Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more.
Course Hero has millions of course specific materials providing students with the best way to expand
their education.
Below is a small sample set of documents:
USC - CSCI - 577
Feasibility Evidence Description (FED)Theater Script Online Database Team No 16Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Nory Nishimura Julie SanchezProject Manager / Non-tech Lead / Developer Requirements Engineer / Tech Lea
USC - CSCI - 577
Quality Management Plan (QMP)Theater Script Online DatabaseTeam No 16Quality Management Plan (QMP)Version 9.0Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Nory Kealii Nishimura Julie SanchezNon-technical Lead Requirements
USC - CSCI - 577
System and Software Architecture Description (SSAD)Version 9.0System and Software Architecture DescriptionTheater Script Online Database Team #16Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Nory Kealii Nishimura Julie Sanchez
USC - CSCI - 577
Proposal for Ada to AADL TranslatorFeasibility Rationale Description(FRD)Team# 18Team Members DeWitt Latimer IV Mridu Sethi Nidhi Gulati Sapan Lalani Suprabha Ray Swapnil Patel Vijay KakadiaIndependent Verification & Validation System and Soft
USC - CSCI - 577
Project DetailDue : Monday, December 15, 2008 at 11:59 PM Submission : Post the file under Final Deliverables page in your team website File name : ProjectDetail_20083_Txx.doc (xx is your team no.) -Instruction: Fill in this form. Make sure that the
USC - CSCI - 577
System and Software Requirements Definition (SSRD)Theater Script Online DatabaseTeam No 16Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Sandeep Mikkilineni Nory Kealii Nishimura John Christopher Reynolds Julie SanchezProject M
USC - MEDIA - 1105
<!DOCTYPE html PUBLIC "-/W3C/DTD XHTML 1.0 Strict/EN" "http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"><html xmlns="http:/www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head> <title>Changeset 1105 for tools/DotSceneLoaderTemplate/media/
USC - MISC - 2438
<!DOCTYPE html PUBLIC "-/W3C/DTD XHTML 1.0 Strict/EN" "http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"><html xmlns="http:/www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head> <title>Changeset 2438 for ogre/Tests/OgreMain/misc/ArchiveTes
USC - MISC - 2438
<!DOCTYPE html PUBLIC "-/W3C/DTD XHTML 1.0 Strict/EN" "http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"><html xmlns="http:/www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head> <title>Changeset 2438 for ogre/Tests/OgreMain/misc/ArchiveTes
USC - DOCS - 1876
<!DOCTYPE html PUBLIC "-/W3C/DTD XHTML 1.0 Strict/EN" "http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"><html xmlns="http:/www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head> <title>Changeset 1876 for ogreaddons/3dv/MouZe/docs/WorkingDi
USC - DOCS - 1876
<!DOCTYPE html PUBLIC "-/W3C/DTD XHTML 1.0 Strict/EN" "http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"><html xmlns="http:/www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head> <title>Changeset 1876 for ogreaddons/3dv/MouZe/docs/ReadMe.tx
USC - CS - 556
Broadcast Encryption and Content Protection ApplicationsYu Shiu & Yih-Feng Chen University of Southern CaliforniaOutline Motivation and Application Framework of Broadcast Encryption Solution to Broadcast Encryption: SubsetCover Revocation Algo
USC - CS - 665
Report 4 (MidTerm) Exit Criteria1. A defined process for analyzing the data and creating a report including all the data under "Task 3" page 772. (Compliant with Section 13.2, pgs. 442-444.) a) Including a process script. (Use any PSP script as a "
USC - SCF - 480
480 TITLES GUIDESPRING 2007Policies:1. No "Film-by" Credit or Similar Per School of Cinema-TV policy, the following title presentations are NOT allowed under any circumstances (the following are examples, the list is not conclusive): A John Doe Fi
