3 Pages

ch3ques

Course: M 244, Fall 2009
School: Whitman
Rating:
 
 
 
 
 

Word Count: 727

Document Preview

3 Chapter Sample Questions These are not meant to be comprehensive, they are meant to give you questions out of the context of any particular section of the textbook. Be sure you understand the homework problems and quiz questions. The following trig formula will be given to you: A cos(t) + B sin(t) = R cos(t - ) where R = A2 + B 2 , tan() = B/A. I will not ask you to compute using Equation (13), p. 212 (Cosine...

Register Now

Unformatted Document Excerpt

Coursehero >> Washington >> Whitman >> M 244

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
3 Chapter Sample Questions These are not meant to be comprehensive, they are meant to give you questions out of the context of any particular section of the textbook. Be sure you understand the homework problems and quiz questions. The following trig formula will be given to you: A cos(t) + B sin(t) = R cos(t - ) where R = A2 + B 2 , tan() = B/A. I will not ask you to compute using Equation (13), p. 212 (Cosine differences). 1. Finish the definition: Functions f, g are linearly independent if: 2. If the W (y1 , y2 ) = t2 , can y1 , y2 be two independent solutions to y + p(t)y + q(t)y = 0? Explain. 3. Construct the operator associated with the differential equation: y = y 2 - 4. Is the operator linear? Show that your answer is true by using the definition of a linear operator. 4. Find the solution to the initial value problem: 3t u + u = 3(2 - t) 0 5. Solve: 2 u + 0 u = F0 cos(t), if 0 t if < t < 2 if t 2 u(0) = 0 u (0) = 0 u(0) = 0 u (0) = 0 if = 0 . (Hint: Probably easiest to use the Method of Undetermined Coefficients) 6. In class, we said that given: 2 u + 0 u = F0 cos(t) u(0) = 0 u (0) = 0 If = 0 , then u(t) = 2 (0 F0 (cos(t) - cos(0 t)) - 2) Show the solution if = 0 two ways: Start over, with Method of Undetermined Coefficients Take the limit of the above expression as 0 . For extra practice with trig integrals, you might also try to find the solution using Variation of Parameters. 7. On Page 208, we see: "The maximum value of R is: Rmax = F0 0 1 - ( 2 /4mk) F0 2 1+ 0 8mk where the last expression is an approximation for small ." Assuming that they've found the maximum correctly, show that the approximation is valid for small (Hint: Think tangent line) 8. Show that the period of motion of an undamped vibration of a mass hanging from a vertical spring is 2 L/g, where L is the elongation of the spring due to the mass and g is the acceleration due to gravity. 9. Consider y + p(t)y + q(t)y = 0. Show that, if u(t) + iv(t) solves the differential equation, then so must u(t) and v(t) separate as functions. (NOTE: If a + ib = 0, then a = 0 and b = 0). Side remark: This exercise is a confirmation that, if the solution to the homogeneous equation is et cos(t) + i et sin(t), then we can use et cos(t) and et sin(t) as the fundamental set. 10. Given that y1 = 1 t solves the differential equation: t2 y - 2y = 0 Find a second linearly independent solution, y2 . 11. Suppose a mass of 0.01 kg is suspended from a spring, and the damping factor is = 0.05. If there is no external forcing, then what would the spring constant have to be in order for the system to critically damped? underdamped? 12. Give the full solution, using any method(s). If there is an initial condition, solve the initial value problem. (a) y + 4y + 4y = t-2 e-2t (b) y - 2y + y = tet + 4, y(0) = 1, y (0) = 1. (c) y + 4y = 3 sin(2t), y(0) = 2, y (0) = -1. N (d) y + 9y = m=1 bm cos(mt) 13. Rewrite the expression in the form a + ib: (i) 2i-1 (ii) e(3-2i)t (iii) ei 14. Find a linear second order differential equation with constant coefficients if y1 = 1 y2 = e-t form a fundamental set, and yp (t) = 1 t2 - t is the particular solution. 2 15. Determine the longest interval for which the IVP is certain to have a unique solution (Do not solve the IVP): t(t - 4)y + 3ty + 4y = 2 y(3) = 0 y (3) = -1 16. Let L(y) = ay + by + cy for some value(s) of a, b, c. If L(3e2t ) = -9e2t and L(t2 + 3t) = 5t2 + 3t - 16, what is the particular solution to: L(y) = -10t2 - 6t + 32 + e2t 17. Show that, using the substitution x = ln(t), then the differential equation: 4t2 y + y = 0 becomes a differential equation with constant coefficients. Solve it. 18. If y - y - 6y = 0, with y(0) = 1 and y (0) = , determine the value(s) of so that the solution tends to zero as t . 19. Without using the Wronskian, determine whether f (x) = xex+1 and g(x) = (4x - 5)ex are linearly independent. 20. Given y + p(t)y + q(t)y = 0, is it always possible to construct a fundamental set of solutions? (Be specific as to how to do it. You might find the Existence and Uniqueness Theorem useful).
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

