52 Pages

OCD_IOC1_S09b_T16_V9.0

Course: CSCI 577, Fall 2009
School: USC
Rating:
 
 
 
 
 

Word Count: 5405

Document Preview

Concept Operational Description (OCD) Theatre Script Online Database Team# 16 Team Members: 1) Jae Young Bang 2) Ka Ho Au 3) Shi Heng Guan 4) Young Chan Noh 5) Gary Lam 6) Nory Nishimura Roles: Project Manager / Non-tech Lead / Developer Prototyper / Developer Planning and Control Engineer / Tester System Architect / Developer Requirements Engineer / Tech Lead / Tester IIV&V/ Quality Focal Point /...

Register Now

Unformatted Document Excerpt

Coursehero >> California >> USC >> CSCI 577

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Concept Operational Description (OCD) Theatre Script Online Database Team# 16 Team Members: 1) Jae Young Bang 2) Ka Ho Au 3) Shi Heng Guan 4) Young Chan Noh 5) Gary Lam 6) Nory Nishimura Roles: Project Manager / Non-tech Lead / Developer Prototyper / Developer Planning and Control Engineer / Tester System Architect / Developer Requirements Engineer / Tech Lead / Tester IIV&V/ Quality Focal Point / Quality Lead Operational Concept Description (OCD) Version 9.0 Date: 04/06/2009 OCD_IOC1_S09b_T16_V9.0.doc ii Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 Version History Date Author Version Changes made Rationale 09/22/2008 10/06/2008 Sandeep, Jae Young Sandeep, Jae Young 1.0 1.1 Early Draft Updated sections 1.2, 2.1,2.3,2.4,2.5,3.1,3.3.1 Added sections 3.2,3.3.2,3.3.3,3.4,3.5,4 Added Shared Vision and System Transformation This is for Core FC package. Updated Shared Vision and Entity Relationship Diagram according to the feedback received from TA Added Organizational and Operational Implications, Prototype, WikiWinWin Results. 10/13/2008 Sandeep 1.2 Updated sections 1.2, 3.1.2, 3.3.1, 3.4 This updated document is for Draft FC package Edited Organization transformations, Prototype according to the feedback received from TA 10/21/2008 Sandeep 2.0 Updated the document after receiving suggestions from IIV&V Edited sections 2.5, 3.4.1 All figures are labeled in order This is the modified OCD document after Core FC Package evaluation. Changes are made according to the feedback received from IIV & V This is the updated OCD document for Foundations Commitment Package. Changes are made based on the feedback received from ARB session and the whole development team. 10/26/08 Sandeep, Jae 3.0 Changed benefits-chain diagram to include all organization goals. Changed business-work flow diagrams as per the suggestions Deleted some capability goals from previous version Updated Prototype with some new features Changed Entity-Relationship diagram 11/10/08 Sandeep 4.0 Updated the document after receiving suggestions from IIV&V This is the modified OCD document after Response to Evaluation of FC Package. Changes are made according to the feedback received from IIV&V 11/24/08 Sandeep 5.0 Updated section 3.1 by deleting the previous OC-2. Changed Entity Relationship diagram by adding visitors account request. This is the modified OCD document for Draft DC Package. Deleted OC-2 from the previous version of OCD as the present OC-2 would make more sense than the previous one. Changed ER diagram as Visitors were not covered in the previous version. OCD_IOC1_S09b_T16_V9.0.doc iii Version Date:04/06/09 Operational Concept Description (OCD) Date Author Version Changes made Rationale Version 9.0 This is the modified OCD for DCR ARB session. 2nd capability goal in section 3.1 is divided into 2 separate goals As visitors can look at the script titles and request for account creation, they were added in the system boundary and environment diagram. Updated System Boundary & Environment Diagram by making OCR an external infrastructure. Updated Business Workflow Diagrams which now represents the workflow Updated Capability goals by deleting first OC. 11/29/08 Sandeep 5.1 Divided the second capability goal into two parts to be more specific on goals. System Boundary and Environment diagram is updated by adding visitors to the diagram 12/07/08 Sandeep 6.0 Final Version of OCD. Made changes according to the suggestions given in the DCR ARB session. 02/09/09 Jae young Bang 6.5 Updated 1.2 to meet the current status of the document Updated Table 1 to meet the current status of the development team Updated section 3.5 to meet the current status of the prototype Ready for Draft RDCP 02/23/09 Jae young Bang 8.0 Changed the version to 8.0 to follow the version control Grammatical errors in Section 1.2 are fixed Ready for RDCP 04/06/09 Jae young Bang 9.0 Updated Section 1.1 and 1.2 to mirror current status of the project Updated The Prototype Section to mirror current status of the prototype system Ready for IOC #1 OCD_IOC1_S09b_T16_V9.0.doc iv Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 Table of Contents Operational Concept Description (OCD).....................................................................................i Version History.............................................................................................................................iii Table of Contents...........................................................................................................................v Table of Tables..............................................................................................................................vi Table of Figures...........................................................................................................................vii A.1. Introduction............................................................................................................................1 A.1.1 Purpose of the OCD.....................................................................................................1 A.1.2 Status of the OCD........................................................................................................1 A.2. Shared Vision.........................................................................................................................2 