42 Pages

LCP_IOC1_S09b_T16_V9.0

Course: CSCI 577, Fall 2009
School: USC
Rating:
 
 
 
 
 

Word Count: 8135

Document Preview

Cycle Life Plan (LCP) Theater Script Online Database Team No 16 Jae Young Bang Gary Lam Shi Heng Guan Young Chan Noh Ka Ho Au Nory Kealii Nishimura Julie Sanchez Non-technical Lead/Builder Tester/Technical Lead Planning and Control Engineer System Architect Builder IIV&V / Quality Lead Client April 2nd, 2009 Life Cycle Plan (LCP) _ Team 16 Version 9.0 Version History ii Life Cycle Plan (LCP) _...

Register Now

Unformatted Document Excerpt

Coursehero >> California >> USC >> CSCI 577

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Cycle Life Plan (LCP) Theater Script Online Database Team No 16 Jae Young Bang Gary Lam Shi Heng Guan Young Chan Noh Ka Ho Au Nory Kealii Nishimura Julie Sanchez Non-technical Lead/Builder Tester/Technical Lead Planning and Control Engineer System Architect Builder IIV&V / Quality Lead Client April 2nd, 2009 Life Cycle Plan (LCP) _ Team 16 Version 9.0 Version History ii Life Cycle Plan (LCP) _ Team 16 Date 9/21/08 Author Shi Heng Guan Versio n 1.0 Changes made Original template for use in ICM EPG Rationale Version 9.0 Initial draft for use with ICM EPG Elaboration of Section 1, 2, 3.3 10/5/08 Shi Heng Guan Shi Heng Guan 2.0 Update Section 3.3 Set the accurate skills everyone need for the system After collecting team view of each responsibility. It was group up to the more convenient ones. The base approach to monitor and review the documentation and project is describe Update details Update tables Estimation of COCOMO v1 10/05/0 8 2.1 Add Responsibility by Phases, Section 3.2 10/11/0 8 Shi Heng Guan 2.2 Describe Approach 10/13/0 8 10/19/0 8 Shi Heng Guan Shi Heng Guan 3.0 Completion of missing section 3.1 Evaluation Corrections on sections 1.3 and 3.3 The status is updated Maintainer roles is added Suggested assumption is added 10/21/0 8 10/27/0 8 10/27/0 8 11/08/0 8 11/13/0 8 11/19/0 8 11/23/0 8 11/24/0 8 11/29/0 8 12/08/0 8 Shi Heng Guan Shi Heng Guan Shi Heng Guan Shi Heng Guan Shi Heng Guan Shi Heng Guan Shi Heng Guan Shi Heng Guan Shi Heng Guan Shi Heng Guan 3.2 3.3 4.0 4.1 Update section 3.3 Update section 3.3 Update section 5 Updated section 5 Error correction and removal 577b roles incorporated Update 577b roles Update COCOMO II Added table 26 for better reference Update section 1.3 List type of users 3.1 Add detail on section 5 4.2 4.3 4.4 5.0 5.1 6.0 Update section 2.3 Update section 5 Update section 5 Review Update section 5 Status update Add missing development phase deliverable Create new COCOMO estimate Consistence with SSAD Minor corrections Minor changes on naming modules in COCOMO Final check on document 2943238cf290f3387d3c727a2eec9d74506d9339.doc iii Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Date 02/06/0 9 02/07/0 9 02/08/0 9 02/18/0 9 02/23/0 9 04/02/0 9 Author Shi Heng Guan Shi Heng Guan Shi Heng Guan Shi Heng Guan Shi Heng Guan Shi Heng Guan Versio n 6.1 6.2 7.0 7.1 8.0 9.0 Changes made Update plans Verify content Update section 5 Correction Update status Update section 5 Rationale Update status Correct dates Version 9.0 Corrected LCP using feedbacks New COCOMO estimate for CCD Correct divergence on dates Final touch for RDCR COCOMO with Code Count calibration 2943238cf290f3387d3c727a2eec9d74506d9339.doc iv Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version 9.0 Table of Contents Life Cycle Plan (LCP)....................................................................................................................................................i ....................................................................................................................................................................i Version History.............................................................................................................................................................ii Table of Contents..........................................................................................................................................................v Table of Tables.............................................................................................................................................................vi Table of Figures..........................................................................................................................................................vii Introduction..............................................................................................................................................................1 A.1.1 Purpose of the LCP ..................................................................................................................................1 A.1.2 Status of the LCP .....................................................................................................................................1 A.1.3 Assumptions...............................................................................................................................................1 Milestones and Products..........................................................................................................................................2 A.1.4 Overall Strategy........................................................................................................................................2 A.1.5 Phases.........................................................................................................................................................4 A.1.6 Project Deliverables..................................................................................................................................4 Responsibilities.......................................................................................................................................................11 A.1.7 Project-specific stakeholder's responsibilities......................................................................................11 12 A.1.8 Responsibilities by Phase........................................................................................................................12 A.1.9 Skills.........................................................................................................................................................18 Approach.................................................................................................................................................................20 A.1.10 Monitoring and Control.......................................................................................................................20 