FIU - COP - 3337
965102108130134143145192200230253261322326326335424525630651743746781830108610991239147915491561158716631694170417161732174018021805182918391845184819131916198219932031205821652174219522002229229
George Mason - SWE - 622
Interprocess Communications1Interprocess Communications---Exchange of data between two or more separate, independent processes/threads. Operating systems provide facilities/resources for interprocess communications (IPC), such as message q
George Mason - ISE - 432
&lt; HTML&gt;&lt; HEAD&gt;&lt; TITLE&gt;SWE 432 JavaScript example: Expanding Table&lt; /TITLE&gt;&lt; LINK REL=STYLESHEET HREF=&quot;././432-style.css&quot; TYPE=&quot;text/css&quot;&gt; &lt; STYLE&gt; BODY {BACKGROUND-IMAGE:URL(http:/www.ise.gmu.edu/faculty/ofut/image/blgr036.jpg)} A:hover {back
Haverford - CMSC - 105
#include &lt;iostream.h&gt;#include &lt;logic.h&gt;/ return true iff i is evenbool even(int i){return i%2 = 0; / true if the remainder of i/2 is 0}double power(double x, int y){precondition(y &gt;= 0);if (y = 0){return 1;}else if (even(y)
UCF - PHY - 4605
Homework 8 PHY 4605 Due Wednesday, March 29 1. Libo, Problem 12.16 2. Libo, Problem 12.19 3. Libo, Problem 12.25 4. Libo, Problem 12.281
Binghamton - CS - 220
CS 220: Computer Systems II: Architecture and ProgrammingSpring 2007 - Section 90Quiz #2 - 2007/02/28 Name: _=1:Circle which of the flags (it can be any number of them) listedunder each set of numbers will be set (to 1) after each pair
George Mason - SCS - 656
CSI 656/EVPP 652/GEOG 570 August 26, 2002 Home Work Set #1 Problem 1. Energy Balance model of global radiational temperature (Dingman, Box 3-1 page 39).This is so called zero dimension energy balance model of the temperature of the earth-atmosphere s
George Mason - NCLC - 249
Kevin Dale 5/1/09 Changing Face of InfromationOver the past ten years our society has changed the way it views information on the Internet. The first use of the Internet was to have a secure, reliable way to pass information from one point to anoth
Northwestern State University of Louisiana - CHM - 10098
Molcules X23 u 1 g2 pB1 g 3 u2 pA 2 pB3 g 1 u 2 u2 pA1 u 3 g 2 u2sB2s A2sB2s A2 g1 u 1sB 1s A 1sB2 g1 u 1s A1 g1 gMolcules X2 Ordre de liaison: (ou indice de liaison)1 n = (nliant - nantiliant ) 2Exemples:2 2 2 Li2 1
TCU - COSC - 20203
Cocs 20203 Techniques in Programming:applications in JavaPlease note that the material discussed here is not in the TextbookExpressionsAntonio Sanchez Spring 20091String processing:Scanning and parsing Scanner: translate input characters
TCU - P - 20073
Fall 2007 Dr Mike Fanelli Hints to Assigned Problems: Chapter 7PROBLEM 7-2: You are asked to change the average density of the Earth to 3000 kg/m3 from its actual value, 5500 kg/m3, and then determine the effect this change would have on the escape
Bentley - ML - 101
FRENCH FOR COMMUNICATION I (ML 101-001 and 002) FALL 2000Modern Languages 101 French for Communication IProfesseur Jacques Georges Morison 117 x2437 E-mail: jacquesrgeorges@yahoo.com Office hours:French for Communication I is for students with
TCU - P - 10164
Physics 10163 &amp; 10164 Spring 2008 Quiz 9 Solutions1. In a single slit diffraction experiment as the width of the slit is made smaller, how will the width of the central maximum change ? Assume that the light illuminating the slit is monochromatic.
Purdue - STAT - 301
Lecture 9, Chapter 12 One-Way Analysis of Variance:It is always interesting to compare data (salaries of women and men, responses to different treatments in a clinical trial). We have learned to display comparisons with back to back stemplots and si
TCU - P - 20073
Telescope &quot;Powers&quot;Light Gathering &quot;Power&quot; Telescopes can be considered as light &quot;buckets&quot; collectors of electromagnetic radiation across the entire spectrum. Larger telescopes collect more light in the same amount of time. The light collecting &quot;
George Mason - CEIE - 360
Chapter 8 Part I Travel Demand and Traffic ForecastingFrom: Principles of Highway Engineering and Traffic Analysis Third Edition Fred Mannering, Walter Kilareski and Scott WashburnTravel Demand &amp; Traffic ForecastingNecessary understand th
