, 769-774. Jiang, L. & Patel, D. J. (1998) Nature Strucural Biology 276, 903. Jiang, L., Suri, A. K., Fiala, R., & Patel, D. J. (1997) Saccharide-RNA Recognition in an Aminoglycoside Antibiotic-RNA Aptamer Complex. Chemistry & Biology 4, 3550. Jiang, L., Suri, A. K., Fiala, R., & Patel, D. J. (1998) Saccharide-RNA Recognition in an Aminoglycoside Antibiotic-RNA Aptamer Complex. Nature Stucture Biology 5, 769. Keene, J. D. (1996) RNA Surfaces as Functional Mimetics of Proteins. Chemistry & Biology 3, 505-513. Karimi, R. & Ehrenberg, M. (1994) Dissociation Rate of Cognate Peptidyl-tRNA from the A-site of Hyper-accurate and Error-prone Ribosomes. European Journal of Biochemistry 226, 355-360. Kearney, P. C., Fernandez, M., & Flygare, J. A. (1998) Solid-Phase Synthesis of 2Aminothiazoles. Journal of Organic Chemistry 63, 196-200. Kilbrun, J. P., Lau, J., & Jones, R. C. F. (2002) A novel facile solid-phase strategy for the synthesis of N,N',N''-substituted guanidines. Tetrahedron 58, 1739-1743. Kim, C. U., Williams, M. A., Wu, H., Zhang, L, Chen, X., Escarpe, P. A., Mendel, D. B., Laver, W. G., & Stevens, R. J. (1998) Structure-activity relationship studies of 216 novel carbocyclic influenza neuraminidase inhibitors. Journal of Medicinal Chemistry 41, 2451-2460. Kim, Y.-G., Su, L., Maas, S., O'Neill, A., & Rich, A. (1999) Specific Mutations in a Viral RNA Pseudoknot Drastically Change Ribosomal Frameshifting Efficiency, Proceedings of the National Academy of Sciences of the United States of America 96, 14234-14239. Kleinjung, F., Klussmann, S., Erdmann, V. A., Scheller, F. W., Furste, J. P., & Bier, F. F. (1998) High-Affinity RNA as a Recognition Element in a Biosensor. Analytical Chemistry 70, 328-331. Klussmann, S., Nolte, A., Bald, R., Erdmann, V. A., & Furste, J. P. (1996) Mirror-Image RNA that Binds D-Adenosine. Nature Biotechnology 14, 1112-1115. Kneeland, D. M., Ariga, K., Lynch, V. M., Huang, C., Anslyn, E. V. (1993) Bis(alkylguanidinium) receptors for phosphodiesters: effect of counterions, solvent mixtures, and cavity flexibility on complexation. Journal of American Chemical Society 115, 10042-10055. Koren, B., Stanovnik, B., & Tisler, M. (1987) Heterocycles. CXXXIII. Indazoles in organic synthesis. Formation of some fused heterocycles. Heterocycles, 26, 689. Kornberg, A., & Baker, T. (1992) DNA Replication. New York, W. H. Freeman. Kotia, R. B., Li, L., & McGown, L. B. (2000) Separation of Nontarget Compounds by DNA Aptamers. Analytical Chemistry 72, 827-831. Kowalski, J. A. & M. A. Lipton (1996) Solid phase synthesis of a diketopiperazine catalyst containing the unnatural amino acid (S)-norarginine. Tetrahedron Letters 37, 5839- 5840. Kubik, M. F., Bell, C., Fitzwater, T., Watson, S. R., & Tasset, D. M. (1997) Isolation and characterization of 2'-fluoro-, 2'-amino-, and 2'-fluoro- /amino-modified RNA ligands to human IFN-gamma that inhibit receptor binding. Journal of Immunology 159, 259-267. Kuimmelis, R. G. & McLaughlin, L. W. (1998) Mechanisms of ribozyme- mediated RNA cleavage. Chemical Reviews 98, 192-212. Kumar, P. K., Machida, K., Urvil, P. T., Kakiuchi, N., Vishnuvardhan, D., Shimotohno, K., Taira, K., & Nishikawa, S. (1997) Isolation of RNA Aptamers Specific to the NS3 Protein of Hepatitis C Virus from a Pool of Completely Random RNA. Virology 237, 270. 217 Kurland, C. G. (1992) Translational Accuracy and the Fitness of Bacteria. Annual Review of Genetics 26, 29-50. Kyogoku, Y., Fujiyoshi, Y., Shimada, I., Nakamura, H., Tsukihara, T., Akutsu, H., Odahara, T., Okada, T., & Nomura, N. (2003) Structural Genomics of Membrane Proteins. Accounts of Chemical Research 36, 199-206. Lammin, S. G., Pedgrift, B. L., & Ratcliffe, A. J. (1996) Conversion of anilines to bisBoc protected N-methylguanidines. Tetrahedron Letters 37, 6815. Lato, S.M. Dissertation. (1999) Ribonucleic Acid Interactions with Aminoglycoside Antibiotics and Flavin Adenine Dinucleotide. Indiaana University. Lato, S. M., Boles, A. R., & Ellington, A. D. (1995) In vitro selection of RNA lectins: using combinatorial chemistry to interpret ribozyme evolution. Chemistry & Biology 2, 291-303. Lato, S. M., Ozerova, N. D. S., He, K., Sergueeva, Z., Shaw, B. R., & Burke, D. H. (2002) Boron-containing aptamers to ATP. Nucleic Acids Research 30, 14011407. Lau, N. C., Lim, L. P., Weinstein, E. G., & Bartel, D. P. (2001) An Abundant Class of Tiny RNAs with Probable Regulatory Roles in Caenorhabditis Elegans. Science 294, 858-862. Lauhon, C. T. & Szostak, J. W. (1995) RNA aptamers that bind flavin and nicotinamide redox cofactors. Journal of the American Chemical Society 117, 1246-1257. Lehn, J.-M. (1971) Structure Bonding 16, 1. Lehn, J.-M. (1995) Supramolecular Chemistry, VCH, New York. Lehnert, V., Jaeger, L., Michel, F., & Westhof, E. (1996) New Loop-loop Tertiary Interactions in Self-splicing Introns of Subgroup IC and ID: A Comparative 3D Model of the Tetrahymena Thermophila Ribozyme. Chemistry & Biology 3, 9931009. Lenz, G. R. (1988) Synthesis of 7-oxygenated aporphine alkaloids from a 1benzylideneisoquinoline enamide. Journal of Organic Chemistry 53, 4447. Levallet, C., Lerpiniere, J., & Ko, S. Y. (1997) The HgCl2-promoted guanylation reaction: the scope and limitations. Tetrahedron 53, 5291. Li, J. J., Fang & X., Tan, W. (2002) Molecular Aptamer Beacons for Real-Time Protein Recognition. Biochemical and Biophysical Research Communications 292, 31-40. 218 Lin, C. H. & Patel, D. J. (1997) Structural Basis of DNA Folding and Recognition in an AMP-DNA Aptamer Complex: Distinct Architectures but Common Recognition Motifs for DNA and RNA Aptamers Complexed to AMP. Chemistry & Biology 4, 817-832. Linkletter, B. A., Szabo, I. E., Bruice, T. C. (1999) Solid-phase synthesis of oligopurine deoxynucleic guanidine (DNG) and analysis of binding with DNA oligomers. Journal of American Chemical Society 121, 3888- 3896. Linton, B. R., Carr, A. J., Orner, B. P., & Hamilton, A.D. (2000) A Versatile One-Pot Synthesis of 1,3-Substituted Guanidines from Carbamoyl Isothiocyanates. Journal of Organic Chemistry 65, 1566-1568. Lerman, L.S. (1961). Structural Considerations in the Interaction of Deoxyribonucleic Acid and Acridines. Journal of Molecular Biology 3, 18-30. Luedtke, N. W., Baker, T. J., Goodman, M., & Tor, Y. (2000) Guanidinoglycosides: A Novel Family of RNA Ligands. Journal of the American Chemical Society 122, 12035-12036. Luedtke, N. W., Liu, Q. & Tor, Y. (2003) RNA-Ligand Interactions: Affinity and Specificity of Aminoglycoside Dimers and Acridine Connjugates to the HIV-1 Rev Response Element. Biochemistry 42, 11391-11403. Leudtke, N. W., Liu, Q., & Tor, Y. (2003) Synthesis, Photophysical Properties, and Nucleic Acid Binding of Phenanthridinium Derivatives Based on Ethidium. Bioorganic & Medicinal Chemistry 11, 5235-5247. Levine, T. D., Gao, F., King, P. H., Andrews, L. G., & Keene, J. D. (1993) Hel-N1: An Autoimmune RNA-Binding Protein with Specificity for 3' Uridylate-rich Untranslated Regions of Growth Factor mRNAs. Molecular and Cellular Biology 13, 3494. Lightstone, F. C. & Bruice T. C. (1996) Ground state conformations and entropic and enthalpic factors in the efficiency of intramolecular and enzymatic reactions. 