A.2.1 Success-Critical Stakeholders.....................................................................................2 A.2.2 System Capability Description ..................................................................................2 A.2.3 Expected Benefits ........................................................................................................3 A.2.4 Benefits Chain Diagram:.............................................................................................4 A.2.5 System Boundary and Environment:.........................................................................5 A.3. System Transformation ........................................................................................................7 A.3.1 Capability Goals...........................................................................................................7 A.3.2 Organizational Goals...................................................................................................8 A.3.3 Proposed New Operational Concept........................................................................10 A.3.4 Organizational and Operational Implications........................................................12 A.3.5 Prototype.....................................................................................................................14 A.4. WikiWinWin Results...........................................................................................................44 OCD_IOC1_S09b_T16_V9.0.doc v Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 Table of Tables Table 1: Success-Critical Stakeholders........................................................................................2 Table 2: Relation to Current System...........................................................................................8 Table 3: Level of Service Goals..................................................................................................12 OCD_IOC1_S09b_T16_V9.0.doc vi Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 Table of Figures Figure 1: Benefits Chain Diagram...............................................................................................4 Figure 2: System Boundary and Environment Diagram...........................................................5 Figure 3: Element Relationship Diagram..................................................................................10 Figure 4: Business Workflows Diagram- Distribute Theatre Scripts.....................................11 Figure 5: Business Workflows Diagram -Authorize an actor or actress................................11 Figure 6: Visitors' Main Page.....................................................................................................18 Figure 7: Visitors on the View Scripts Page..............................................................................18 Figure 8: Visitors who have insufficient rights to access the page are directed to the login page...............................................................................................................................................19 Figure 9: Logging in with invalid username or password.......................................................20 Figure 10: User Registration Form............................................................................................21 Figure 11: Password Recovery Page..........................................................................................22 Figure 12: Users Logged In.........................................................................................................23 Figure 13: Edit User Page...........................................................................................................24 Figure 14: Change Password Page.............................................................................................24 Figure 15: The Request Access Link Enabled For Basic User to Request Access For a Script.............................................................................................................................................25 Figure 16: Administrator's Main Page......................................................................................26 Figure 17: Active User Page Viewed by The Administrator...................................................27 Figure 18: Pending User Page Viewed by The Administrator................................................28 Figure 19: The Pending User Is Activated................................................................................29 Figure 20: Deleting A User on the Active User Page................................................................30 Figure 21: The Active User Who Demonstrates User Lockout(WinC_4)..............................31 Figure 22: The Locked User Goes To The Inactive User List.................................................31 OCD_IOC1_S09b_T16_V9.0.doc vii Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 Figure 23: Viewing Script Lists..................................................................................................32 Figure 24: View Script in A Browser.........................................................................................33 Figure 25: Search In Script by Keyword (WinC_57)...............................................................34 Figure 26: Download Script Page...............................................................................................35 Figure 27: Upload Scripts Page (WinC_21)..............................................................................36 Figure 28: Administrator Clicks on One of the Usernames....................................................37 Figure 29: List of Scripts Granted to A User............................................................................37 Figure 30: List of Scripts That Are Not Granted to A User....................................................38 