U. Houston - CUIN - 6345
Jalanta WallerCUIN 6345 Social, Legal, Ethical, Human IssuesFocus Group #6Social Impact of Limited Technology Availability For Students and Families with Limited ResourcesSocial Issue: Disadvantaged Students and Families Impact: There are many
U. Houston - CUIN - 3111
What Do We Know About Texas?By: Julie Martinth 113.6 Social Studiesth4 Grade TEKS Objectives: (4.1) History: The Student understands the similarities and differences of Native American groups in Texas. (4.5) History: The Student understa
Clayton - PROJECT - 210
Surrealist languageSurrealism and poetry, dreams that have been recorded. May 6, 1998 class outline Introduce Surrealism language What is surrealism? What are the characteristics of Surrealism poems? What is the purpose of Surrealist
U. Houston - COE - 3112
Technology-Enhanced Lesson Support FiveUsing Digital Cameras, Scanned Images and the Internet1. Description of the Support:Students can use this lesson support to elaborate on any given topic. This example was used to demonstrate the different sh
U. Houston - CUIN - 3111
WAY Way too many technical errors! The amount of grammergrammar and usage error's today is astounding. Not to mention spelling. If I was a teacher, I'd I would feel badly that less and less fewer students seem to understand the basic principals of
U. Houston - KMOORE - 3111
WAY Way too many technical errors! The amount of grammergrammar and usage error's today is astounding. Not to mention spelling. If I was a teacher, I'd I would feel badly that less and less fewer students seem to understand the basic principals of
U. Houston - CUIN - 3112
*Unit Plan Template Unit AuthorFirst and Last NameUnit Overview CurriculumFraming QuestionsKasey L. MooreEssential Question Unit Questions Content QuestionsUnit Title Unit SummaryWho are some of the most famous scientists known today? Wh
U. Houston - KMOORE - 3112
*Unit Plan Template Unit AuthorFirst and Last NameUnit Overview CurriculumFraming QuestionsKasey L. MooreEssential Question Unit Questions Content QuestionsUnit Title Unit SummaryWho are some of the most famous scientists known today? Wh
Allan Hancock College - INFS - 3200
INFS3200/7907 Advanced Database SystemsSolution Tutorial 1: Distributed Database DesignSemester 1, 2007 Question 1:Given the following relation and the predicates p1: Pos &lt; 4, p2: Pos &gt; 4 EventID SwM100Free SwM100Free SwM100Free SwM100Free Shotpu
East Los Angeles College - CL - 0405
Business Studies 2003 Paper 7 Question 12 Describe three criteria a UK patent must exhibit. [3 marks] A UK patent must be - Novel. The invention described must be new, and not an obvious adaptation of something already known, or made public in any wa
U. Houston - CS - 1304
C ProgrammingStructures and UnionsStructure User-defined data type Grouping of related data that makes programming easier Begins with a structure definition Uses the keyword structmain() { struct { char initial; /* last name initial */ int
ETSU - CSCI - 5230
Course Scheduling SystemCHOOSING THE BEST WBS TEAM TRIANGLEOur Project Management TeamChristi Bouldin Zac Lawson Adam Ogle Tyler Osborne David SalazarOverviewScope Statement Software Development Life Cycle Organizational Structure Work Breakdo
ETSU - MATH - 1530
Two-Way Tables from Slaps per Film in the Three Stooges' WorkProbability and Statistics (MATH 1530) Worksheet Gardner and Davidson, Spring 2009 Name: _The purpose of this worksheet is to review some of your Minitab knowledge. In the process, you wi
U. Houston - BTECH - 3301
&gt;Piece of genomic DNA from C. elegansggccgattttgatctttttgaacatttcttcattaaaatttagtggaaaaattttcaaaaattctaagagttaggcattgacctcttctcaagtgtaaagatatatttccagaagactttgatcttttgagaagtatgtgcttaaagctataaaagttttcgaatttcttgcatacccgtcataattctgtaagttttcagttctcttgcact
U. Houston - CUIN - 6378
Rubric: Open-ended Essay (3-2-1) Student C 3 Facts 4 3 Are clearly Is well stated, stated, easily understandable, understandable, shows a good bit shows depth of of understanding understanding of of subject subject matter. matter. Extremely well Well
