Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more.
Course Hero has millions of course specific materials providing students with the best way to expand
their education.
Below is a small sample set of documents:
CSU Fullerton - PRJ - 566
PRJ566 Project Planning and ManagementWork Breakdown Structure: Resources & Dependencies1Agenda Defining Activities/Tasks Resources Dependencies Tracking your ProjectDefining ActivitiesTop DownStart at a goal (activity) level and
CSU Fullerton - PRJ - 566
PRJ566 Project Planning & ManagementNetwork Diagrams & Critical PathAgenda Where are we? Identifying Dependencies Critical PathWhere are we? Identified work breakdown structure (WBS) activities and tasks Estimated tasks Assigned resou
CSU Fullerton - PRJ - 566
PRJ566: Project Planning and ManagementCost Benefit AnalysisAgenda What is cost benefit analysis? The process Examples identifying costs and benefitsWhat is cost benefit analysis?Shows the benefit or return the project will bring to
CSU Fullerton - PRJ - 566
PRJ566 Project Planning and ManagementProject SelectionAgenda System Selection Team Selection Project Requirements Other course requirements FormsSystem SelectionSelect a computer system that you see a need for You are encouraged to
CSU Fullerton - PRJ - 566
PRJ566 Project Planning & ManagementCritical Path in MSProjectAgendaCritical PathCritical PathFortunately MSProject automatically calculates the Critical Path. Once you know which tasks are on the Critical Path, you can track these tasks v
Western Kentucky University - PHYS - 301
Physic 301 Laboratory Worksheet Lab 4 Name:_ Exercise 2.1 Step 6. Values of 10k_, Thermistor_Calculate the relative % relative error ( 10k.) forStep 7. Value of Thermistor after long contact with body __ Assume that your body temperature is 37
Western Kentucky University - BIO - 113
Tutoring Resources for StudentsThe Learning Center At TLC, peer tutors provide WKU students with FREE tutoring and study skills help. Students may drop-in for assistance or make appointments for one-on-one or group tutoring. Our mission is to promot
University of Baltimore - IDIA - 630
Information ArchitectureProcess Overview The Skeleton Plane Session 11Process Overview Strategy Scope Structure Skeleton SurfacePage 33, Chapter 2 The Elements of User ExperienceSkeleton working at the page levelStory boards pages an
University of Illinois, Urbana Champaign - CS - 498
Knowledge Repn. & Reasoning Lec #11+13: Frame Systems and Description LogicsUIUC CS 498: Section EA Professor: Eyal Amir Fall Semester 2004Today Restricting expressivity of FOL: DLs Description Logics (DLs) Language Semantics InferenceDescr
University of Illinois, Urbana Champaign - CS - 101
Perform File I/O using file pointers FILE * data-type Opening and closing files Character Input and Output String Input and OutputRelated Chapters: FER Chapter 15232So far, we have seen that one way to manipulate files in a program is to
University of Baltimore - HIST - 300
HIST 300: Maps Tamara Smith, Reference Librarian Langsdale Library tsmith@ubalt.edu 4108375072 Plan for Today Review: Search Strategy Scholarly vs. Popular Primary vs. Secondary Maps Wrapup Review: Search Strategy If your topic is too
University of Baltimore - IDIA - 630
Information ArchitectureThe Strategy Plane Final ProjectAudience driven evolutionary changes to a PlainLanguage.gov website Deliverables for Plain Language Government employees Academicians Press Critics Heuristic analysi
Rosalind Franklin University of Medicine & Science - COMM - 320
7532 Pateo Pass Dr. Blacklick, OH 43004 March 15, 2009 Mr. Seth Doe Manager Brio Tuscan Grill 3993 Easton Station Columbus, OH 43219 Dear Mr. Doe: Last month we had a critical issue with your bar area service and multiple bogus charges being placed o
University of Texas - CH - 318
Exam II will cover chapters 15-18, inclusive, but only 15.1 and 15.2!Extra Office Hours Today and Monday (3-4:30 pm in both cases)Recommended Problems (new): EVERYTHING IN CH 17!But if pressed for time, start with:Recommended Problems (new): EV
UCLA - CS - 240