Figure 31: List of Scripts Granted to The User........................................................................39 Figure 32: Administrator Clicks on The Script Title...............................................................41 Figure 33: User "vicszs" Has The Access To "Moliere Plays in Paris".................................41 Figure 34: List of Users Who Do Not Have Access to The Script...........................................42 OCD_IOC1_S09b_T16_V9.0.doc viii Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 A.1.............................................................Introduction A.1.1 Purpose of the OCD The purpose of this document is to provide shared vision and goals of the stakeholders in the project Theatre Script Online Database. Stakeholders in the project are the on-campus and the off-campus developers, the client, and the users of this software system. OCD would provide all the stakeholders a clear picture of the project, and thus it would help them in developing a better software system. A.1.2 Status of the OCD This is the 9th version of OCD, and this document is for Initial Operational Capability Report #1 Package. OCD has been stabilized through out the previous versions; System Boundary and Environment diagram, Capability Goals, Business Workflow diagrams, Benefits-Chain diagram are finalized. The description of the prototype is still evolving. OCD_IOC1_S09b_T16_V9.0.doc 1 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 A.2. Shared Vision A.2.1 Success-Critical Stakeholders Table 1: Success-Critical Stakeholders Stakeholder Client Authorized Representatives Julie Sanchez Organization Relation to Benefits Chain JulesTBear's Online Script- Responsible for providing o-Rama budget, maintaining and updating the system. Users Actors and Theater JulesTBear's Online Script- Beneficiaries of the system. Staff o-Rama Jae Young Bang Ka Ho Au Shi Heng Guan Young Chan Noh Gary Lam USC Responsible for providing the Theatre Script Online Database application. Also responsible in training the client. Developers IIV&V Nory Nishimura USC Responsible in verifying and validating the project's artifacts to assure quality. A.2.2 System Capability Description The proposed system is a web-based system that has the following features. Client will be the Administrator and Maintainer for this project Administrator scans the scripts and uploads them in the database and has all the rights in maintaining the users accounts. Administrator also provides login details to the users (actors and theatre staff) for a limited span of time. Users can look at the titles of the scripts they wanted and once they find them, they can login into their account, view the scripts and they are also allowed to download it and take a print out of that copy. Updates are made by the administrator only. Users are not allowed to edit the documents. After every update, notification will be send to users about that. OCD_IOC1_S09b_T16_V9.0.doc 2 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 Everything is done manually before. Reasons why client wants us to develop this application are to reduce the use of paper, to save client's time in printing out copies of scripts. A.2.3 Expected Benefits Client benefits the most from this application. It reduces client's work in searching the scripts from the filing cabinet and print out the copies for users. All the manual operations are carried out online with this project. Users can easily access the scripts once they are given the permission from the administrator. Administrator can easily notify updates to users. They are sent automatically if any changes to the scripts are made. Users can easily search for the scripts they wanted and can retrieve them easily. Lot of paper can be saved, as there is no need in providing hard copies to users all the time. OCD_IOC1_S09b_T16_V9.0.doc 3 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 A.2.4 Benefits Chain Diagram: Figure 1: Benefits Chain Diagram OCD_IOC1_S09b_T16_V9.0.doc 4 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 A.2.5 System Boundary and Environment: Figure 2: System Boundary and Environment Diagram OCD_IOC1_S09b_T16_V9.0.doc 5 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 OCD_IOC1_S09b_T16_V9.0.doc 6 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 A.3. System Transformation A.3.1 Capability Goals OC-1: Access Control, The system will be able to control user access through authentication capability. Users can only read the scripts when they are logged in, and they have access to them. OC-2: User Authorization - Regular users should not be able to edit scripts; only the administrator should be able to create, update, and delete scripts. OC-3: Page and Act Search The users will be able to search for a page or an act. Search options can be given such as words, phrase, page number, and act number. OC-4: Script Changes Tracking The users will be able to track changes of scripts through edit log. New changes will be notified automatically by the system to users. OC-5: User Account Activation The administrator will be able to activate new user accounts through the web interface. New users will not be able to use the system until the administrator activates their accounts. OC-6: User Profile The users shall be capable of change their information and password in the database. OCD_IOC1_S09b_T16_V9.0.doc 7 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 Relation to Current System Capabilities Current System New System - Administrator scan theater scripts and upload them to the system - System automatically notifies changes to users - Users retrieve up-to-date theater scripts online - Theater scripts are posted online - Automatic notification is provided based on the useractivity log - No need to make another copies for changes - Reusability of theater scripts - Less use of papers - Bigger storage for more theaters - More stable OCR feature Roles and -Administrator copies theater