Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more.
Course Hero has millions of course specific materials providing students with the best way to expand
their education.
Below is a small sample set of documents:
Berkeley - ASTRO - 00337115
Version: 2.3 (Tue Dec 16 07:38:23 UTC 2008)Using 346 Counts, Exposure [s]= 36223.45XRT/DSS Frame Offset: RA -0.200 , Dec 0.900 , 90% Conf. Error: 0.990Using 10 X-ray Sources and 7 DSS SourcesDSS Refined RA, Dec: 21 52 27.95 -33 50 07.1 ; 90% C
Berkeley - ASTRO - 00331475
Version: 0.7 (Thu Oct 16 05:16:04 UTC 2008)Using 12 Counts, Exposure [s]= 16135.11XRT/DSS Frame Offset: RA 1.400 , Dec -3.700 , 90% Conf. Error: 7.030Using 3 X-ray Sources and 1 DSS SourcesDSS Refined RA, Dec: 02 00 50.07 -17 38 02.9 ; 90% Con
George Mason - SYLLSUMMER - 03
PSYCHOLOGY 301(C01) Research Methods in Psychology SUMMER 2003 INSTRUCTOR: MTW 9:30-11:20 am Dr. Patricia Wanschura Office: David-King 2020 Phone: 703-993-4118 Email: pwanschu@gmu.edu Office hours: LAB: M 12:30- 1:30 pm; M 4:00-4:30 pm (through 7/23)
George Mason - SYLLFALL - 05
PSYC 890 Clinical Psychology Professional Seminar Fall 2005 Mondays 3:00 4:15 at Clinic Instructor: Office: Office Hours: Office Phone: Email: Web: Dr. Jerome Short David King 2045 12:00 - 2:00 Wednesdays 703-993-1368 jshort@gmu.edu http:/mason.gmu
Berkeley - ASSIGNMENT - 201
Evaluation of Alicia Cohn's Master's ProjectThe UV-Tube as an Appropriate Water Disinfection Technology:An Assessment of Technical Performance and Potential for DisseminationER 201 Josiah Johnston, 9/26/071Location(s)2UV-Tube Design3
Berkeley - PS - 298
EEP 118, Intro Applied Econometrics Problem Set 2Josiah Johnston September 30, 20081. Describe the dataThe data analyzed in this problem set was composed of survey results from 556 Mexican poor rural households. It included data on expenses, hou
Berkeley - ARE - 298
EEP 118: Introductory Applied Econometrics Research Idea Josiah Johnston October 7, 2008 Does job creation decrease rates of violent crime? Although violence is not the biggest killer in most societies when compared to disease, it is one of the most
Berkeley - ARE - 298
- log: /Users/josiah/Berkeley/2008.3.Fall/EEP118/HW4/Johnston.EEP118.HW4.txt log type: text opened on: 23 Sep 2008, 07:13:58. * Show the current directory. pwd/Users/josiah/Berkeley/2008.3.Fall/EEP118/HW4/. . /*/. * Read in the data from a
Berkeley - HW - 298
- log: /Users/josiah/Berkeley/2008.3.Fall/EEP118/HW4/Johnston.EEP118.HW4.txt log type: text opened on: 23 Sep 2008, 07:13:58. * Show the current directory. pwd/Users/josiah/Berkeley/2008.3.Fall/EEP118/HW4/. . /*/. * Read in the data from a
Berkeley - ARE - 298
- log: /Users/josiah/Berkeley/2008.3.Fall/EEP118/DummyVariableTests/log.txt log type: text opened on: 20 Oct 2008, 16:20:21. insheet using "4classes.csv"(8 vars, 5999 obs). sum Variable | Obs Mean Std. Dev. Min
Berkeley - PS - 298
CountryGDPpcCO2pcBangladesh384.697287Brazil3891.899350China1323.1416105Germany23560.405267India546.1295334Japan38235.984269Nigeria409.3428924United States36274.938561
Berkeley - ASSIGNMENT - 201
ER 201, Assignment 1Josiah Johnston, September 24, 2007I reviewed Alicia Cohn's Masters project, "The UV-Tube as an Appropriate Water Disinfection Technology: An Assessment of Technical Performance and Potential for Dissemination." The readers we
Berkeley - PROP - 13
Fiscal Constraint and Fiscal Adaptation:30 years experience grappling with wicked problems John KirlinExecutive Director Delta Visionjohn.kirlin@resources.ca.gov1Wicked problems Wicked problems: Value conflicts Uncertainty and conflict re c
Berkeley - PROP - 13