1. Cyclic anhydride formation by substituted glutharates, succinate, and 3,6-endoxoD4-tetrahydrophthalate monophenyl esters. Journal of the American Chemical Society 118, 2595-2605. Li, Y. & Breaker, R. R. (1999) Kinetics of RNA degradation by specific base catalysis of transesterification involving the 2'-hydroxyl group. Journal of the American Chemical Society 121, 5364-5372. 219 Li, Y. & Sen, D. (1996) A Catalytic DNA for Porphyrin Metallation. Nature Structure Biology 3, 743-747. Lin, Y., Qiu, Q., Gill, S. C., & Yayasen, S. D. (1994) Modified RNA sequence pools for in vitro selection. Nucleic Acids Research 22, 5229- 5234. Linney, I. D., Buck, I. M., Harper, E. A., Kalindjin, S. B., Pether, M. J., Shankley, N. P., Watt, G. F., & Wright, P. T. (2000) Design, Synthesis, and Structure-Activity Relationships of Novel Non-Imidazole Histamine H3 Receptor Antagonists. Journal of Medicinal Chemistry 43, 2362-2370. Liss, M., Peterson, B., Wolf, H., & Prohaska, E. (2002) An Aptamer-Based Quartz Crystal Protein Biosensor. Analytical Chemistry 74, 4488-4495. Lorsch, J. R. & Szostak, J. W. (1994) In vitro selection of RNA aptamers specific for cyanocobalamin. Biochemistry 33, 973-982. Lozupone, C., Changayil, S., Majerfeld, I., & Yarus, M. (2003) Selection of the simplest RNA that binds isoleucine. RNA 9, 1315-1322. Lu, Y., Liu, J., Li, J., Bruesehoff, P. J., Pavot, C. M.-B., & Brown, A. K. (2003) New highly sensitive and selective catalytic DNA biosensors for metal ions. Biosensors and Bioelectronics 18, 529-540. Luzi, E., Minummi, M., Tombelli, S., & Mascini, M. (2003) New Trends in Affinity Sensing Aptamers for Ligand binding. Trends in Analytical Chemistry 22, 810818. Luedtke, N. W., Tor, Y. (2000) A Novel Solid-Phase Assembly for Identifying Potent and Selective RNA Ligands. Angewandte Chemie International Edition in English 39, 1788-1790. Macaya, R. F., Schultze, P., Smith, F. W., Roe, J. A., & Feigon, J. (1993) ThrombinBinding DNA Aptamer Forms a Unimolecular Quadruplex Structure in Solution. Proceedings of the National Academy of Sciences of the United States of America 90, 3745-3749. Maillard, M. C., Perlman, M. E., Amitay, O., Baxter, D., Berlove, D., Connaughton, S., Fischer, J. B., Guo, J. Q., Hu, L., McBurney, R. N., Nagy, P. I., Subbarao, K., Yost, E. A., Zhang, L., & Durant, G. J. (1998) Design, synthesis, and pharmacological evaluation of conformationally constrained analogues of N,N'diaryl- and N-aryl-N-aralkylguanidines as potent inhibitors of neuronal Na+ channels. Journal of Medicinal Chemistry 41, 3048-3061. Marriner, S. (1986) Anthelmintic Drugs. Veterinary Record 118, 181-184. 220 Marshall, K. A. & Ellington, A. D. (2000) In Vitro Selection of RNA Aptamers. Methods in Enzymology 318, 193-214. Martell, R. E., Nevins, J. R., & Sullenger, B. A. (2002) Optimizing Aptamer Activity for Gene Therapy Applications Using Expression Cassette SELEX. Molecular Therapy 6, 30-34. McCauley, T. G., Hamaguchi, N., & Stanton, M. (2003) Aptamer-based biosensor arrays for detection and quantification of biological macromolecules. Analytical Biochemistry 319, 244-250. Mei, H. Y., Galan, A. A., & Halim, N. S. (1995) Discovery of Selective, Small-Molecule Inhibitors of RNA Complexes: I. The Tat Protein/TAR RNA Complexes Required for HIV-1 Transcription. Bioorganic & Medicinal Chemistry Letters 5, 2755-2760. Meli, M., Vergne, J., Decout, J.-L., & Maurel, M.-C. (2002) Adenine-Aptamer Complexes. A BIPARTITE RNA SITE THAT BINDS THE ADENINE NUCLEIC BASE. Journal of Biological Chemistry 277, 2104-2111. Mendonsa, S. D. & Bowser, M. T. (2004) In Vitro Evolution of Functional DNA Using Capillary Electrophoresis. Journal of the American Chemical Society 126, 20-21. Merino, E. J. & Weeks, K. M. (2003) Fluorogenic Resolution of Ligand Binding by a Nucleic Acid Aptamer. Journal of the American Chemical Society 125, 1237012371. Metzger, A., Gloe, K., Stephen, H., & Schmidtchen, F. P. (1996) Molecular Recognition and Phase Transfer of Underivatized Amino Acids by a Foldable Artificial Host. Journal of Organic Chemistry 61, 2051-2055. Michael, K. & Tor, Y. (1998) Designing Novel RNA Binders. Chemistry: A European Journal 4, 2091-2098. Michael, K., Wang, H., & Tor, Y. (1999) Enhanced RNA Binding of Dimerized Amino Glycosides. Bioorganic & Medicinal Chemistry 7, 1361-1371. Michaud, M., Jourdan, E., Ravelet, C., Villet, A., Ravel, A., grosset, C., & Peyrin, E. (2004) Immobilized DNA Aptamers as Target-Specific Chiral Stationary Phases for Resolution of Nucleoside and Amino Acid Derivative Enantiomers. Analytical Chemistry 76, 1015-1020. 221 Michaud, M., Jourdan, E., Villet, A., Ravel A., Grosset, C., & Peyrin, E. (2003) A DNA Aptamer as a New Target-Specific Chiral Selector for HPLC. Journal of the American Chemical Society 125, 8672-8679. Michel, F. & Westhof, E. (1990) Modelling of the Three-Dimensional Architecture of Group I Catalytic Introns Based on Comparative Transcription Factor IIIA. Journal of Molecular Biology 216, 585-610. Michiels, P. J. A., Versleijen, A. A. M., Verlaan, P. W., Pleij, C. W. A., Hilbers, & C. W., Heus, H. A. (2001) Solution Structure of the Pseudoknot of SRV-1 RNA Involved in Ribosomal Frameshifting. Journal of Molecular Biology 310, 11091123. Mikkelsen, N. E., Brannvall, M., Virtanen, A., & Kirsebom, L. A. (1999) Inhibition of RNase P RNA Cleavage by Aminoglycosides. Proceedings of National Academy of Science of the United States of America 96, 6155-6160. Misra, V. K. & Draper, D. E. (1998) On the Role of Magnesium Ions in RNA Stability. Biopolymers 48, 113-135. Miyamoto, Y., Hirose, H., Matsuda, H., Nakano, S., Ohtani, M., Kaneko, M., Sishigaki, K., Nomura, F., Kitamura, H., & Kawashima, Y.