Responsibilities scripts manually for each actress/actor -Administrator hand out theater scripts manually - Administrator make another copy when changes occur - Users receive theater scripts in person User Interactions - Theater scripts are given in person Infrastructure - Notification in person; providing a new copy of the script Stakeholder Essentials Amenities Future Capabilities and Table 2: Relation to Current System A.3.2 Organizational Goals Following are the Organizational Goals for the Theatre Script Online Database System: OG-1: Reduce the client time in searching and taking out copies of scripts to the users. OG-2: Reduce the user's (actors and theatre staff) time in getting the scripts they wanted. They need not go to the client every time for the sake of scripts. OG-3: Reduce lots of paper usage as everything is done online and there is no need in providing copies to the users. OG-4: The quality of service provided to the users increases a lot as everything is done online. OG-5: Improve the reputation of client. As this is a web-based application people from around the globe can search for script titles and if they find any script interesting, they can contact OCD_IOC1_S09b_T16_V9.0.doc 8 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 administrator to gain access to view scripts. This way, client will be recognized by people and size of users would increase every year. OCD_IOC1_S09b_T16_V9.0.doc 9 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 A.3.3 Proposed New Operational Concept .3.3.1 Element Relationship Diagrams Figure 3: Element Relationship Diagram .3.3.2 Business Workflows Business Workflows of Theatre Script Online Database is down below. The first diagram shows how the theater scripts are distributed while the second diagram shows the process of actor/actress authorization to the system. OCD_IOC1_S09b_T16_V9.0.doc 10 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 Figure 4: Business Workflows Diagram- Distribute Theatre Scripts Figure 5: Business Workflows Diagram -Authorize an actor or actress OCD_IOC1_S09b_T16_V9.0.doc 11 Version Date: 04/06/09 Operational Description Concept (OCD) Version 9.0 .3.3.3 Level of Service Goals Table 3: Level of Service Goals Level of Service Goals Search Accuracy Script Search Time System Up Time Priority Level Must Have Must Have Must Have Referred SSRD requirements LOS-1 LOS-2 LOS-3 A.3.4 Organizational and Operational Implications .3.4.1 Organizational Transformations Though every thing is changed from the current system, there would be only one organizational transformation and that is the client has to perform new roles. 1) The only transformation is Client has to be both administrator/maintainer. Though she maintains the current system, the system we are going to implement is entirely different from the present system in the way that she is new to roles like scan and upload scripts, manage user accounts and database. .3.4.2 Operational Transformations Following are the operational transformations that take place with future system. 1) Administrator will upload the scripts into system's database and retrieve them whenever required whereas in the current system client has to search for the scripts manually in filing cabinets. 2) Whenever authorized users want the script they can login into their account and download it where as in the present system, they have to go to client's office and request for the copy of script they wanted. OCD_IOC1_S09b_T16_V9.0.doc 12 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 3) If any changes are to be made to the script, administrator can modify it and send the notifications to the users but in the present system if any changes are made, client has to prepare copies of the updated script and hand them over to users. OCD_IOC1_S09b_T16_V9.0.doc 13 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 A.3.5 Prototype Objective: Team 16 will be designing and developing a Theater Script Online Database for automating the existing manual system. Our client, the administrator of the Computer Science department at USC, currently needs to scan the theater scripts and distribute to the users such as actors and the people who are interested in reading the scripts. Our client has to email the scripts to users whenever users request for it. She also has to notify users whenever she has to make changes of the scripts. As the number of scripts she needs to process is growing tremendously, she found that it would be nice if users can just go online to download the scripts and receive notifications through the system whenever there are any scripts updated. She is really looking for a web-base system that helps her fasten the processes. Approach: Participants Our client is the main participant of the system. The other users who are going to use the system include the actors and the people who are interested in the scripts and permitted to get the scripts by our client, we have not had a chance to interview with them for gathering the requirements, however. Our client has been providing a lot of information for us to build the initial prototype. She made quite a lot of clarifications such as logging in as two types of users administrator and common users, uploading scripts to the system, viewing scripts in web pages etc. Additionally, she emphasized the importance of user's privileges on the pages. For example, the system is going to have the edit script function and this function is only accessible by the administrator. The initial prototype presenting here is going to demonstrate the initial login system, which can differentiate different kinds of users and the functions corresponding to them. She mentioned that there is a budget for the project if it is highly beneficial to the system. Therefore, an Optical Character Recognition (OCR) might have to be bought to convert PDF file to MS word format such that our client can edit script files in MS Word. Our client allows us to use any tools we want as