Knowledge discovery & data miningAssociation rules and market basket analysis-introductionUCLA CS240A Course Notes*_ *froma EDBT2000 tutorial byFosca Giannotti & Dino Pedreschi Pisa KDD Lab1Market Basket Analysis: the contextC ustom r buyin
N.E. Illinois - BUS - 3500
Lumpkin College of Business and Applied Sciences School of Business BUS 3500 004 Management Information Systems Fall 2006 Instructor: Dr. Karen Ketler Lumpkin Hall 4012 (217) 581-6906 E-Mail Address: cfkjk@eiu.edu Website: www.ux1.eiu.edu/~cfkjk 1:4
UCLA - CACHE - 9002
Sheet1 Volume MGN_9002 Magellan Radio Science Experiment Original Data Records (ODR) Solar Wind Scintillation and Faraday Rotation Experiments Planetary Plasma Interactions Node of the Planetary Data System Err:510 Introduction Err:510 This disk cont
Berkeley - CS - 150
Tentative extra credit point assignments Please note that your TA has full authority to award (or not award) extra credit points. Early demo Cool graphics Customized sound Magic Move up Cut line Cut upper half Shorten block Lengthen block Both shorte
Bates - PSYC - 101
Learning PSYCH 101 Learning What is learning? Learning is a relatively permanent.Classical Conditioning o Classical conditioning is _ learning. o The name to know here is. o More terms: Generalization = Discrimination = Extinction = Spontan
UCSD - MATH - 170
Instructor: Emre MengiMath 170A (Winter 2009)Study Guide for Week 9 Homework 8 concerns the topics listed below. Denitions of eigenvalues, eigenvectors and eigenspaces (section 5.2) Basic facts concerning eigenvalues and eigenvectors; some of th
San Diego State - EDTEC - 570
There are 34 file(s) associated with this project Download FilesDesigning WomenProject DetailsTitle: Designing Women Collaborators: Kerry Rice, Annette Wall, julian riley, Kathleen Evans, Julie Lind, Katie Ingram Grade level: elementary (K-6) Rec
Allan Hancock College - COMP - 8400
COMP8400: AlgorithmsandTechniques forDataMiningMoreondatalinkageLectureoutlineProbabilisticdataorrecordlinkageRecordpaircomparison Recordpairclassification Linkageexample:Monthofbirthweightcalculation ValuespecificmatchingweightsWhyblocking/in
San Diego State - CS - 696
Your attention, pleaseTao posted two Matlab programs online (under Project Description link). From Sample Simulation Code for Greedy and SP algorithms code, you can learn (1) how to simulate a disk array; and (2) how to simulate other peoples algori
Whitman - M - 244
Chapter 3 Sample Questions These are not meant to be comprehensive, they are meant to give you questions out of the context of any particular section of the textbook. Be sure you understand the homework problems and quiz questions. The following trig
FIU - COP - 3337
965102108130134143145192200230253261322326326335424525630651743746781830108610991239147915491561158716631694170417161732174018021805182918391845184819131916198219932031205821652174219522002229229
George Mason - SWE - 622
Interprocess Communications1Interprocess Communications---Exchange of data between two or more separate, independent processes/threads. Operating systems provide facilities/resources for interprocess communications (IPC), such as message q
George Mason - ISE - 432
< HTML>< HEAD>< TITLE>SWE 432 JavaScript example: Expanding Table< /TITLE>< LINK REL=STYLESHEET HREF="././432-style.css" TYPE="text/css"> < STYLE> BODY {BACKGROUND-IMAGE:URL(http:/www.ise.gmu.edu/faculty/ofut/image/blgr036.jpg)} A:hover {back
Haverford - CMSC - 105
#include <iostream.h>#include <logic.h>/ return true iff i is evenbool even(int i){return i%2 = 0; / true if the remainder of i/2 is 0}double power(double x, int y){precondition(y >= 0);if (y = 0){return 1;}else if (even(y)
UCF - PHY - 4605
Homework 8 PHY 4605 Due Wednesday, March 29 1. Libo, Problem 12.16 2. Libo, Problem 12.19 3. Libo, Problem 12.25 4. Libo, Problem 12.281
Binghamton - CS - 220
CS 220: Computer Systems II: Architecture and ProgrammingSpring 2007 - Section 90Quiz #2 - 2007/02/28 Name: _=1:Circle which of the flags (it can be any number of them) listedunder each set of numbers will be set (to 1) after each pair
George Mason - SCS - 656