(1985) Trans. Am. Soc. Artif. Int. Organs 31, 508-511. Moazed, D. & Noller, H. F. (1986) Transfer RNA Shields Specific Nucleotides in 16S Ribosomal RNA from Attack by Chemical Probes. Cell 47, 985-994. Moazed, D. & Noller, H. F. (1987) Interaction of Antibiotics with Functional Sites in 16S ribosomal RNA. Nature 327, 389-394. Moazed, D. & Noller, F. (1987) Intermediate Sites in the Movement of Transfer RNA in the Ribosome. Nature 389. Mollova, E. (2002) Single-molecule fluorescence of nucleic acids. Current Opinion in Chemical Biology 6, 823- 828. Moravek, Z., Neidle, S., & Schneider, B. (2002) Protein and drug interactions in the minor groove of DNA. Nucleic Acids Research 30, 1182-1191. Moreno, M., Rincon, E., Pineiro, D., Fernandez, G., Domingo, A., Jimenez-Ruiz, A., Salinas, M., & Gonzalez, V. M. (2003) Biochemical and Biophysical Research Communications 308, 214-218. Mori, A., Cohen, B.D., & Koide, H., Guanidines-Further Explorations of the Biological and Clinical Significance of Guanidino compounds. (1987) Plenum Press, N.Y. 222 Mori, A., Cohen, B. D., & Lowenthal, A. (1985) Guanidines- Historical, Biological, Biochemical, and Clinical Aspects of the Naturally Occurring Guanidino Compounds. Plenum Press, N.Y. Morris, K. N., Jensen, K. B., Julin, C. M., Weil, M., & Gold, L. (1998) High Affinity Ligands from in vitro Selection: Complex. Targets Proceedings of the National Academy of Sciences of the United States of America 95, 2902-2907. Mowat, C. G., Moysey, R., Miles, C. S., Leys, D., Doherty, M. K., Taylor, P., Walkinshaw, M. D., Reid, G. A., & Chapman, S. K. (2001) Kinetic and Crystallographic Analysis of the Key Active Site Acid/base Arginine in a Soluble Fumarate Reductase. Biochemistry 40, 12292-12298. Muramatsu, I., Oshita, M., & Yamanaka, K. (1983) Selective alpha-2 blocking action of DG-5128 in the dog mesenteric artery and rat vas deferens. Journal of Pharmacology and experimental therapeutics 227, 194-198. Murphy, F. L. & Cech, T. R. (1993) An Independently Folding Domain of RNA Tertiary Structure Within the Tetrahymena Ribozyme. Biochemistry 32, 5291-5300. Murphy, M. B., Fuller, S. T., Richardson, P. M., & Doyle, S. A. (2003) Nucleic Acids Research An improved method for the in vitro evolution of aptamers and applications in protein detection and purification. 31, e110. Muth, G. W., Ortoleva- Donnelly, L., & Strobel, S. A. (2000) A Single Adenosine with a Neutral pKa in the Ribosomal Peptidyl Transferase Center. Science 289, 947950. Nauenburg, S., Zwerschke, W., & Jansen-Durr, P. (2001) Induction of Apoptosis in Cervical Carinoma Cells by Peptide Aptamers that Bind to the HPV-16 E7 Oncoprotein. EASEB Journal 15, 592-594. Nefzi, A., Dooley, C., Ostresh, J. M., & Houghten, R. A. (1998) Combinatorial chemistry: from peptides and peptidomimetics to small organic and heterocyclic compounds. Bioorganic Medicinal Chemistry Letters 8, 2273- 2278. Nesbitt, S., Hegg, L. A., & Fedor, M. J. (1997) An Unusual pH-independent and Metalion-independent Mechanism for Hairpin Ribozyme Catalysis. Chemistry & Biology 1997, 4, 619-630. Nickens, D. G., Patterson, J. T., & Burke, D. H. (2003) Inhibition of HIV-1 reverse transcriptase by RNA aptamers in Escherichia coli. RNA 9, 1029-1033. 223 Nilsen, T. W. (1998) "RNA-RNA interactions in nuclear pre-mRNA splicing" in RNA Structure and Function, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 279-307. Nissen, P., Hansen, J., Ban, N., Moore, P. B., & Steitz, T. A. (2000) The Structural Basis of Ribosome Activity in Peptide Bond Synthesis. Science 289, 920- 930. Nissen, P., Ippolito, J. A., Ban, N., Moore, P. B., & Steitz, T. A. (2001) RNA Tertiary Interactions in the Large Ribosomal Subunit: The A-minor Motif. Proceedings of the National Academy of Sciences of the United States of America 98, 4899-4903. Nolte, A., Klussmann, S., Bald, R., Erdmann, V. A., & Furste, J. P. (1996) Mirror-Design of L-Oligonucleotide Ligands binding to L-Arginine. Nature Biotechnology 14, 1116-1119. Ohizumi, Y., Sasaki, S., Kusumi, T., & Ohtani, I. I. (1996) Ptilomycalin A, a novel Na+, K(+)- or Ca2(+)-ATPase inhibitor, competitively interacts with ATP at its binding site. European Journal of Pharmacology 310, 95-98. Oivanen, M., Kuusela, S., & Lonnberg, H. (1998) Kinetics and mechanisms for the cleavage and isomerization of the phosphodiester bonds of RNA by Bronsted acids and bases. Chemical Reviews 98, 961-990. Okamura, K., Kiyohara, Y., Komada, F., Iwakawa, S., Hiral, M., & Fuwa, T. (1990) Improvement in wound healing by epidermal growth factor (EGF) ointment. I. Effect of nafamostat, gabexate, or gelatin on stabilization and efficacy of EGF. Pharmaceutical Research 7, 1289-1293. Osborne, S. E. & Ellington, A. D. (1997) Nucleic Acid Selection and the Challenge of Combinatorial Chemistry. Chemical Reviews 97, 349-370. Padmanaphan, K., Padmanaphan, K. P., Ferrara, J. D., Sadler, J. E., & Tulinsky, A. J. (1993) The Structure of -Thrombin Inhibited by a 15-Mer Single-Stranded DNA Aptamer. Journal of Biological Chemistry 268, 17651-17654. Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellineck, D., & Dang, C. (1997) Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA Inhibitors of Keratinocyte Growth Factor. Nature Biotechnology 15, 68-73. Pan, W., Craven, R. C., Qiu, Q., Wilson, C. B., Wills, J. W., Golovine, S., & Wang, J. F. (1995) Isolation of Virus-Neutralizing RNAs from a Large Pool of Random Sequences. Proceedings of the National Academy of Sciences of the United States of America 92, 11509-11513. 