long as it works, so we have the flexibility of choosing anything to use for the project. OCD_IOC1_S09b_T16_V9.0.doc 14 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 Prototyping After having a couple meeting of determining what tools should be used, our team decided to use MySQL as our database. For the programming language, we chose java JSP, Servlet and potentially EJB 3.0 in the future. The reasons of using java are as follows: We are using Apache Tomcat as our java web server, which supports declarative control through xml files. For example, configuration parameters can be set in the xml files and retrieved by java servlets when needed. Moreover, using declarative control can allow data transfer in a secure way (i.e. using https). The web container handles threads for us. It spawns threads for handling each incoming request. All we have to do is to implement the business methods without worrying about multi-threading. When the system goes larger, java frameworks such as struts can be used to support the MVC design pattern. The lightweight container frameworks such as Spring can also be used to work with EJB. For easing the deployment procedures, apache ant can also be used to automate the deployment settings. Java Sun provides a Netbean IDE package that we can download the its bundle without too much configuration setup. We can start prototyping once we downloaded Netbean. Also, the bundle is free of charge (based on win condition 2.9, the software should be free, by Julie Sanchez). In the long term, the system might require the system to support concurrency (i.e. having more than one user modifying a mutually exclusive content at a time). Converting the plain old java objects Session Bean, Entity beans using EJB 3.0 should be a good choice in this case as they support concurrency. Transaction management. The future system might have a lot more work load. If the server crashes during data processing, the data cannot be recovered as its original form. EJB has nice features that can rollback everything before the server crashed. Java is a high level object oriented programming language. Most of our team members have learned it or its similar language before. The reasons of choosing MySQL as our database are as follows: MySQL is free, yet a powerful database (based on win condition 2.9, the software should be free, by JulieSanchez) It has an enterprise version MySQL out in the market, so the system can be converted to an enterprise system without having too much database migration efforts. 15 Version Date: 04/06/09 OCD_IOC1_S09b_T16_V9.0.doc Operational Concept Description (OCD) Version 9.0 MySQL is a relational database. Its syntax is very similar to other databases our team familiar with. Based on the reasons above, we believe that using java and MySQL should be adequate to ours needs. Moreover, there are many large enterprises using java as their front-end and back-end systems where the Bank of America website is one of the examples. This proves that java is reliable and it can handle our needs very well. OCD_IOC1_S09b_T16_V9.0.doc 16 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 Initial Results: Currently way for performing As of now everything has to be done manually. Whenever there are any new scripts released, our client has to scan them and distribute them to the users. Users sometimes also ask for scripts individually and our client has to find the scripts and send it to them. When our client wants to search for a script, the only way she can do is to go through the script files one by one. It makes the work more cumbersome when she wants to do advanced searches such as search by title, actors etc. Moreover, our client also wants to keep track of the number of users who are interested in the scripts. When she wants to know the list of people who wants the scripts, she has to use the people list from the previous email she sent and keep adding people from that list. When users want to unsubscribe the scripts, she has to use the same way to remove people from the list. Proposed way of performing activity Note that we keep our user interface simple and user-friendly. The users can learn to operate the system by using it (based on win condition 1.1, keep it simple, by Julie Sanchez). As our client states that the system is going to be accessible by anybody, but some pages such as view scripts, edit user information can only be accessible by users who logged in. Our team treated this feature as one of the top priorities of the system requirements and implemented it as shown in the following screen shots: OCD_IOC1_S09b_T16_V9.0.doc 17 Version Date: 04/06/09 Operational Concept Description (OCD) Visitors' privileges Version 9.0 Figure 6: Visitors' Main Page The above is the main page that is accessible to anybody. The visitors can go to the view scripts link to see the list of the scripts that are in the system (WinC_5, Option_2). Figure 7: Visitors on the View Scripts Page However, when the visitors try to view or download the script file, they will be directed to the OCD_IOC1_S09b_T16_V9.0.doc 18 Version Date: 04/06/09 Operational Concept Description (OCD) login page with an error message: Version 9.0 Figure 8: Visitors who have insufficient rights to access the page are directed to the login page If users enter invalid input or password, the error message is shown as below: OCD_IOC1_S09b_T16_V9.0.doc 19 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 Figure 9: Logging in with invalid username or password The above screenshots show that users have to log in to use the core functionalities of the system (WinC_3). On the above screen, the create account link right below the login button can lead users to the create account page when new users want to register for a new account (WinC_16). Its screenshot is as follows: OCD_IOC1_S09b_T16_V9.0.doc 20 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 Figure 10: User Registration Form After a new account is created, an notification