Proposition 13 and California's Public SchoolsJon Sonstelie, UC Santa Barbara Proposition 13 at 30 June 6, 2008Current Expenditures on Elementary and Secondary Education per Student, 1976-2005 9,000 Expenditures per Student (2005 $) 8,000 7,000 6,
Berkeley - P - 023
"1CS-1","1CS-1""1CS-2","1CS-2""1CS-3","1CS-3""1CS-4","1CS-4""1E-35","1E-41""1E-41","1E-41""1E-42","1E-42""1E-43","1E-43""1E-44","1E-44""1E-45","1E-45""1E-55","1E-55""1E-56","1E-55""1E-57","1E-55""1E-58","UNASSIGN""1E-59","1E-55""1ES-1"
Berkeley - P - 04
"1100","0001100""1101","0001101""1102","0001102""1103","0001103""1104","0001001""1105","0001001""1106","0001106""1107","0001107""1108","0001002""1109","0001003""1110","0001110""1111","0001004""1112","0001112""1113","0001113""1114","0001
Berkeley - P - 041
"1100","0001100""1101","0001101""1102","0001102""1103","0001103""1104","0001001""1105","0001001""1106","0001106""1107","0001107""1108","0001002""1109","0001003""1110","0001110""1111","0001004""1112","0001112""1113","0001113""1114","0001
Berkeley - PRESENTATI - 2001
Aerodynamic Forces on TrucksThe loads on a single truck as a function of yaw angle and tractortrailer gap spacing. The drag of two trucks in tandem at zero yaw. M. Hammache & F. Browand Ground Vehicle Aerodynamics Lab WindTunnel Truck Model
Berkeley - BIRS - 04
BIRS Workshop Statistical Science for Genome Biology August 14-19, 2004Organizers: Jenny Bryan (University of British Columbia, Statistics) Sandrine Dudoit (UC Berkeley, Biostatistics) Mark van der Laan (UC Berkeley, Biostatistics and Statistics) Th
Berkeley - ME - 221
LuGuardian LuGuardian ". a RFID-enabled solution that assists the airline industry in managing and tracking passenger luggage in a secure, precise, and minimally intrusive manner." Features and Benefits Security o 128 bit Encryption o Daily change o
Berkeley - CS - 267
CS 267 Applications of Parallel Computers Lecture 9: Split-C James Demmelhttp:/www.cs.berkeley.edu/~demmel/cs267_Spr99CS267 L9 Split-C Programming.1Demmel Sp 1999Comparison of Programming Models Data Parallel (HPF) Good for regular applica
Berkeley - CS - 267
CS 267 Applications of Parallel Computers Lecture 10: Sources of Parallelism and Locality James Demmelhttp:/www.cs.berkeley.edu/~demmel/cs267_Spr99CS267 L10 Sources of Parallelism.1Demmel Sp 1999 Machine modelsRecap: Parallel Models and Mach
Berkeley - ICT - 4
Design, Prototyping, and Evaluation in Developing CountriesJen Mankoff, Assistant Professor EECS1What is human computer interaction about? Creating applications that provide needed services to clients in acceptable ways Supporting specific goal
Berkeley - CS - 294
Towards a Common API for Structured PeertoPeer Overlays Frank Dabek, Ben Zhao, Peter Druschel, John Kubiatowicz, Ion StoicaPresented for Cs2944 byBenjamin Poon 1Outline Background Motivation API Specification Example Usage Exampl
Berkeley - CS - 252
CS252 Graduate Computer Architecture Lecture 8 Instruction Level Parallelism: Getting the CPI < 1September 27, 2000 Prof. John Kubiatowicz9/27/00CS252/Kubiatowicz Lec 8.1Review: Reorder Buffer (ROB) Use of reorder buffer In-order issue, Out-
Berkeley - CS - 152
Alternative datapath (book): Multiple Cycle Datapath Miminizes Hardware: 1 memory, 1 adderPCWr PCWrCond Zero IorD MemWr IRWr32 32 32 32 0 1 32 32 RAdr Rs 32 Rt 5 5 0 1PCSrc RegDst RegWr ALUSelA1 0 32 32MuxPC MuxZero ALU Out ALUInstructi
Berkeley - CS - 294
Practical Byzantine Fault ToleranceMiguel Castro and Barbara Liskov MITPresented to cs294-4 by Owen CooperThe problemProvide a reliable answer to a computation even in the presence of Byzantine faults. A client would like to Transmit a r
Berkeley - CS - 294