USC - CSCI - 577
CLIENT INTERACTION REPORT-TEAM# 16Project Name: Theatre Script Online Database Organization Name: JulesTBear's Online ScriptoRama Current System System name: None. What it provides to users A script filing cabinet. A place to keep hard copies of
USC - CSCI - 577
Supporting Information Document (SID)NEW ECONOMICS FOR WOMENTeam No: 11Team members and roles Name Raghava Aditya Ravula Tejaswi Chadalavada Nitin Bandi Adil Fulara Veena Movva Swarag Segu Abbey Sullivan Role Project Manager & SSRD & Meeting Fa
USC - CSCI - 577
Systems and Software Architecture Design (SSAD)Version 1.0Project #14: Early Medieval East Asian TombsSiavash Gholami (Project Manager, FRD) Derek Zimmermann (SSAD) Aviral Mathur (Prototyper) Yasin Angara (OCD) Xiaoyan Zhang (LCP) Sijie Zhang (S
USC - CSCI - 577
Life Cycle Plan (LCP)Youthink.com Video Uploading and Conversion System Team 10Sandarsh M Kumar Project Management Rajen Sarda System Analysis Peter Thompson Operational Concept Description Pius Pack Feasibility Rational Description Stephen Cather
USC - CSCI - 577
Supporting Information Document (SID)LCA Package Version 2.2Personal Care Technology Team 9Team Members: Preeti Agrawal Project Management, LCP Akash Haswani Operational Concept Neha Singla Prototype / Implementation Prateek Tandon Requireme
USC - CSCI - 577
Operational Concept Description (OCD)Video Uploading & Conversion SystemTeam 10Stephen Cathers Tasneem Hakim Sandarsh Kumar Pius Pack Rajen Sarda Peter Thompson John Marshall Dean Robert(Prototyping) (System & Software Requirements Description
USC - CSCI - 577
USCC S EUniversity of Southern CaliforniaCenter for Software EngineeringValue-Based Software Engineering (VBSE) and the Incremental Commitment Model (ICM)Barry Boehm, USC CS 510, 577a Lectures Fall 2008USCC S EUniversity of Southern C
USC - CSCI - 577
COTS Survey COTS Integration Pre-Assignment Survey1. Team Number: 5 2. Is system largely dependent on COTS products?Yes.3. How many COTS products does your proposed system utilize (including operating system)? 5 4. List the members of you
Loyola Marymount - MBAD - 617
Ragsdale's Chpt 3.9 Investment ProblemsProblem: how to design a retirement income portfolio for retirees using corporate bonds? Client has $750,000 in liquid assets to invest A list of upcoming bond issues from 6 companies has been identified and
USC - CC - 2420
ARCHITECTURE=The default LPL implementation uses a packet train with acknowledgementsenabled, shortened backoffs, and a spinning energy checking loop.The default strategy can be improved by implementing a different architecture.Right now the a
Southern Utah - ECON - 2020
Money, Banking and the Financial SectorChapter 13McGrawHill/IrwinCopyright 2001 by The McGrawHill Companies, Inc. All rights reserved.13 2Laugher Curve A central banker walks into a pizzeria to order a pizza. When the pizza is done, he
USC - CSCI - 351
<XMP><HTML><HEAD> <TITLE>Homework #5: List</TITLE> <STYLE type="text/css"> OL { color: Navy; font: bold 16px times new roman; list-style-type: upper-roman; } OL OL { color: Blue; font: bold italic 16px t
Virginia Tech - CS - 4984
33 F.3d 1526 63 USLW 2088, 31 U.S.P.Q.2d 1545 (Cite as: 33 F.3d 1526) RICH, Circuit Judge, with whom: United States Court of Appeals, Federal Circuit In re Kuriappan P. ALAPPAT, Edward E. Averill and James G. Larsen. No. 92-1381. July 29, 1994. *1529
SUNY Potsdam - WIDRICCR - 191
Spanish Vocabulary Practice This is an amazing site that provides a variety of categories to choose from to practice and learn Spanish vocabulary with options of having it pronounced for you. Spanish Verb Conjugations This is an amazing site that all
SUNY Potsdam - GLASERIM - 191
Vocabulary QuizNY State Algebra I Chapter 8 Systems of Equations and Inequalities phschool.com Homework Tutor ata-00801 through ata-0806 Name: _ Date Set TopicsCHA 8-1 CHA 8-2Ata-0851 Chapter Test PracticeAssignmentJournal Find the errorZe