CSI 656/EVPP 652/GEOG 570 August 26, 2002 Home Work Set #1 Problem 1. Energy Balance model of global radiational temperature (Dingman, Box 3-1 page 39).This is so called zero dimension energy balance model of the temperature of the earth-atmosphere s
George Mason - NCLC - 249
Kevin Dale 5/1/09 Changing Face of InfromationOver the past ten years our society has changed the way it views information on the Internet. The first use of the Internet was to have a secure, reliable way to pass information from one point to anoth
Northwestern State University of Louisiana - CHM - 10098
Molcules X23 u 1 g2 pB1 g 3 u2 pA 2 pB3 g 1 u 2 u2 pA1 u 3 g 2 u2sB2s A2sB2s A2 g1 u 1sB 1s A 1sB2 g1 u 1s A1 g1 gMolcules X2 Ordre de liaison: (ou indice de liaison)1 n = (nliant - nantiliant ) 2Exemples:2 2 2 Li2 1
TCU - COSC - 20203
Cocs 20203 Techniques in Programming:applications in JavaPlease note that the material discussed here is not in the TextbookExpressionsAntonio Sanchez Spring 20091String processing:Scanning and parsing Scanner: translate input characters
TCU - P - 20073
Fall 2007 Dr Mike Fanelli Hints to Assigned Problems: Chapter 7PROBLEM 7-2: You are asked to change the average density of the Earth to 3000 kg/m3 from its actual value, 5500 kg/m3, and then determine the effect this change would have on the escape
Bentley - ML - 101
FRENCH FOR COMMUNICATION I (ML 101-001 and 002) FALL 2000Modern Languages 101 French for Communication IProfesseur Jacques Georges Morison 117 x2437 E-mail: jacquesrgeorges@yahoo.com Office hours:French for Communication I is for students with
TCU - P - 10164
Physics 10163 & 10164 Spring 2008 Quiz 9 Solutions1. In a single slit diffraction experiment as the width of the slit is made smaller, how will the width of the central maximum change ? Assume that the light illuminating the slit is monochromatic.
Purdue - STAT - 301
Lecture 9, Chapter 12 One-Way Analysis of Variance:It is always interesting to compare data (salaries of women and men, responses to different treatments in a clinical trial). We have learned to display comparisons with back to back stemplots and si
TCU - P - 20073
Telescope "Powers"Light Gathering "Power" Telescopes can be considered as light "buckets" collectors of electromagnetic radiation across the entire spectrum. Larger telescopes collect more light in the same amount of time. The light collecting "
George Mason - CEIE - 360
Chapter 8 Part I Travel Demand and Traffic ForecastingFrom: Principles of Highway Engineering and Traffic Analysis Third Edition Fred Mannering, Walter Kilareski and Scott WashburnTravel Demand & Traffic ForecastingNecessary understand th
U. Houston - CUIN - 6345
Jalanta WallerCUIN 6345 Social, Legal, Ethical, Human IssuesFocus Group #6Social Impact of Limited Technology Availability For Students and Families with Limited ResourcesSocial Issue: Disadvantaged Students and Families Impact: There are many
U. Houston - CUIN - 3111
What Do We Know About Texas?By: Julie Martinth 113.6 Social Studiesth4 Grade TEKS Objectives: (4.1) History: The Student understands the similarities and differences of Native American groups in Texas. (4.5) History: The Student understa
Clayton - PROJECT - 210
Surrealist languageSurrealism and poetry, dreams that have been recorded. May 6, 1998 class outline Introduce Surrealism language What is surrealism? What are the characteristics of Surrealism poems? What is the purpose of Surrealist
U. Houston - COE - 3112
Technology-Enhanced Lesson Support FiveUsing Digital Cameras, Scanned Images and the Internet1. Description of the Support:Students can use this lesson support to elaborate on any given topic. This example was used to demonstrate the different sh
U. Houston - CUIN - 3111
WAY Way too many technical errors! The amount of grammergrammar and usage error's today is astounding. Not to mention spelling. If I was a teacher, I'd I would feel badly that less and less fewer students seem to understand the basic principals of
U. Houston - KMOORE - 3111
WAY Way too many technical errors! The amount of grammergrammar and usage error's today is astounding. Not to mention spelling. If I was a teacher, I'd I would feel badly that less and less fewer students seem to understand the basic principals of