WhatCanDatabasesDofor PeertoPeerStevenGribble,AlonHalevy, ZacharyIves,MayaRodrig,DanSuciu Presentedby:RyanHuebsch CS2944P2PSystems11/03/03 OutlineDisclaimer:Thisisapositionpaper,not atechnical/systempaper(nographs) AuthorsMindset DataPlacement
Berkeley - MATH - 55
Math 55 - Fall 07 - Lecture notes # 13 - Sep 28 (Friday) Goal for today: Recall definition of division algorithm, mod Application: Modular arithmetic Application: How computers do integer arithmetic
Berkeley - MATH - 55
Math 55 - Spring 2004 - Lecture notes # 3 - Jan 27 (Tuesday) Keep Reading: Sections 1.6, 1.7 and 1.8 Homework: section 1.6: 8, 12, 16, 22 section 1.7: 4, 26, 38, 40 for sets {2,4,6,8} and {1,3,5,7} section 1.8: 6, 16, 22,
Berkeley - SS - 2012
Kuali Student Service SystemRelease 1 Scope Document- DRAFT DOCUMENT For Discussion PurposesVersion 1.0Prepared for: Kuali Functional Council Kuali Student Service System Board July 8, 20081Document Information and Revision HistoryDocument
Berkeley - SS - 2012
Project Status ReportA. General InformationProvide detailed explanations of current activity and plans for on-time, on-budget delivery of the project objectives. Schedule Status: Green: The project will complete on time. Yellow: The project has inc
Berkeley - SS - 2012
BERKELEY: OFFICE OF THE VICE CHANCELLOR FOR STUDENT AFFAIRSSeptember 18, 2006 Vice Chancellor Brostrom Vice Provost Maslach Dean Mason RE: Student Systems 2012 Executive Governance Committee Dear Colleagues, As you are aware, the Campuswide Informa
Berkeley - DATA - 247388
CTAAGACGCTAAGACGCTAAGACGCTAAGACTTTAAGACGTTAAGACACTTAGACTCTTAGACTCTTAGCCGCTTAGCCGCTTAGCCGTTAAGGCGTTAAGGCATTAAGGCATTAAGGCACTAAGCCCCTTAAACTCTTAGAAACTAAGCGCCTAAGGGCTTAAGCTG
Berkeley - DATA - 247388
Consensus for Zeste:YGAGYG
Berkeley - DATA - 247388
Motif for Engrailed:AATTATGATTGTTTAATGGCCGGCTAATGAGCGGCTAATTTGGCGTTCCAGAGCC
Berkeley - DATA - 247388
Consensus for Dorsal:RRAAATCCC
Berkeley - DATA - 247388
Motif for Pleiohomeotic:TAGCCATGTTGGACAGCCATCTCGCTTAGCCATTGGCGGCGGCCATTGCGGG
Berkeley - DATA - 247388
Motif for Hairy:ACACGCGCGGCACGCCCCGCACGCCCGTCTCGCGAC
Berkeley - DATA - 247388
Consensus for Buttonhead (Sp1):GGGGCGGGG
Berkeley - SUNSITE - 3
METS and IMS-CPConvergence and DivergenceRick Beaubien UC Berkeley LibraryWhat is METS? Metadata Encoding and Transmission Standard An XML schema-based specification for encoding "hub" documents for materials whose content is digital.Hub do
Berkeley - SUNSITE - 3
1/3/06 Software used: Freely downloadable software is marked accordingly.Window based:SQL Server 2000 Office 2000 in particular Access and ExcelUnix based:Tomcat Other servelet engines can be used, however we have been version 5.5.9 http:/tomc
Berkeley - SUNSITE - 3
WebGenDB Fields Master ListRevised 02/25/08 Last change: MODS and EAD exports updated, particularly for _ebx and their parallel fields *Note: fields in red are recommended for deprecation. Do not include these in PM field select list. Note: fields i
Berkeley - SUNSITE - 3
SEAN 20/male/single Personal Background: Sean is a reporter for the Daily Californian. Well, that is what he wants to be, right now he is working on reviews only. Soon he hopes to change that and work on the news desk. Sean worked on his high school
Berkeley - SUNSITE - 3
JOSEPH 28/male/married Personal Background: Joseph who likes to be called Joe by his friends says it is because his Dad is called Joseph and so he was always called Joe at home. One of the greatest things Joe has learned at UC Berkeley is political a
Berkeley - SUNSITE - 3
ANDREW 19/male/single Personal Background: Andrew surprises most people when they learn that he is on the UC Berkeley Cross-Country team. He was consistent all through high school and he has the potential to be among the team's leaders this year. Coa