University of Texas - BIO - 301
name (required) _revise 2. (4pts) Why is it difficult to measure the harmful effects of the levels and types of ionizing radiation that we think is most relevant to our population? MTF A) Sample size: too few people are exposed to any dose of ionizi
University of Texas - BIO - 301
name _ (required)Exam 4, Bio301D, 6 Dec 061. (4 pts) Key code, box #, and name. Fill in (A B) to indicate your key for this version of the exam. Be sure your name and box number are correctly bubbled in on the scantron and that you have signed th
Alverno College - CS - 270
Finding Your Inner Flyor How Do I Find My Inner Calling and Integrate It Into a Career?What's My Inner Fly?Human fruit flies often seem genetically predisposed to do what they do Instinctively combine their passions with their aptitudesThe r
UMass (Amherst) - CMSTEX - 7427
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>d45388c39de57138e50b0c9c7f576e503d4a146b.pdf%3Ffile %3Dga</Key><RequestId>C54CA1FF88F18B1A</RequestId><HostId>XC9Y3bs5njIkwgF
UMass (Amherst) - CMSTEX - 6757
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>376d9e7e270963f427b491168cab228bef0ea56c.pdf%3Ffile %3Dka</Key><RequestId>B3BFDEA49E0E623F</RequestId><HostId>2ildKFi1Y4DZcYB
SUNY Potsdam - JOHNSOJD - 190
NY State Algebra I Chapter 8 Systems of Equations and Inequalities phschool.com hh Homework Tutor ata0801 through ata0806Vocabulary Quiz Ata-0851 Chapter Test Practice Ata-0852Name: _SetCHA 8-1 CHA 8-2 CHA 8-3 CHA 8-4 CHA 8-5 CHA 8-7DateTo
W. Carolina - CS - 361
8 6 world x and y dims0 0 -3 viewpoint (x, y, z)14 plane2 2 2 r g b ambient6 6 6 r g b diffuse0 0 0 r g b specular0 1 0 normal0 -4 0 point13 sphere1 1 1
W. Carolina - CS - 361
8 6 world x and y dims0 0 -3 viewpoint (x, y, z)14 plane0.0 0.0 0.0 amb, diffuse, spec2.6 2.0 0.0 amb, diffuse, spec0.7 0.7 0.7 amb, diffuse, spec0 1 0 normal0 -4 0 point16
Emory - CS - 323000
I fixed Notes.txt ("Cut Property" and "Cycle Property" were reversed).We did not do the correctness of Prim's algorithm, but it is a prettysimple consequence of the Cut Property. We'll talk about performancenext time.
Emory - CS - 153000
See the lab6 handout for an explanation.
Emory - CS - 153000
We had to edit lcs.pl during class to make it work, filelcs.pl.orig is the original version. It has "lcs_cache" inone place, instead of "llcs_cache", and no "use strict"which would have caught the error.The original version falls back into the
Emory - CS - 0126
In class I edited ./0123/hw1.pl with the resulting file"hw1-nodefault.pl", so we did not look at the prepared file"hw1-rewrite.pl" (and the "Tom Toady" motto).We did look at example5-6.pl and example5-7.pl, but (as Iexpected) we did not have tim
Emory - CS - 323000
I just spoke today, no code. Here are summary notes of whatI recall discussing. We should see working code Friday.I started with a high-level preview of shortest paths andthe three algorithms, as listed in Notes.txt.I defined shortest paths o
Emory - IBS - 574
For today's class we will meet in the computer lab, B28 of the Dental School building. We will go over the following papers. See the blackboard for copies of the papers. Kulkarni-Kale, 2007. Jeenduang, 2008. Jongejan, 2008.We will review new mod
USC - CSCI - 201
/Figure 2-27import java.util.Vector;import Item;class ProducerConsumerMonitor extends Object { private final int N = 5; private int count = 0; private Vector theData; synchronized public void insert(Item data) { whil
USC - CSCI - 201
TYPICAL TRANSMISSIONS FOR ARRIVALS AT LOS ANGELES TOWERSWA111/112-Southwest One Eleven/Twelve LC-2-Local Control Two (North Tower) GC-2-Ground Control Two (North Ground) CD-Clearance DeliverySWA111 Los Angeles Tower, this is Southwest One Eleven fi
Emory - BENSON - 361