U. Houston - CUIN - 3112
*Unit Plan Template Unit AuthorFirst and Last NameUnit Overview CurriculumFraming QuestionsKasey L. MooreEssential Question Unit Questions Content QuestionsUnit Title Unit SummaryWho are some of the most famous scientists known today? Wh
U. Houston - KMOORE - 3112
*Unit Plan Template Unit AuthorFirst and Last NameUnit Overview CurriculumFraming QuestionsKasey L. MooreEssential Question Unit Questions Content QuestionsUnit Title Unit SummaryWho are some of the most famous scientists known today? Wh
Allan Hancock College - INFS - 3200
INFS3200/7907 Advanced Database SystemsSolution Tutorial 1: Distributed Database DesignSemester 1, 2007 Question 1:Given the following relation and the predicates p1: Pos < 4, p2: Pos > 4 EventID SwM100Free SwM100Free SwM100Free SwM100Free Shotpu
East Los Angeles College - CL - 0405
Business Studies 2003 Paper 7 Question 12 Describe three criteria a UK patent must exhibit. [3 marks] A UK patent must be - Novel. The invention described must be new, and not an obvious adaptation of something already known, or made public in any wa
U. Houston - CS - 1304
C ProgrammingStructures and UnionsStructure User-defined data type Grouping of related data that makes programming easier Begins with a structure definition Uses the keyword structmain() { struct { char initial; /* last name initial */ int
ETSU - CSCI - 5230
Course Scheduling SystemCHOOSING THE BEST WBS TEAM TRIANGLEOur Project Management TeamChristi Bouldin Zac Lawson Adam Ogle Tyler Osborne David SalazarOverviewScope Statement Software Development Life Cycle Organizational Structure Work Breakdo
ETSU - MATH - 1530
Two-Way Tables from Slaps per Film in the Three Stooges' WorkProbability and Statistics (MATH 1530) Worksheet Gardner and Davidson, Spring 2009 Name: _The purpose of this worksheet is to review some of your Minitab knowledge. In the process, you wi
U. Houston - BTECH - 3301
>Piece of genomic DNA from C. elegansggccgattttgatctttttgaacatttcttcattaaaatttagtggaaaaattttcaaaaattctaagagttaggcattgacctcttctcaagtgtaaagatatatttccagaagactttgatcttttgagaagtatgtgcttaaagctataaaagttttcgaatttcttgcatacccgtcataattctgtaagttttcagttctcttgcact
U. Houston - CUIN - 6378
Rubric: Open-ended Essay (3-2-1) Student C 3 Facts 4 3 Are clearly Is well stated, stated, easily understandable, understandable, shows a good bit shows depth of of understanding understanding of of subject subject matter. matter. Extremely well Well
Cuyamaca College - COMP - 3513
50Assignment Kit #7Assignment description Using the Project Plan Summary form shown in Table 11.2, make a plan for doing the next assignment. First, estimate the program's size as described in Chapter 6. For this program, you will have to guess th
U. Houston - CUIN - 3113
Technology Integration ProjectCUIN 3113 PUMA 2003 Group Members: Andra Ancira Van Nguyen Maggie Ramirez Lan TranStage One: Teacher PlanningMs. Bunting is Lan Tran's mentor teacher. She has worked with our group for this technology integration les
U. Houston - ECE - 4371
Syllabus: ECE4371 Introduction to Telecommunication Engineering/4117 Telecommunication Laboratory, Fall, 2008 Zhu HanInstructor information Office location: Engineering 1 N324 Office hours: Mon. 10:00am-12:00am, Other time including weekend by app
U. Houston - ECE - 6341
ECE 6341 Spring 2009 HW 1 1) Derive the formulas on slides 13 and 14 in Notes 1, for the fields due to Az and Fz. (These results are the same as those given in Eqs. (3-86) and (3-89) in the book, except for differences with a factor of and , respec
Texas Tech - BA - 6337
Name _(5) SSN_(5)ISQS 6337 Fall 98 Exam 1 Please follow all class style guidelines. Hungarian notation, indention, neatness of code, neatness of writing (IF I CAN"T READ IT THEN IT IS WRONG!) simple comments, and correct data type will all count. Y
U. Houston - CUIN - 3111
PARTS OF SPEECH ACTIVITYDirections: Highlight the parts of speech in each of the following sentences to match the legend shown on the right.1. 2. 3. 4. 5. 6. 7. 8. 9. 10. The water in the swimming pool was too cold for her to swim. The small dog