224 Pape, T., Wintermeyer, W., & Rodnina, M. V. (2000) Conformational Switch in the Decoding Region of 16S rRNA during Aminoacyl-tRNA Selection on the Ribosome. Nature Structure Biology 7, 104-107. Pape, T.; Wintermeyer, W.; Rodina, M. (1999) Induced Fit in Initial Selection and Proofreading of Aminoacyl-tRNA on the Ribosome. EMBO Journal 18, 38003807. Patel, D. J. (1999) Adaptive Recognition in RNA Complexes with Peptides and protein Molecules. Current Opinions in Structural Biology 9, 74. Pavski, V. & Le, X. C. (2001) Detection of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Using Aptamers as Probes in Affinity Capillary Electrophoresis. Analytical Chemistry 73, 6070-6076. Peterson, E. T., Blank, J., Sprinzel, M., & Uhlenbeck, O. C. (1993) Selection for Active E.coli tRNA(Phe) Variants from a Randomized Library Using Two Proteins. EMBO Journal 12, 2959. Petrenko, V. A., Smith, G. P., Gong, X., & Quinn, T. (1996) A library of organic landscapes on filamentous phage. Protein Engineering, 9, 797-801. Pieken, W. A., Olsen, D. B., Benseler, F., Aurup, H., & Eckstein, F. (1991) StructureFunction Relationship of Hammerhead Ribozymes as Probed by 2'Modifications. Science 253, 314- 317. Potapov, A. P., Tiana-Alonso, F. J., & Nierhaus, K. H. (1995) Ribosomal Decoding Processes at Codons in the A or P Sites Depend Differently on 2'-OH Groups. Journal of Biological Chemistry 270, 17680-17684. Potyrailo, R. A., Conrad, R. C., Ellington, A. D., & Hieftje, G. M. (1998) Adapting Selected Nucleic Acid Ligands (Aptamers) to Biosensors. Analytical Chemistry 70, 3419-3425. Puglisi, J. D., Chen, L., Blanchard, S., & Frankel, A. D. (1995) Solution Structure of a Bovine Immunodeficiency Virus Tat-TAR Peptide-RNA Complex. Science 270, 1200. Puglisi, J. D., Williamson, J. R. (1999) in The RNA World, Gesteland, R. F., Cech, T. R., Atkins, J. F. Eds. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2nd ed., pp. 403-425. Puglisi, J. D., Wyatt, J. R., & Tinoco, I., Jr. (1990) Conformation of an RNA Pseudoknot. Journal of Molecular Biology 214, 437. 225 Purohit, P. & Stern, S. (1994) Interactions of a Small RNA with Antibiotic and RNA Ligands of the 30S Subunit. Nature 370, 659. Qin, P. Z.; Pyle, A. M. (1999) Site- Specific Labeling of RNA with Fluorophore s and Other Structural Probes. A Companion to Methods in Enzymology 18, 60-70. Raines R. T. (1998) Ribonuclease A. Chemical Reviews 98, 1045-1065. Rajendran, M. & Ellington, A. D. (2003) In vitro selection of molecular beacons. Nucleic Acids Research 31, 5700-5713. Recht, M. I., Fourmy, D., Blanchard, S. C., Dahlquist, K. D., Puglisi, J. D. (1996) RNA Sequence Determinants for Aminoglycoside Binding to an A-site rRNA Model Oligonucleotide. Journal of Molicular Biology 262, 421-436. Reich, E. & Goldberg, I. H. (1964). Actinomycin and Nucleic Acid Function. Progress in Nucleic Acids Research 3, 183-234. Rehder, M. A. & McGown, L. B. (2001) Open-tubular Capillary Electrochromatography of Bovine Beta-Lactoglobulin Variants A and B Using an Aptamer Stationary Phase. Electrophoresis 22, 3759-3764. Rensing, S., Arendt, M., Springer, A., Grawe, T., & Schrader, T. (2001) Optimization of a Synthetic Arginine Receptor. Systematic Tuning of Noncovalent Intractions. Journal of Organic Chemistry 66, 5814-5821. Ringquist, S., Jones, T., Snyder, E. E., Gibson, T., & Gold, L. (1995) High-Affinity RNA Ligands to Escherichia coli Ribosomes and Ribosomal Protein S1: Comparison of Natural and Unnatural Binding Sites. Biochemistry 34, 3640-3648. Robertson, M. P. & Ellington, A. D. (1999) In Vitro Selection of an Allosteric Ribozyme that Transduces Analytes to Amplicons. Nature Biotechnology 17, 62-66. Robles, J., Grandas, A., & Pedroso, E. (2003) 4-Guanidino-2-pyrimidinone Nucleobases: Synthesis and Hybridization Properties. Nucleotides & Nucleic Acids 22, 5-8. Robinson, S. & Roskamp, E. J. (1997) Solid Phase Synthesis of Guanidines. Tetrahedron 53, 6697- 6705. Rodriguez-Lopez, J. N., Lowe, D. J., Hernandez-Ruiz, J., Hiner, A. N. P., GarciaCanovas, F., & Thorneley, R. N. F. (2001) Mechanism of Reaction of Hydrogen Peroxide with Horseradish Peroxidase: Identification of Intermediates in the Catalytic Cycle. Journal of the American Chemical Society 123, 11838-11847. 226 Rogers, J., Chang, A. H., von Ahsen, U., Schroeder, R., & Davies, J. (1996) Inhibition of the Self-Cleavage Reaction of the Human Hepatitis Delta Virus Ribozyme by Antibiotics. Journal of Molecular Biology 916-925. Romig, T. S., Bell, C., & Drolet, D. W. (1999) Aptamer Affinity Chromatography: Combinatorial Chemistry applied to Protein Purification. Journal of Chromatography B 731, 275-284. Rook, M. S., Treber, D. K., & Williamson, J. R. (1999) An Optimal Mg2+ Concentration for Kinetic Folding of the Tetrahymena Ribozyme. Proceedings of the National Academy of Sciences of the United States of America 96, 12471- 12476. Rowsell, S., Stonehouse, N. J., Convery M. A., Adams, C. J., Ellington, A. D., Hirao, I., Peabody, D. S., Stockley, P. G., & Phillips, S. E. (1998) Crystal Structure of a Series of RNA Aptamers Complexed to the Same Protein Target. Nature Structure Biology 5, 970-975. Rusconi, C. P., Scardino, E., Layzer, J., Pitoc, G. A., Ortel, T. L., Monroe, D., & Sullenger, B. A. (2002) RNA aptamers as reversible antagonists of coagulation factor IXa. Nature 419, 90-94. Russell, R. & Herschlag, D. (2001) Probing the Folding Landscape of the Tetrahymena Ribozyme: Commitment to Form the Native Conformation is Late in the Folding Pathway. Journal of Molecular Biology 308, 839- 851. Sabeti, P. C. & Unrau, P. J (1997) Accessing Rare Activities from Random RNA Sequences: The Importance of the Length of Molecules in the Starting Pool. Chemistry & Biology 4, 767-774. Saenger, W. Principles of Nucleic Acid Structure (1984) Springer Verlag: New York. Sassanfar, M. & Szostak, J. W. (1993) An RNA Motif that Binds ATP. Nature 364, 550553. Satoh, T., Muramatu, M., Ooi, Y., Miyatake, H., Nakajima, T., & Umeyama, M. (1985) Medicinal chemical studies on synthetic protease inhibitors, trans-4guanidinomethylcyclohexanecarboxylic acid aryl esters. Chemical & Pharmaceutical Bulletin 33, 647-654. Schneider, S.E., Bishop, P.A., Salazar, M. A., Bishop, O.A., & Anslyn, E.V. (1998) Solid Phase Synthesis of Oligomeric Guanidiniums. Tetrahedron, 54, 15063-15086. Schneider, S.E., O'Neil, S.N., & Anslyn, E.V. (2000) Journal of the American Chemical Society 122, 542-543. 