PHYSICS 361:Analytical Mechanics I BensonMWF11:45-12:35MAX: 6WRT: NoFor B.A. physics and other mathematical science majors (B.S. physicsmajors should take Physics 361S). More complete mathematicaltreatment of classical mechanics, focusing
Emory - CS - 323000
Reminder: hw4 program due 11:59pm Monday (4/13)There are only about two weeks left, expect only one more regularhomework+program homework, hw5, probably Monday. (If there isanything else, it will only be written or makeup work.)Today we'll go
W. Carolina - PDFS - 304
Advanced Technical Writing Organization A guide for users of a major city library is organized alphabetically. Topics are listed below. Discuss the merits and limitations of alphabetical organization for this document if the readers are first-time us
UMass (Amherst) - CMSTEX - 0544
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>b5300218f10f2e87efa7bdbd80ecf03dc15f29bb.pdf%3Ffile %3Dzv</Key><RequestId>30232869F6772BF1</RequestId><HostId>F8ckQP0vd/73RQG
University of Texas - MIS - 380
Using The Lognormal Random Variable to Model Stock Prices2Using The Lognormal Random Variable to Model Stock PricesIn reality, stock prices can assume any non-negative value. In a binomial tree, of course, only a finite number of stock prices ar
USC - CSCI - 577
Project #8: AAA Petal Pushers Remote R&D Client Meeting Note #6 Date Venue Start time Attendee: Name Chatupoln Taparugssanagorn Ampatcha Satornsantikul Chatchai Sinthop Sattawat Suppalertporn Saranya Iranoppaiboon John Lindsey Apology: Name Ryan Lee
UMass (Amherst) - CMSTEX - 0488
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>081262e20a0e972a572f90cf586ebf5c0058762e.pdf%3Ffile %3Ddu</Key><RequestId>3B3D88EC67A65393</RequestId><HostId>K8lVlKD5XUrVQPp
Emory - E - 411
EMORY UNIVERSITY DEPARTMENT OF ECONOMICS Money and Banking Econ 411 WRInstructor: Stefan Krause (skrause@emory.edu) Classroom: Rich Hall 104 Mon, Wed & Fri 3:00-3:50pmOffice: Rich Hall 321 Off. Hrs.: Mon & Wed 2:00-2:50pm Phone: 404-727-2944Tex
Emory - CS - 0410
GCCCTGTGGTGCCAGTCATAACCCCACGACTCTACTGCCAGACAGTCCGTTGGGCCGTAAAGTCCAGCGCGGCTCGTCATGCTTTGCCAGGCGGATCTCTGTGCTACTGATGAGGGATACTTCCGTCTGACGATAAGTGGAGCGCGGTGGGTTGTGCTGCGTCCATGGTTACCCCTCGTGTAGTCATCTTGAAATTGCGATGGGCACAGGAGCCAAGACCCGATAGTAGTTGTGCGTCCCCGGTAAC
Emory - CS - 0410
ADMINISTRATIVE: Note there are just a bit over two weeks left in thecourse. Expect only one more Perl lab (lab8), probably Monday. If wedo have any other work in the course, it will probably be written, notprogramming. We will have a final exam
USC - CS - 551
Return-Path: william@bourbon.usc.eduDelivery-Date: Wed Sep 3 23:12:15 2008X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.eduX-Spam-Level: X-Spam-Status: No, score=-2.3 required=5.0 tests=AWL,BAYES_00 autolearn=hamversion
UMass (Amherst) - CMSTEX - 7675
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>26056cff7d722f6e4eb85c179cf38fecf0c5e7e8.pdf%3Ffile %3Dou</Key><RequestId>9885A9591B319512</RequestId><HostId>k0jzBl9mjplykCw
USC - CSCI - 577
Quality Management Plan (QMP)Open Source XML Parser-Based Code Count ToolTeam 23Ali Afzal Malik Harsh Nayak Kunal Kulkarni Vannak Touch Naman Modi Matthew Benjamin QMP_IOC1_S06b_T23_V1.2.docProject Manager and Configuration Manager Tester and
W. Carolina - ASSIGN - 401
Style Revision Assignment Due: 1/23 In the following memo, the Vice President of the company (Cindi Tuffboss) required an employee (Billy Joe Bobby Bob) to verify that a co-worker of Billy's (Chris Doe) was falsifying time card data. Basically, Billy
UMass (Amherst) - CMSTEX - 7957
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>305dce5019c0e364c7c7d635ff1734df8b84bb29.pdf%3Ffile %3Ddr</Key><RequestId>40AD95E0135EFE24</RequestId><HostId>RD6bs5Er/Qy5mP0
Allan Hancock College - LNGS - 1005
Writing in an academic style Academic writing tends to be authoritative and objective: the language is formal, technical and impersonal. Academic spoken English is also technical, but slightly less formal and impersonal. The features of spoken and wr