Cuyamaca College - COMP - 3513
50Assignment Kit #7Assignment description Using the Project Plan Summary form shown in Table 11.2, make a plan for doing the next assignment. First, estimate the program's size as described in Chapter 6. For this program, you will have to guess th
U. Houston - CUIN - 3113
Technology Integration ProjectCUIN 3113 PUMA 2003 Group Members: Andra Ancira Van Nguyen Maggie Ramirez Lan TranStage One: Teacher PlanningMs. Bunting is Lan Tran's mentor teacher. She has worked with our group for this technology integration les
U. Houston - ECE - 4371
Syllabus: ECE4371 Introduction to Telecommunication Engineering/4117 Telecommunication Laboratory, Fall, 2008 Zhu HanInstructor information Office location: Engineering 1 N324 Office hours: Mon. 10:00am-12:00am, Other time including weekend by app
U. Houston - ECE - 6341
ECE 6341 Spring 2009 HW 1 1) Derive the formulas on slides 13 and 14 in Notes 1, for the fields due to Az and Fz. (These results are the same as those given in Eqs. (3-86) and (3-89) in the book, except for differences with a factor of and , respec
Texas Tech - BA - 6337
Name _(5) SSN_(5)ISQS 6337 Fall 98 Exam 1 Please follow all class style guidelines. Hungarian notation, indention, neatness of code, neatness of writing (IF I CAN&quot;T READ IT THEN IT IS WRONG!) simple comments, and correct data type will all count. Y
U. Houston - CUIN - 3111
PARTS OF SPEECH ACTIVITYDirections: Highlight the parts of speech in each of the following sentences to match the legend shown on the right.1. 2. 3. 4. 5. 6. 7. 8. 9. 10. The water in the swimming pool was too cold for her to swim. The small dog
U. Houston - CUIN - 3113
Student Name: _Angel Castillo_ Rotation: _2nd_SBTE: _Mr. Raymond_Date: _10/24/08 _ Subject: _Reading _Technology Integrated Product #1 ChecklistObservation Sitting Properly Followed Log on Procedures Typed story in Microsoft Word Double spaced
Gonzaga - CPSC - 121
CPSC 121 Computer Science I Prog1 Spring 2009 Due 2/2/09, 1:10 pmProblem Type in the prog1.cpp program which converts an input Fahrenheit temperature to an output Celsius temperature. You need to modify the appropriate lines in the posted prog1.cpp
U. Houston - CUIN - 3112
ACTIVITYStudents are to write a report on the sun and the importance of its energy for humans and plants.TEKS(11) Science concepts. The student knows the natural world includes earth materials and objects in the sky. The student is expected to: (
U. Houston - CUIN - 3111
Semester Reflection Teaching with technology helps enhance a students understanding about a topic being taught. Technology makes a lesson more interesting because you can add visuals and sounds to an activity. This class has been a great help in impr
Maryland - METO - 200
METO 200 WEATHER AND CLIMATE Spring 2002 Homework #1 DUE February 12, 2003 Homework will be collected at the beginning of discussion. Anything you turn in should be neat and legible. Staple loose pages together. 1. The ozone in the southern polar str
U. Houston - CUIN - 3111
SIX FLAGS OVER TEXASFROM THE PAST TO THE PRESENTPresentation by: Cathy BoatesSOURCES: Graphics: Flags of Spain, France, Mexico, Republic, Confederacy and United States: http:/lsjunction.com/facts/6flags.htm Six Flag Array: http:/ourworld.compuse
U. Houston - CUIN - 3112
*Unit Plan TemplateUnit AuthorFirst and Last NameUnit Overview CurriculumFraming QuestionsCathy BoatesEssential Question Unit QuestionsHow can students learn about the factors surrounding Texas independence, republic and statehood? What kin
New York Institute of Technology - MGMT - 775
Chapter 10: Electronic Commerce SecurityElectronic Commerce, Seventh Annual EditionObjectivesIn this chapter, you will learn about: Online security issues Security for client computers Security for the communication channels between computers
CSU Fullerton - IENG - 3020
Discuss the type of Plant LayoutProcess Layout: group similar activities together in departments or work centers machining: o lathe, milling machine, drill fabrication: o shear, break, iron worker, punch press, fitting, welding, weld inspection (