227 Schroeder, R. (1994) Translation. Dissecting RNA Function. Nature 370, 597-598. Schroeder R., Streicher, B., & Wank, H. (1993) Splice-Site Selection and Decoding: Are They Related? Science 260, 1443-1444. Schroeder, R., von Ashen, U., Eckstein, F., & Lilley, D. M. J. (1996) "Nucleic Acids and Molecular Biology," Vol. 10, p.53. Springer-Verlag, Berlin. Michael, K. & Tor, Y. (1998) Designing Novel RNA Binders. Chemistry: A European Journal 4, 2091. Schroeder, R., Waldsich, C., & Wank, H. (2000) Modulation of RNA Function by Aminoglycoside Antibiotics. EMBO Journal 19, 1-9. Schultze, P., Macaya, R. F., & Feigon, J. (1994) Three-dimensional Solution Structure of the Thrombin-binding DNA Aptamer. Journal of Molecular Biology 235, 1532. Schuster, P., Fontana, W., Stadler, P. F., & Hofacker, I. L. (1994) From Sequences to Shapes and Back: A Case Study in RNA Secondary Structures. Proceedings of the Royal Society of London Series B 255, 279-284. Sclavi, B., Sullivan, M., Chance, M. R., Brenowitz, M., & Woodson, S. A. (1998) RNA Folding at Millisecond Intervals by Synchrotron Hydroxyl Radical Footprinting. Science 279, 1940-1943. Scott W. G., Murray, J. B., Arnold, J. R. P., Stoddard, B. L., & Klug, A. (1996) Capturing the Structure of a Catalytic RNA Intermediate: the Hammerhead Ribozyme Science 274, 2065-2069. Seelig, B., Keiper, S., Stuhlmann, F., & Jaschke, A. (2000) Enantioselective ribozyme catalysis of a bimolecular cycloaddition reaction. Angewandte Chemie International Edition in English 39, 4576-4579. Sheridan, M. A., Kittilson, J. D., & Slagter, B. J. (200) Structure-function relationships of the siganaling system for the somatostatin peptide hormone family. American Zoologist 40, 269-286. Sherman, D. & Henry, J. P. (1980) Role of the proton electrochemical gradient in monoamine transport by bovine chromaffin granules. Biochim. Biophys. Acta 601, 664-677. Shiman, R. & Draper, D. E. (2000) Stabilization of RNA Tertiary Structure by Monovalent Cations. Journal of Molecular Biology 302, 79-91. 228 Short, J. H., Ours, C. W. & Ranus, Jr., W. J. (1968) Sympathetic nervous system blocking agents. V. Derivatives of isobutyl-, tert-butyl-, and neopentylguanidine. Journal of Medicinal Chemistry 11, 1129-1135. Singer, B. S., Shtatland, T., Brown, D., & Gold, L. (1997) Libraries for genomic SELEX. Nucleic Acids Research 25, 781-786. Silverman, S. K., Deras, M. L., Woodson, S. A., Scaringe, S. A., & Cech, T. R. (2000) Multiple Folding Pathways for the P4-P6 RNA Domain. Biochemistry 39, 1246512475. Siomi, H., & Dreyfuss, G. (1997) RNA-binding Proteins as Regulators of Gene Expression. Current Opinion in Genetics & Development 7, 345- 353. Smith, J., Liras, J. L., Schneider, S. E., & Anslyn, E. V. (1996) Solid and Solution Phase Organic Syntheses of Oligomeric Thioureas. Journal of Organic Chemistry 61, 8811- 8818. Soukup, G. A. & Breaker, R. R. (1999) Relationship between internucleotide linkage geometry and the stability of RNA. RNA 5, 1308-1325. Spiegelman, S. Q. (1971) An Approach to the Experimental Analysis of Precellular Evolution. Quarterly Reviews of Biophysics 4, 213-253. Srisawat, C. & Engelke, D. R. (2002) Streptavidin Aptamers: Affinity Tags for the Study of RNAs and Ribonucleoprotein. Methods 26, 156- 161. Stadlwieser, J., Ellmerer-Muller, E. P., Tako, A., Maslouh, N., & Bannwarth, W. (1998) Combinatorial solid-phase synthesis of structurally complex thiazolylhydantoins. Angewandte Chemie International Edition 37, 1402-1404. Stage, T. K., Hertel, K. J., & Uhlenbeck, O. C. (1995) Inhibition of the hammerhead ribozyme by neomycin. RNA 1, 95-101. Starikov, E. B. & Nilsson, L. (2002) Structural Basis of Biotin-RNA Aptamer Binding: A Theoretical Study. Chemistry & Physics Letters 363, 39-44. Stojanovic, M. N. & Landry, D. W. (2002) Aptamer-Based Colorimetric Probe for Cocaine. Journal of the American Chemical Society 124, 9678-9679. Streicher, B., Westhof, E., & Schroeder, R. (1996) The Environment of Two Metal Ions Surrounding the Splice Site of a Group I Intron. EMBO Journal 15, 2556-2564. 229 Strobel, S. A. (2002). Biochemical Identification of A-minor Motifs within RNA Tertiary Structure by Interference Analysis. Biochemical Society Transactions 30, 1126-1131. Su, W. (1996) An efficient procedure for the guanylation of amines using N,N'bis(benzyloxycarbonyl)-S-methylisothiourea. Synthetic Communications, 26, 407. Sudarsanan, V., Nagarajan, K., & Gokhale, N. G. (1982) Nitroimidazoles: Part XVII. 5Aminoimidazoles. Indian Journal of Chemistry Section B 21, 1087. Sulyok, G. A., Gibson, C., Goodman, S. L., Holzemann, Wiesner, G. M., Kessler, H. (2001) Solid-phase synthesis of a nonpeptide RGD mimetic library: new selective alphavbeta3 integrin antagonists. Journal of Medicinal Chemistry 44, 1938-1950. Szilagyi, L., Pusztahelyi, Z. Sz., Jakab, S., & Kovacs, I. (1993) Microscopic protonation constants in tobramycin. An NMR and pH study with the aid of partially Nacetylated derivatives. Carbohydrate Research 247, 99-109. Takeuchi, M., Yoda, S., Imada, T., & Shinkai, S. (1997) Chiral sugar recognition by a diboronic-acid-appended binaphthyl derivative through rigidification effect. Tetrahedron 53, 8335-8348. Tan, R., Chen, L., Buettner, J. A.; Hudson, D., & Frankel, A. D. (1993) RNA Recognition by an Isolated Alpha Helix. Cell 73, 1031-1040. Theimer, C. A., Finger, L. D., & Feigon, J. (2003) Evolution of aptamers with a new specificity and new secondary structures from an ATP aptamer. RNA 9, 14461455. Thomas, M., Chedin, S., Carles, C., Riva, M., Famulok, M., & Sentenac, A. (1997) Selective Targeting and Inhibition of Yeast RNA Polymerase II by RNA Aptamers. Journal of Biological Chemistry 272, 27980. Tor, Y., Hermann, T., & Westhof, E. (1998) Deciphering RNA Recognition: Aminoglycoside Binding to the Hammerhead Ribozyme. Chemistry & Biology 5, R277 Toume, J.-J., Darfeuille, F., Kolb, G., Chabas, S., & Staedel, C. (2003) Modulating Viral Gene Expression by Aptamers to RNA Structures. Biology of the Cells 95, 229238. Treiber, D. K., Rook, M. S., Zarrinkar, P. P., & Williamson, J. R. (1998) Kinetic Intermediates Trapped by Native Interactions in RNA Folding. Science 279, 1943- 1946. 