email is sent to the administrator saying that the user is requesting to register for the system (WinC_15). After the user gets approved, the user can log on to the system. Additionally, if users have a account but forgot their password, they can recover their password by going to the recover password page and type in their username and/or email address, their password that was used to register the system will be sent to the email address, provided that the email address has to be the one that was used to register for the system. OCD_IOC1_S09b_T16_V9.0.doc 21 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 Figure 11: Password Recovery Page OCD_IOC1_S09b_T16_V9.0.doc 22 Version Date: 04/06/09 Operational Concept Description (OCD) Basic Users' Privileges Version 9.0 Figure 12: Users Logged In Users can now access to pages such as viewing the content of the scripts, download the scripts, edit their profile (WinC_9) and change their password (WinC_6) OCD_IOC1_S09b_T16_V9.0.doc 23 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 Figure 13: Edit User Page Figure 14: Change Password Page Also, when the basic user goes to the view script page, the request access link is enabled for them to request access to a script. OCD_IOC1_S09b_T16_V9.0.doc 24 Version Date: 04/06/09 Operational Concept Description (OCD) Version 9.0 Figure 15: The Request Access Link Enabled For Basic User to Request Access For a Script OCD_IOC1_S09b_T16_V9.0.doc 25 Version Date: 04/06/09 Operational Concept Description (OCD) Administrators' Privileges Version 9.0 Now we would like to demonstrate the administrator's functionalities. The screen shot below shows the main page after the administrator logged in: Figure 16: Administrator's Main Page Clearly, there is more functionality provided for the administrator when we compare this screen shot to the one for visitors. OCD_IOC1_S09...

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

USC - CSCI - 577
Life Cycle Plan (LCP)Theater Script Online DatabaseTeam No 16Jae Young Bang Gary Lam Shi Heng Guan Young Chan Noh Ka Ho Au Nory Kealii Nishimura Julie SanchezNon-technical Lead/Builder Tester/Technical Lead Planning and Control Engineer System
USC - CSCI - 577
Feasibility Evidence Description (FED)Theater Script Online Database Team No 16Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Nory Nishimura Julie SanchezProject Manager / Non-tech Lead / Developer Requirements Engineer / Tech Lea
USC - CSCI - 577
Quality Management Plan (QMP)Theater Script Online DatabaseTeam No 16Quality Management Plan (QMP)Version 9.0Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Nory Kealii Nishimura Julie SanchezNon-technical Lead Requirements
USC - CSCI - 577
System and Software Architecture Description (SSAD)Version 9.0System and Software Architecture DescriptionTheater Script Online Database Team #16Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Nory Kealii Nishimura Julie Sanchez
USC - CSCI - 577
Proposal for Ada to AADL TranslatorFeasibility Rationale Description(FRD)Team# 18Team Members DeWitt Latimer IV Mridu Sethi Nidhi Gulati Sapan Lalani Suprabha Ray Swapnil Patel Vijay KakadiaIndependent Verification & Validation System and Soft
USC - CSCI - 577
Project DetailDue : Monday, December 15, 2008 at 11:59 PM Submission : Post the file under Final Deliverables page in your team website File name : ProjectDetail_20083_Txx.doc (xx is your team no.) -Instruction: Fill in this form. Make sure that the
USC - CSCI - 577
System and Software Requirements Definition (SSRD)Theater Script Online DatabaseTeam No 16Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Sandeep Mikkilineni Nory Kealii Nishimura John Christopher Reynolds Julie SanchezProject M
USC - MEDIA - 1105
<!DOCTYPE html PUBLIC "-/W3C/DTD XHTML 1.0 Strict/EN" "http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"><html xmlns="http:/www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head> <title>Changeset 1105 for tools/DotSceneLoaderTemplate/media/
USC - MISC - 2438
<!DOCTYPE html PUBLIC "-/W3C/DTD XHTML 1.0 Strict/EN" "http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"><html xmlns="http:/www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head> <title>Changeset 2438 for ogre/Tests/OgreMain/misc/ArchiveTes
USC - MISC - 2438
<!DOCTYPE html PUBLIC "-/W3C/DTD XHTML 1.0 Strict/EN" "http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"><html xmlns="http:/www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head> <title>Changeset 2438 for ogre/Tests/OgreMain/misc/ArchiveTes
USC - DOCS - 1876
<!DOCTYPE html PUBLIC "-/W3C/DTD XHTML 1.0 Strict/EN" "http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"><html xmlns="http:/www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head> <title>Changeset 1876 for ogreaddons/3dv/MouZe/docs/WorkingDi
USC - DOCS - 1876
<!DOCTYPE html PUBLIC "-/W3C/DTD XHTML 1.0 Strict/EN" "http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"><html xmlns="http:/www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head> <title>Changeset 1876 for ogreaddons/3dv/MouZe/docs/ReadMe.tx
USC - CS - 556
Broadcast Encryption and Content Protection ApplicationsYu Shiu & Yih-Feng Chen University of Southern CaliforniaOutline Motivation and Application Framework of Broadcast Encryption Solution to Broadcast Encryption: SubsetCover Revocation Algo
USC - CS - 665
Report 4 (MidTerm) Exit Criteria1. A defined process for analyzing the data and creating a report including all the data under "Task 3" page 772. (Compliant with Section 13.2, pgs. 442-444.) a) Including a process script. (Use any PSP script as a "
USC - SCF - 480
480 TITLES GUIDESPRING 2007Policies:1. No "Film-by" Credit or Similar Per School of Cinema-TV policy, the following title presentations are NOT allowed under any circumstances (the following are examples, the list is not conclusive): A John Doe Fi
USC - CSCI - 577