Catholic - LSC - 555
Digitizing The Tower NewspaperProject TeamBeth Bryden-Miller, Erin Engle, Beth Killion, John McKenna, Janet McKinney, Carla Miller, and Colleen SemitekolJune 24, 2008LSC 555 - Final Project Summer 2008DigitizingProject Objectives Gather ba
CUNY Baruch - ATT - 0013
Classroom Practices and The Second Mindful Learners Conference:Faculty ConversationsCome join together with other contemplative pedagogues to meditate, reflect on, share, and explore the latest research, theory and best practices in contempla
Virginia Tech - CS - 2604
/ On my honor:// - I have not used C+ language code obtained from another student, / or any other unauthorized source, either modified or unmodified. // - All C+ language code and documentation used in my program / is either my orig
CSU Fullerton - FIN - 570
CHAPTER 11Measuring and Managing Economic ExposurePART I. FOREIGN EXCHANGE RISK AND ECONOMIC EXPOSUREI. FOREIGN EXCHANGE RISKA. Economic exposure focuses on the impact of currency fluctuations on firm's value. 1 . The most important aspect of fo
CSU Fullerton - CS - 231
LEARNING OBJECTIVES Problems with simple indexing. Multilevel indexing: B-Tree. B-Tree creation: insertion and deletion of nodes. B-tree complexity. Merging and redistribution Advantages of B-trees.CPSC 231 B-Trees (D.H.)1Problems related
CSU Fullerton - MGT - 339
Chapter 6 Process Performance and Quality5. Marlin CompanyBottle Sample 1 2 3 4 5 6 1 .604 .597 .581 .620 .590 .585 2 .612 .601 .570 .605 .614 .583 3 .588 .607 .585 .595 .608 .617 4 .600 .603 .592 .588 .604 .579x.601 .602 .582 .602 .604 .591 x =
Old Dominion - MATC - 1200
MATC 1200 Calculus for Business and Social Sciences Spring Quarter 2009 Syllabus Instructor: FAHRIDZAL (FAREED) OMAR E-mail: fomar@du.edu Phone: (303) 871 3291 Office Location: JGH 202B Office Hours: MW 9:30a.m 11:30a.m F 11a.m 12 noon Course Web p
SUNY Plattsburgh - CLIF - 2122
Tiffany Clift Lesson Plan 1 February 2, 2005 Mrs. FrechetteTopic: Valentine Candy Count Setting: 1st grade Special/Regular Education classroom Relevant New York Standards: -Content Area: Math, Science -Standard Number and Label: Standard 1- Analysi
SUNY Plattsburgh - VENN - 0433
The Five SensesCreated By: Cierra VenneThe Five Senses Touch Hear Smell Sight TasteTouch Touch is to use your skin to have physical contact with another object. Some examples of touch are: hard, soft, rough, silky, etc.Facts about Touch
University of California, Merced - ED - 232
Species ConstraintsUnconstrained LearningTiming ConstraintsDomain ConstraintsSpecies ConstraintsUnconstrained LearningTiming ConstraintsDomain ConstraintsTaste AversionKonrad LorenzSpecies ConstraintsUnconstrained LearningTimi
Pima CC - KKING - 9796
Katherine King Professor Kotzen October 20, 2005 Disney On Wednesday I attended the presentation on the Disney College Program. To my surprise I am putting some serious thought into participating in the program and set up a phone interview. There was
Utah State - CS - 7650
9.4 Resampling for estimating statistics Jackknife BootstrapJackknife Mean1 = nn i =1Xi Standard deviation1 2 = n(n - 1)n i =1( Xi - ) 2Jackknife Leave-one-out mean1 ( i ) = n -1j inX - X i Xj = n -1 Jackknife estimate of m
MD University College - ASIA - 2092
JAPN 111: Elementary Japanese J Term: 4 ('08-'09) Site: Camp Zama University of Maryland University CollegeFaculty Contact Information Instructor: Moriaki Kanai Email: mkanai@asia.umuc.edu Phone number: 090-3082-0460 Date: 3/23/2009 Course Descripti
Cal Poly Pomona - CHEM - 160
SUMMARY OF STATISTICAL MECHANICAL RESULTS FOR A GASEOUS DIATOMIC MOLECULE XY Function q Translation3 (2mkBT/h2)1.5V Rotation2,5 (kBT/hc)[1/(Be)] RT R Rln[ekBT/hcBe] Vibration2 [1 - exp(-x)]-1 RTx[exp(x) - 1]-1 Rx2exp(x)[exp(x) - 1]-2 Rx[exp(x) - 1]-1
W. Kentucky - CIT - 370
Name _ Lab Assignment #3: vim Improved vi editor CIT 370001/002 Spring 2009You should read pages 131136 before starting this lab. You must follow the steps carefully to get the correct answer.1. We want to use vim to create the file states.txt.