230 Tsai, D. E., Harper, D. S., & Keene, J. D. (1991) U1-snRNP-A protein selects a ten nucleotide consensus sequence from a degenerate RNA pool presented in various structural contexts. Nucleic Acids Research Nucleic Acid Research 4931-4936. Tsai, D. E., Kenan, D. J., & Keene, J. D. (1992) In Vitro Selection of an RNA Epitope Immunologically Cross-Reactive with a Peptide. Proceedings of the National Academy of Sciences of the United States of America 89, 8864-8868. Tuerk, C. & Gold, L. (1990) Systematic Evolution of Ligands by Exponential Enrichment: RNA Ligands to Bacteriophage T4 DNA Polymerase. Science 249, 505. Uhlenbeck, O. C. (1998) A Coat for All Sequences. Nature Structure Biology 5, 174-176. Ulrich, H., Magdesian, M. H., Alves, M. J. M. & Colli, W. (2002) In Vitro Selection of RNA Aptamers That Bind to Cell Adhesion Receptors of Trypanosoma cruzi and Inhibit Cell Invasion. Journal of Biological Chemistry 277, 20756-20762. Umezawa, S., Takahashi, Y., Usui, T., & Tsuchiya, T. (1974) Synthesis of 4'deoxykanamycin and its resistance to kanamycin phosphotransferase II. Journal of Antibiotics 27, 997- 999. Usher, D. A. & McHale A. H. (1976) Hydrolitic stability of helical RNA: A selective advantage for the natural 3',5'-bond. Proceedings of the National Academy of Sciences of the United States of America 73, 1149-1153. Valegard, K., Murray, J. B., Stockley, P. G., Stone-house, N. J., & Liljas, L. (1994) Crystal Structure of an RNA Bacteriophage Coat Protein-Operator Complex. Nature 371, 623-626. Valegard, K. et al. (1997) The three-dimensional structures of two complexes between recombinant MS2 capsids and RNA operator fragments reveal sequence-specific protein-RNA interactions. Journal of Molecular Biology 270, 724-738. Van der Merwe, P. A. & Davis, S. J. (2003) Molecular interactions mediating T cell antigen recognition. Annual Review of Immunology 21, 659-684. Varani, G., Cheong, C., & Tinoco, I., Jr. (1991) Structure of an unusually stable RNA hairpin. Biochemistry 30, 3280-3289. Varani, G. & Nagai, K. (1998) RNA Recognition by RNP Proteins During RNA Processing. Annual Review of Biophysics and Biomolecular Structure 27, 407445. 231 von Ashen, U., Davies, J., & Schroeder, R. (1991) Antibiotic Inhibition of Group I Ribozyme Function. Nature 353, 368-370. von Ahsen, U.. Davies, J., & Schroeder, R. (1992) Non-Competitive Inhibition of Group I Intron RNA Self-Splicing by Aminoglycoside Antibiotics. Journal of Molecular Biology 226, 935-941. von Ahsen, U. & Noller, H. F. (1993) Footprinting the Sites of Interaction of Antibiotics with Catalytic Group I Intron RNA. Science 260, 1500-1503. von Ashen, U.; Schroeder, R. (1990) Streptomycin and Self-Splicing. Nature 346, 801. Vuyisich, M. & Beal, P. A. (2002) Regulation of the RNA-Dependent Protein Kinase by Triple Helix Formation. Chemistry & Biology 9, 907-913. Wallace, S. T.; Schroeder, R. (1998) In Vitro Selection and Characterization of Streptomycin-Binding RNAs: Recognition Discrimination Between Antibiotics. RNA 4, 112. Wallace, S. T. & Schroeder, R. (2000) In Vitro Selection and Characterization of RNAs with High Affinity Antibiotics. Methods in Enzymology 318, 214-229. Wallis, M. G. & Schroeder, R. (1997) The Binding of Antibiotics to RNA. Progress in Biophysics and Molecular Biology 67, 141-154. Wallis, M. G., Streicher, B., Wank, H., von Ashen, U., Clodi, E., Wallace, S. T., Famulok, M., Schroeder, S. (1997) In Vitro Selection of a Viomycin-binding RNA Pseudoknot. Chemistry & Biology 4 357. Wallis, M. G., von Ashen, U., Schroeder, R., & Famulok, M. (1995) A Novel RNA Motif for Neomycin Recognition. Chemistry & Biology 2, 543. Walter, G., Bussow, K., Lueking, A., & Glokler, J. High- throroughput Protein Arrays: Prospects for Molecular Diagnostics. Trends in Molecular Medicine 8, 250-253. Walter, G., Bussow, K., Lueking, A., & Glokler, J. (2002) Protein Arrays for Gene Expression and Molecular Interaction Screening. Trends in Molecular Medicine 8, 250-253. Wang, F., & Hauske, J. R. (1997) An approach to enantiomerically pure inverse -turn mimetics for use in solid-phase synthesis. Tetrahedron Letters 38, 8651- 8654. Wang, H. & Tor, Y. (1997) Electrostatic Interactions in RNA Aminoglycosides Binding. Journal of the American Chemical Society 119, 8734-8735. 232 Wang, H. & Tor, Y. (1998) RNA-Aminoglycoside Interactions: Design, Synthesis, and Binding of Amino-aminoglycosides to RNA. Angewandte Chemie International Edition in English 37, 109-111. Wang, H. & Tor, Y. (1998) Tobramycin-EDTA Conjugate: A Noninnocent AffinityCleaving Reagent. Bioorganic & Medicinal Chemistry Letters 8, 3665-3670. Wang, K. Y., McCurdy, S. N., Shea, R. G., Swaminathan, S., & Bolton, P. H. (1993) A DNA aptamer which binds to and inhibits thrombin exhibits a new structural motif for DNA. Biochemistry 32, 1899-1904. Wang, P., McLeish, M. J., Kneen, M. M., Lee, G., & Kenyon, G. L. (2001) An unusually low pK(a) for Cys282 in the active site of human muscle creatine kinase. Biochemistry 40, 11698-11705. Wang, Y. & Rando, R. R. (1995) Specific Binding of Aminoglycoside Antibiotics to RNA. Chemistry & Biology 2, 281 - 290. Wani, M. C., Campbell, H. F., Brine, G. A., Kepler, J. A., & Wall, M. E. (1972) Plant antitumor agents. IX. Total synthesis of dl-camptothecin. Journal of the American Chemical Society 94, 3631-3632. Waring, M. J., & Wakelin, L. P. G. "Forty Years On" pp 1-17. in DNA and RNA Binders, Demeunynck, M., Bailey, C., Wilson, W. D., Wiley-VCH. Weeks, K. M. & Crothers, D. M. (1991) RNA Recognition by Tat-derived Peptides: Interaction in the Major Groove. Cell 66, 577. Weeks, K. M. & Crothers, D. M. (1993) Major Groove Accessibility of RNA. Science 261, 1574. Weigand, T. W., Williams, P. B., Dreskin, S. C., Jouvin, M.-H., Kinet, J.-P., & Tasset, D. (1996) High-affinity oligonucleotide ligands to human IgE inhibit binding to Fc.epsilon. receptor I. Journal of Immunology 157, 221-230. Welch, M., Majerfeld, I., & Yarus M. (1997) 23S rRNA similarity from selection for peptidyl transferase mimicry. Biochemistry 36, 6614-6623. Werstuck, G. & Green, M. R. (1998) Controlling Gene Expression in Living Cells Through Small Molecule-RNA Interactions. Science 282, 296-298. Werstuck, G., Zapp, M. L., & Green, M. R. (1996) A Non-Canonical Base Pair Within the Human Immunodeficiency Virus Rev-Responsive Element is Involved in Both Rev and Small Molecule Recognition. Chemistry & Biology 3, 129-137. 233 Westheimer, F. H. (1968) Pseudo-rotation in the hydrolysis of phosphate esters. Accounts in Chemical Research 1, 70-78. Westhof, E. & Patel, D. J. (1997) Nucleic Acids. From Self-Assembly to Induced-fit Recognition. Current Opinions in Structural Biology 7, 305 White, R., Rusconi, C., Scardino, E., Wolberg, J. L., Hoffman, M., & Sullenger, B. (2001) Generation of Species Cross-reactive Aptamers Using "Toggle" SELEX. Molecular Therapy 4, 567-573. Wiegand, T. W., Williams, P. B., Dreskin, S. C., Jouvin, M. H., Kinet, J. P., & Tasset, D. (1996) High-affinity oligonucleotide ligands to human IgE inhibit binding to Fc epsilon receptor I. The Journal of Immunology 157, 221-230. Williams, D. H. & Westwell, M. S. (1998) Aspects of Weak Interactions. Chemical Society Reviews 27, 57. Williams, K. P., Liu, X.