CLIENT INTERACTION REPORT-TEAM# 16Project Name: Theatre Script Online Database Organization Name: JulesTBear's Online ScriptoRama Current System System name: None. What it provides to users A script filing cabinet. A place to keep hard copies of
USC - CSCI - 577
Supporting Information Document (SID)NEW ECONOMICS FOR WOMENTeam No: 11Team members and roles Name Raghava Aditya Ravula Tejaswi Chadalavada Nitin Bandi Adil Fulara Veena Movva Swarag Segu Abbey Sullivan Role Project Manager & SSRD & Meeting Fa
USC - CSCI - 577
Systems and Software Architecture Design (SSAD)Version 1.0Project #14: Early Medieval East Asian TombsSiavash Gholami (Project Manager, FRD) Derek Zimmermann (SSAD) Aviral Mathur (Prototyper) Yasin Angara (OCD) Xiaoyan Zhang (LCP) Sijie Zhang (S
USC - CSCI - 577
Life Cycle Plan (LCP)Youthink.com Video Uploading and Conversion System Team 10Sandarsh M Kumar Project Management Rajen Sarda System Analysis Peter Thompson Operational Concept Description Pius Pack Feasibility Rational Description Stephen Cather
USC - CSCI - 577
Supporting Information Document (SID)LCA Package Version 2.2Personal Care Technology Team 9Team Members: Preeti Agrawal Project Management, LCP Akash Haswani Operational Concept Neha Singla Prototype / Implementation Prateek Tandon Requireme
USC - CSCI - 577
Operational Concept Description (OCD)Video Uploading & Conversion SystemTeam 10Stephen Cathers Tasneem Hakim Sandarsh Kumar Pius Pack Rajen Sarda Peter Thompson John Marshall Dean Robert(Prototyping) (System & Software Requirements Description
USC - CSCI - 577
USCC S EUniversity of Southern CaliforniaCenter for Software EngineeringValue-Based Software Engineering (VBSE) and the Incremental Commitment Model (ICM)Barry Boehm, USC CS 510, 577a Lectures Fall 2008USCC S EUniversity of Southern C
USC - CSCI - 577
COTS Survey COTS Integration Pre-Assignment Survey1. Team Number: 5 2. Is system largely dependent on COTS products?Yes.3. How many COTS products does your proposed system utilize (including operating system)? 5 4. List the members of you
Loyola Marymount - MBAD - 617
Ragsdale's Chpt 3.9 Investment ProblemsProblem: how to design a retirement income portfolio for retirees using corporate bonds? Client has $750,000 in liquid assets to invest A list of upcoming bond issues from 6 companies has been identified and
USC - CC - 2420
ARCHITECTURE=The default LPL implementation uses a packet train with acknowledgementsenabled, shortened backoffs, and a spinning energy checking loop.The default strategy can be improved by implementing a different architecture.Right now the a
Southern Utah - ECON - 2020
Money, Banking and the Financial SectorChapter 13McGrawHill/IrwinCopyright 2001 by The McGrawHill Companies, Inc. All rights reserved.13 2Laugher Curve A central banker walks into a pizzeria to order a pizza. When the pizza is done, he
USC - CSCI - 351
<XMP><HTML><HEAD> <TITLE>Homework #5: List</TITLE> <STYLE type="text/css"> OL { color: Navy; font: bold 16px times new roman; list-style-type: upper-roman; } OL OL { color: Blue; font: bold italic 16px t
Virginia Tech - CS - 4984
33 F.3d 1526 63 USLW 2088, 31 U.S.P.Q.2d 1545 (Cite as: 33 F.3d 1526) RICH, Circuit Judge, with whom: United States Court of Appeals, Federal Circuit In re Kuriappan P. ALAPPAT, Edward E. Averill and James G. Larsen. No. 92-1381. July 29, 1994. *1529
SUNY Potsdam - WIDRICCR - 191
Spanish Vocabulary Practice This is an amazing site that provides a variety of categories to choose from to practice and learn Spanish vocabulary with options of having it pronounced for you. Spanish Verb Conjugations This is an amazing site that all
SUNY Potsdam - GLASERIM - 191
Vocabulary QuizNY State Algebra I Chapter 8 Systems of Equations and Inequalities phschool.com Homework Tutor ata-00801 through ata-0806 Name: _ Date Set TopicsCHA 8-1 CHA 8-2Ata-0851 Chapter Test PracticeAssignmentJournal Find the errorZe
University of Texas - BIO - 301
name (required) _revise 2. (4pts) Why is it difficult to measure the harmful effects of the levels and types of ionizing radiation that we think is most relevant to our population? MTF A) Sample size: too few people are exposed to any dose of ionizi
University of Texas - BIO - 301
name _ (required)Exam 4, Bio301D, 6 Dec 061. (4 pts) Key code, box #, and name. Fill in (A B) to indicate your key for this version of the exam. Be sure your name and box number are correctly bubbled in on the scantron and that you have signed th
Alverno College - CS - 270
Finding Your Inner Flyor How Do I Find My Inner Calling and Integrate It Into a Career?What's My Inner Fly?Human fruit flies often seem genetically predisposed to do what they do Instinctively combine their passions with their aptitudesThe r
UMass (Amherst) - CMSTEX - 7427
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>d45388c39de57138e50b0c9c7f576e503d4a146b.pdf%3Ffile %3Dga</Key><RequestId>C54CA1FF88F18B1A</RequestId><HostId>XC9Y3bs5njIkwgF
UMass (Amherst) - CMSTEX - 6757
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>376d9e7e270963f427b491168cab228bef0ea56c.pdf%3Ffile %3Dka</Key><RequestId>B3BFDEA49E0E623F</RequestId><HostId>2ildKFi1Y4DZcYB
SUNY Potsdam - JOHNSOJD - 190
NY State Algebra I Chapter 8 Systems of Equations and Inequalities phschool.com hh Homework Tutor ata0801 through ata0806Vocabulary Quiz Ata-0851 Chapter Test Practice Ata-0852Name: _SetCHA 8-1 CHA 8-2 CHA 8-3 CHA 8-4 CHA 8-5 CHA 8-7DateTo
W. Carolina - CS - 361
8 6 world x and y dims0 0 -3 viewpoint (x, y, z)14 plane2 2 2 r g b ambient6 6 6 r g b diffuse0 0 0 r g b specular0 1 0 normal0 -4 0 point13 sphere1 1 1
W. Carolina - CS - 361
8 6 world x and y dims0 0 -3 viewpoint (x, y, z)14 plane0.0 0.0 0.0 amb, diffuse, spec2.6 2.0 0.0 amb, diffuse, spec0.7 0.7 0.7 amb, diffuse, spec0 1 0 normal0 -4 0 point16
Emory - CS - 323000
I fixed Notes.txt ("Cut Property" and "Cycle Property" were reversed).We did not do the correctness of Prim's algorithm, but it is a prettysimple consequence of the Cut Property. We'll talk about performancenext time.
Emory - CS - 153000
See the lab6 handout for an explanation.