Berkeley - SUNSITE - 3
PROFESSOR LAURA SNOW 34/female/married Personal Background: Assistant Professor Laura Snow came to the Haas School's Organizational Behavior and Industrial Relations group by way of the University of Arizona's Eller School, where she taught for three
Berkeley - SUNSITE - 3
Professor Elliot 38/female/marriedPersonal Background: Professor Elliot just came to UC Berkeley from the University of Michigan at Ann Arbor. She actually did her undergraduate work at Berkeley so it happy to be back. She is enjoying the campus an
Berkeley - SUNSITE - 3
PROFESSOR JACK ROSENBERG 35/male/single Personal Background: Professor Rosenberg works in the Robotics and Intelligent Machines Laboratory. His major research interest is human-machine and human-computer interaction, especially in medicine and surger
Berkeley - SUNSITE - 3
PROFESSOR GREG STEWART 60/male/married Personal Background: Professor Stewart is a Professor of Mathematics at the University of Warwick in England. In the past he has only visited the area while on vacation, but he is thrilled that he has a chance t
Berkeley - SUNSITE - 3
AUDREY 28/female/single Personal Background: Audrey is currently working at the library and has been for most of her time at UC Berkeley. She enjoys working on campus as it makes doing the rest of her work that much easier as she doesnt have to add t
Berkeley - SUNSITE - 3
PING 20/female/singlePersonal Background: Ping is pre-law and it has been her ambition for years to be a lawyer. Her family has done everything they could to support her and she appreciates it. She is enjoying the classes she has taken, but can har
Berkeley - SUNSITE - 3
ROY 24/male/single Personal Background: Roy has a passion for film. He loves to talk about his latest favorite film, the directors that he thinks embodies the best and the greatest, and books that have come out that discuss film. Sometimes his friend
Berkeley - SUNSITE - 3
February 16, 2007 This document describes the automatic generation of METS and EADs through GenDB and GenX. These processes are similar in many ways, and for simplicity, I have referred to METS when the processing a METS and the processing an EAD coi
Berkeley - SUNSITE - 3
Documentation for tblDigRsc and associated technical metadata tables Last revised: 4/29/2009 tblDigRscColumn name DigRscIdentifier Definition Designation that uniquely identifies the digital resource. Currently in our case an ark. Supported Values [
Berkeley - SUNSITE - 3
Top Level/Frontmatter Finding Aid Fields mapped to GenDBNotes: GenDB Fieldname entries appearing in red represent new fields from the user interface standpoint. DB Table/Column entries represent new columns that would need to be defined in the datab
Berkeley - SUNSITE - 3
EAD version 2002 GenDB Fieldname tags: mainagency OwnersIdentifier code= <filedesc> <titlestmt> <titleproper> <titleproper> type="filing" <author> FindAidTitle.TitleGenDB Table/Column tblObject/OwnersIdentifier tblAltTitle/Title (tblAltTitle/Type =
Berkeley - SUNSITE - 3
ROLE="Added Entry" ROLESOURCE="local" ENCODING="700" SOURCE="local">ROLE="creator" ROLESOURCE="naf" RULES=" SOURCE="naf">Includes Front Matter
Berkeley - SUNSITE - 3
Please make all checks and money orders payable to UC Regents, earmarked for the Emma Goldman Papers. Proceeds will benefit the ongoing work of the project. Send your payment and this order form to: The Emma Goldman PapersUC Berkeley2372 E
Berkeley - SUNSITE - 2
This is a complete list of the changes beta2v1 makes duringconversion.1. Lowercase all element and attribute names. Non-CDATA attribute values are also folded to lowercase. 2. New version 1 DOCTYPE declaration substituted for the beta v