-H., Schumacher, T. N. M., Lin, H. Y., Ausiello, D. A., et al., (1997) Bioactive and Nuclease-Resistant L-DNA Ligand of Vasopressin. Proceedings of the National Academy of Sciences of the United States of America 94, 11285-11290. Willis, M. C., Collins, B., Zhang, T., Green, L. S., Sebesta, P., Bell, C., Kellogg, E., Gill, S. C., Magallanez, A., Knauer, S., Bendele, R. A., Gill, P. S., & Janic, N. (1998) Liposome-Anchored Vascular Endothelial Growth Factor Aptamers. Bioconjugate Chemistry 9, 573-582. Wiskur, S. L. & Anslyn, E. V. (2001) Using a Synthetic Receptor to Create and OpticalSensing Ensemble for a Class of Analytes: A Colorimetric Assay for the Aging of Scotch. Journal of the American Chemical Society 123, 10109-10110. Wiskur, S. L., Floriano, P. N., Anslyn, E. V. (2003) A multicomponent sensing ensemble in solution: Differentiation between structurally similar analytes. Angewandte Chemie International Edition in English 42, 2070-2072. Wilson, D. S. & Szostak, J. W. (1999) In Vitro Evolution of Functional Nucleic Acids. Annual Reviews in Biochemistry 68, 611-647. Wisner, J. A., Beer, P. D., Drew, M. G. B., & Sambrook, M. R. (2002) Anion-Templated Rotaxane Formation. Journal of the American Chemical Society 124, 1246912476. Woodcock, J., Moazed, D., Cannon, M., Davies, J., & Noller, H. F. (1991) Interaction of Antibiotics with A- and P-site-specific Bases in 16S Ribosomal RNA. EMBO Journal 10, 3099-3103. 234 Woese, C. R., Winker, S., & Gutell, R. R. (1990) Architecture of Ribosomal RNA: Constraints on the Sequence of "Tetra-Loops". Proceedings of the National Academy of Sciences of the United States of America 87, 8467-8471. Wu, C. C. N., Castro, J. E., Motta, M., Cottam, H. B., Kyburz, D., Kipps, T. J., Corr, M., & Carson, D. A. (2003) Selection of Oligonucleotide Aptamers with Enhanced Uptake and Activation of Human Leukemia B Cells. Human Gene Therapy 14, 849-860. Wu, M. & Tinoco, Jr. I. (1998) RNA Folding Causes Secondary Structure Rearrangement. Proceedings of the National Academy of Sciences of the United States of America 95, 11555- 11560. Xu, C., W., & Luo, Z. (2002) Inactivation of Ras Function by Allele-Specific Peptide Aptamers. Oncogene 21, 5753-5757. Xu, W. & Ellington, A. D. (1996) Anti-peptide Aptamers Recognize Amino Acid Sequence and Bind a Protein Epitope. Proceedings of the National Academy of Sciences of the United States of America 93, 7475-7480. Yamana, K., Ohtani, Y., Nakano, H., Nakano, H., & Saito, I. (2003) Bioorganic & Medicinal Chemistry Letters Bis-pyrene labeled DNA aptamer as an intelligent fluorescent biosensor. 13, 3429-3431. Yang, Y., Kochoyan, M., Burgstaller, P., Westhof, E., & Famulok, M. (1996) Structural Basis of Ligand Discrimination by Two Related RNA Aptamers Resolved by NMR Spectroscopy. Science 272, 1343. Ye, X., Gorin, A., Ellington, A. D., & Patel, D. J. (1996) Deep Penetration of and AlphaHelix into a Widened RNA Major Groove in the HIV-1 Rev Peptide-RNA Aptamer Complex. Nature Structure Biology 3, 1026. Ye, X., Gorin, A., Frederick, R., Hu, W., Majumdar, A., Xu, W., McLendon, G., Ellington, A. D., & Patel, D. J. (1999) RNA Architecture Dictates the Conformations of a Bound Peptide. Chemistry & Biology 6, 557 Ye, X., Kumar, R. A., & Patel, D. J. (1995) Molecular Recognition in the Bovine Immunodeficiency Virus Tat Peptide-TAR RNA Complex. Chemistry & Biology 2, 827 Ylera, F., Lurz, R., Erdmann, V. A., & Furste, J. P. (2002) Selection of RNA Aptamers to the Alzheimer's Disease Amyloid Peptide. Biochemical and Biophysical Research Communications 290, 1583-1588. 235 Yong, Y. F., Kowalski, J. A., & Lipton, M. A. (1997) Facile and Efficient Guanylation of Amines Using Thioureas and Mukaiyama's Reagent. Journal of Organic Chemistry 62, 1540. Yoshizawa, S., Fourny, D., & Puglisi, J. D. (1998) Structural Origins of Gentamicin Antibiotic Action. EMBO Journal 17, 6437. Yoshizawa, S., Fourney, D., & Puglisi, J. D. (1999) Recognition of the Codon-Anticodon Helix by Ribosomal RNA. Science 285, 1722-1725. Zagorowska, I., Kuusela, S., & Lonnberg H. (1998) Metal ion-dependent hydrolysis of RNA phosphodiester bonds within hairpin loops. A comparative kinetic study on chimeric ribo/2'-O-methylribo oligonucleotides. Nucleic Acids Research 26, 3392-3396. Zapp, M. L., Stern, S., & Green, M. R. (1993) Small Molecules that Selectively Block RNA Binding of HIV-1 Rev Protein Inhibit Rev Function and Viral Production. Cell 74, 969-978. Zapp, M. L., Stern, S., & Green, M. R. (1993) Small Molecules that Selectively Block RNA Binding of HIV-1 Rev Protein Inhibit Rev Function and Viral Production. Cell 74, 969-978. Zarrinkar, P. P. & Williamson, J. R. (1994) Kinetic Intermediates in RNA Folding. Science 265, 918-924. Zhang, Y., Gu, H., Yang, Z., & Xu, B. (2003) Supramolecular Hydrogels Respond to Ligand-Receptor Interaction. Journal of the American Chemical Society 125, 13680-13681. Zhou, D.-M. & Taira, K. (1998) The hydrolysis of RNA: From theoretical calculations to the hammerhead ribozyme-mediated cleavage of RNA. Chemical Reviews 98, 991-1026. Zimmerman, G. R., Shields, T. P., Jenison, R. D., Wick, C. L., & Pardi, A. (1998) A Semiconserved Residue Inhibits Complex Formation by Stabilizing Interactions in the Free State of a Theophylline-Binding RNA. Biochemistry 37, 9186- 9192. Zimmermann, G. R., Jenison, R. D., Wick, C. L., Simorre, J-P., & Pardi, A. (1997) Interlocking Structural Motifs Mediate Molecular Discrimination by a Theophylline-Binding RNA. Nature Structure Biology 4, 644- 649. Zuker, M. (1989) On Finding all Suboptimal Foldings of an RNA Molecule. Science 244, 48-52. 236 Vita Joseph Chacko Manimala was born in Kerala, India on February 22, 1979, the son of Chacko Kurian Manimala and Chinnamma Chacko Manimala. After completing grade school at Roosevelt high school, Yonkers, New York, he attended Rensselaer Polytechnic Institute in fall 1996. During his stay there, he worked in professor Dordick's lab. He obtained his Bachelor of Science degree in Biochemistry/ Biophysics in May 1999. In August 1999, he entered the Graduate School of the University of Texas. Permanent address: 2450 Wickersham Ln. #104, Austin, TX, 78741 This dissertation was typed by the author. 237

Find millions of documents here - Study Guides, Homework Solutions, Papers, Exam Answer Keys and more. Course Hero has millions of course related materials that will enable you to learn better, faster and get an A in all your courses.