Emory - CS - 153000
We had to edit lcs.pl during class to make it work, filelcs.pl.orig is the original version. It has "lcs_cache" inone place, instead of "llcs_cache", and no "use strict"which would have caught the error.The original version falls back into the
Emory - CS - 0126
In class I edited ./0123/hw1.pl with the resulting file"hw1-nodefault.pl", so we did not look at the prepared file"hw1-rewrite.pl" (and the "Tom Toady" motto).We did look at example5-6.pl and example5-7.pl, but (as Iexpected) we did not have tim
Emory - CS - 323000
I just spoke today, no code. Here are summary notes of whatI recall discussing. We should see working code Friday.I started with a high-level preview of shortest paths andthe three algorithms, as listed in Notes.txt.I defined shortest paths o
Emory - IBS - 574
For today's class we will meet in the computer lab, B28 of the Dental School building. We will go over the following papers. See the blackboard for copies of the papers. Kulkarni-Kale, 2007. Jeenduang, 2008. Jongejan, 2008.We will review new mod
USC - CSCI - 201
/Figure 2-27import java.util.Vector;import Item;class ProducerConsumerMonitor extends Object { private final int N = 5; private int count = 0; private Vector theData; synchronized public void insert(Item data) { whil
USC - CSCI - 201
TYPICAL TRANSMISSIONS FOR ARRIVALS AT LOS ANGELES TOWERSWA111/112-Southwest One Eleven/Twelve LC-2-Local Control Two (North Tower) GC-2-Ground Control Two (North Ground) CD-Clearance DeliverySWA111 Los Angeles Tower, this is Southwest One Eleven fi
Emory - BENSON - 361
PHYSICS 361:Analytical Mechanics I BensonMWF11:45-12:35MAX: 6WRT: NoFor B.A. physics and other mathematical science majors (B.S. physicsmajors should take Physics 361S). More complete mathematicaltreatment of classical mechanics, focusing
Emory - CS - 323000
Reminder: hw4 program due 11:59pm Monday (4/13)There are only about two weeks left, expect only one more regularhomework+program homework, hw5, probably Monday. (If there isanything else, it will only be written or makeup work.)Today we'll go
W. Carolina - PDFS - 304
Advanced Technical Writing Organization A guide for users of a major city library is organized alphabetically. Topics are listed below. Discuss the merits and limitations of alphabetical organization for this document if the readers are first-time us
UMass (Amherst) - CMSTEX - 0544
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>b5300218f10f2e87efa7bdbd80ecf03dc15f29bb.pdf%3Ffile %3Dzv</Key><RequestId>30232869F6772BF1</RequestId><HostId>F8ckQP0vd/73RQG
University of Texas - MIS - 380
Using The Lognormal Random Variable to Model Stock Prices2Using The Lognormal Random Variable to Model Stock PricesIn reality, stock prices can assume any non-negative value. In a binomial tree, of course, only a finite number of stock prices ar
USC - CSCI - 577
Project #8: AAA Petal Pushers Remote R&D Client Meeting Note #6 Date Venue Start time Attendee: Name Chatupoln Taparugssanagorn Ampatcha Satornsantikul Chatchai Sinthop Sattawat Suppalertporn Saranya Iranoppaiboon John Lindsey Apology: Name Ryan Lee
UMass (Amherst) - CMSTEX - 0488
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>081262e20a0e972a572f90cf586ebf5c0058762e.pdf%3Ffile %3Ddu</Key><RequestId>3B3D88EC67A65393</RequestId><HostId>K8lVlKD5XUrVQPp
Emory - E - 411
EMORY UNIVERSITY DEPARTMENT OF ECONOMICS Money and Banking Econ 411 WRInstructor: Stefan Krause (skrause@emory.edu) Classroom: Rich Hall 104 Mon, Wed & Fri 3:00-3:50pmOffice: Rich Hall 321 Off. Hrs.: Mon & Wed 2:00-2:50pm Phone: 404-727-2944Tex
Emory - CS - 0410
GCCCTGTGGTGCCAGTCATAACCCCACGACTCTACTGCCAGACAGTCCGTTGGGCCGTAAAGTCCAGCGCGGCTCGTCATGCTTTGCCAGGCGGATCTCTGTGCTACTGATGAGGGATACTTCCGTCTGACGATAAGTGGAGCGCGGTGGGTTGTGCTGCGTCCATGGTTACCCCTCGTGTAGTCATCTTGAAATTGCGATGGGCACAGGAGCCAAGACCCGATAGTAGTTGTGCGTCCCCGGTAAC
Emory - CS - 0410
ADMINISTRATIVE: Note there are just a bit over two weeks left in thecourse. Expect only one more Perl lab (lab8), probably Monday. If wedo have any other work in the course, it will probably be written, notprogramming. We will have a final exam
USC - CS - 551
Return-Path: william@bourbon.usc.eduDelivery-Date: Wed Sep 3 23:12:15 2008X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.eduX-Spam-Level: X-Spam-Status: No, score=-2.3 required=5.0 tests=AWL,BAYES_00 autolearn=hamversion
UMass (Amherst) - CMSTEX - 7675
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>26056cff7d722f6e4eb85c179cf38fecf0c5e7e8.pdf%3Ffile %3Dou</Key><RequestId>9885A9591B319512</RequestId><HostId>k0jzBl9mjplykCw
USC - CSCI - 577
Quality Management Plan (QMP)Open Source XML Parser-Based Code Count ToolTeam 23Ali Afzal Malik Harsh Nayak Kunal Kulkarni Vannak Touch Naman Modi Matthew Benjamin QMP_IOC1_S06b_T23_V1.2.docProject Manager and Configuration Manager Tester and
W. Carolina - ASSIGN - 401
Style Revision Assignment Due: 1/23 In the following memo, the Vice President of the company (Cindi Tuffboss) required an employee (Billy Joe Bobby Bob) to verify that a co-worker of Billy's (Chris Doe) was falsifying time card data. Basically, Billy
UMass (Amherst) - CMSTEX - 7957
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>305dce5019c0e364c7c7d635ff1734df8b84bb29.pdf%3Ffile %3Ddr</Key><RequestId>40AD95E0135EFE24</RequestId><HostId>RD6bs5Er/Qy5mP0