Below is a small sample set of documents:

doppmanngw026.pdf
Path: Texas >> DOPPMANNGW >> 026 Fall, 2009

guajardoma026.pdf
Path: Texas >> GUAJARDOMA >> 026 Fall, 2009
martinezvm029.pdf
Path: Texas >> MARTINEZVM >> 029 Fall, 2009
brownsonab029.pdf
Path: Texas >> BROWNSONAB >> 029 Fall, 2009
lambertg36961.pdf
Path: Texas >> LAMBERTG >> 36961 Fall, 2009
aljuaiedma042.pdf
Path: Texas >> ALJUAIEDMA >> 042 Fall, 2009
decastropj029.pdf
Path: Texas >> DECASTROPJ >> 029 Fall, 2009
cathrodl77285.pdf
Path: Texas >> CATHRODL >> 77285 Fall, 2009
mcglohenmk042.pdf
Path: Texas >> MCGLOHENMK >> 042 Fall, 2009
lansdellcp029.pdf
Path: Texas >> LANSDELLCP >> 029 Fall, 2009
stuberja80926.pdf
Path: Texas >> STUBERJA >> 80926 Fall, 2009
canterar35023.pdf
Path: Texas >> CANTERAR >> 35023 Fall, 2009
chatellemb042.pdf
Path: Texas >> CHATELLEMB >> 042 Fall, 2009
shackmanlc042.pdf
Path: Texas >> SHACKMANLC >> 042 Fall, 2009
complexity.txt
Path: CSU San Bernardino >> CS >> 330 Fall, 2009
okazakit51686.pdf
Path: Texas >> OKAZAKIT >> 51686 Fall, 2009
bamfordw82161.pdf
Path: Texas >> BAMFORDW >> 82161 Fall, 2009
russellr74662.pdf
Path: Texas >> RUSSELLR >> 74662 Fall, 2009
lab9.pdf
Path: CSU San Bernardino >> CS >> 201 Fall, 2009
mukadama15106.pdf
Path: Texas >> MUKADAMA >> 15106 Fall, 2009
kellerkm71167.pdf
Path: Texas >> KELLERKM >> 71167 Fall, 2009
oxfordwt32223.pdf
Path: Texas >> OXFORDWT >> 32223 Fall, 2009
bennettl81291.pdf
Path: Texas >> BENNETTL >> 81291 Fall, 2009
engelas504835.pdf
Path: Texas >> ENGELAS >> 504835 Fall, 2009
curranma71134.pdf
Path: Texas >> CURRANMA >> 71134 Fall, 2009
stanleyk74304.pdf
Path: Texas >> STANLEYK >> 74304 Fall, 2009
protsenkode026.pdf
Path: Texas >> PROTSENKOD >> 026 Fall, 2009
Chapter07.outline.pdf
Path: Concordia NE >> PHYS >> 110 Fall, 2009
rutherfordg022.pdf
Path: Texas >> RUTHERFORD >> 022 Fall, 2009
auerbachs13838.pdf
Path: Texas >> AUERBACHS >> 13838 Fall, 2009
dechapanyaw029.pdf
Path: Texas >> DECHAPANYA >> 029 Fall, 2009
shoemakerdb042.pdf
Path: Texas >> SHOEMAKERD >> 042 Fall, 2009
johnsonam71217.pdf
Path: Texas >> JOHNSONAM >> 71217 Fall, 2009
sampselld77810.pdf
Path: Texas >> SAMPSELLD >> 77810 Fall, 2009
complex.txt
Path: CSU San Bernardino >> CS >> 330 Fall, 2009
cadenheadjk046.pdf
Path: Texas >> CADENHEADJ >> 046 Fall, 2009
benjaminsmr042.pdf
Path: Texas >> BENJAMINSM >> 042 Fall, 2009
simpsonal13317.pdf
Path: Texas >> SIMPSONAL >> 13317 Fall, 2009
hamiltont84490.pdf
Path: Texas >> HAMILTONT >> 84490 Fall, 2009
kotrlaka518287.pdf
Path: Texas >> KOTRLAKA >> 518287 Fall, 2009
harrisont86130.pdf
Path: Texas >> HARRISONT >> 86130 Fall, 2009
brandonjc99738.pdf
Path: Texas >> BRANDONJC >> 99738 Fall, 2009
MATH107A46024536.doc
Path: MD University College >> ASIA >> 2092 Fall, 2009
crawforda65881.pdf
Path: Texas >> CRAWFORDA >> 65881 Fall, 2009
achacosom07761.pdf
Path: Texas >> ACHACOSOM >> 07761 Fall, 2009
jarroldwl86380.pdf
Path: Texas >> JARROLDWL >> 86380 Fall, 2009
sharyginany026.pdf
Path: Texas >> SHARYGINAN >> 026 Fall, 2009
goncalvesac026.pdf
Path: Texas >> GONCALVESA >> 026 Fall, 2009
zieglerkj47418.pdf
Path: Texas >> ZIEGLERKJ >> 47418 Fall, 2009
burtnerjc90760.pdf
Path: Texas >> BURTNERJC >> 90760 Fall, 2009
alvarezla07232.pdf
Path: Texas >> ALVAREZLA >> 07232 Fall, 2009
MATH012A46124534.doc
Path: MD University College >> ASIA >> 2092 Fall, 2009
bonningew86532.pdf
Path: Texas >> BONNINGEW >> 86532 Fall, 2009
CMIS141AA44024445.doc
Path: MD University College >> ASIA >> 2092 Fall, 2009
CMIS102AA42086692.doc
Path: MD University College >> ASIA >> 2088 Fall, 2009
STAT200A42186896.doc
Path: MD University College >> ASIA >> 2088 Fall, 2009
kulkarnis86095.pdf
Path: Texas >> KULKARNIS >> 86095 Fall, 2009
chapmanbg60287.pdf
Path: Texas >> CHAPMANBG >> 60287 Fall, 2009
slattonkc78713.pdf
Path: Texas >> SLATTONKC >> 78713 Fall, 2009
michalskylo026.pdf
Path: Texas >> MICHALSKYL >> 026 Fall, 2009
batemanmt33508.pdf
Path: Texas >> BATEMANMT >> 33508 Fall, 2009
lodowskid97061.pdf
Path: Texas >> LODOWSKID >> 97061 Fall, 2009
raichlend29983.pdf
Path: Texas >> RAICHLEND >> 29983 Fall, 2009
perkinsjd44616.pdf
Path: Texas >> PERKINSJD >> 44616 Fall, 2009
mehdiabadinj026.pdf
Path: Texas >> MEHDIABADI >> 026 Fall, 2009
borisovasa86653.pdf
Path: Texas >> BORISOVASA >> 86653 Fall, 2009
Abuhakema504399.pdf
Path: Texas >> ABUHAKEMA >> 504399 Fall, 2009
hw03_solution.doc
Path: Penn State >> ME >> 581 Fall, 2009
oestreichj19588.pdf
Path: Texas >> OESTREICHJ >> 19588 Fall, 2009
evstatieve01477.pdf
Path: Texas >> EVSTATIEVE >> 01477 Fall, 2009