A.1.11 Methods, Tools and Facilities...............................................................................................................22 22 A.2. Resources.........................................................................................................................................................23 2943238cf290f3387d3c727a2eec9d74506d9339.doc v Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version 9.0 Table of Tables Table 1: Milestone on Different Phases.......................................................................................................................4 Table 2: Artifact Deliverable in Exploration Phase...................................................................................................4 Table 3: Artifact Deliverable in Valuation Phase......................................................................................................6 Table 4: Artifact deliverable in Foundations Phase part 1/2....................................................................................7 Table 5: Artifact deliverable in Rebaseline (Foundations Phase part 2/2)..............................................................8 Table 6: Artifact deliverable in Development Phase-Construction Iteration.........................................................9 Table 7: Artifact deliverable in Development Phase-Transition Iteration............................................................10 Table 8: Project Specific Stakeholder's Responsibilities.........................................................................................11 Table 9: Project Manager's Responsibilities by Phases..........................................................................................12 Table 10: Operational Concept Engineer's Responsibility by Phases...................................................................13 Table 11: Requirement Engineer's Responsibility by Phases.................................................................................13 Table 12: Planning and Control Engineer's Responsibility by Phases..................................................................14 Table 13: System Architect's Responsibilities by Phases........................................................................................14 Table 14: Prototyper's Responsibility by Phases.....................................................................................................15 Table 15: IIV&V-QFP's Responsibilities by Phases................................................................................................16 Table 16: IIV&V-RE's Responsibilities by Phases..................................................................................................16 Table 17: Authorized Stakeholder Representatives................................................................................................18 Table 18: Required Skills of each member of the Team on 577a...........................................................................18 Table 19: Required Skills of each member of the Team on 577b...........................................................................19 Table 20: Require Skills for maintainer...................................................................................................................19 Table 21: Tools for the Project..................................................................................................................................22 Table 22: COCOMOII Scale Driver.........................................................................................................................23 Table 23: COCOMOII Cost Driver Module 1 - Login............................................................................................24 Table 24: COCOMOII Cost Driver Module 2 Administrator Profile Management.........................................25 Table 25: COCOMOII Cost Driver Module 3 Search Script..............................................................................26 Table 26: COCOMOII Cost Driver Module 4 User Interface (View Script).....................................................27 Table 27: COCOMOII Cost Driver Module 5 Account Creation.......................................................................28 Table 28: COCOMOII Cost Driver Module 6 Script Management...................................................................29 Table 29: SLOC of the System...................................................................................................................................31 vi Life Cycle Plan Table of Contents Table of Figures Figure 1: ICM Phases and Calendar Distribution ....................................................................................................3 Figure 2: COCOMO Estimate Model.......................................................................................................................32 Figure 3: COCOMO for CCD...................................................................................................................................33 Figure 4: CCD COCOMO Estimation with Unified Code Count..........................................................................34 2943238cf290f3387d3c727a2eec9d74506d9339.docvii Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 Introduction A.1.1 Purpose of the LCP The purpose of the present Life Cycle Plan (LCP) document is to provide assistance in monitoring and managing the project and its progress. It is extremely important to allocate the correct amount of people and resources into the right area of the project. This document will help setting a plan to walkthrough all the phases of the ICM in the life cycle of developing the system. It will also provide a vision of where each member is now in this development process and what is his/hers next step and the understanding of the entire system. A.1.2 Status of the LCP The status of the LCP is currently at the middle of development phase and preparing for transition. This LCP goes in the Initial Operational Capability Set 1. All of the artifacts are completed for planning and updated according to changes. The client ideas of the system are understood and she has provided adequate hardware necessary for setup and client is satisfied so far with prototype. The progress have been checked by the client and approved by the client. Every document will be improved on the present packages to refine requirements, design and issues on the development. A.1.3 Assumptions These are our assumptions: The total time of development is 24 weeks split in CS577a and CS577b, 12 weeks each. Everyone will be working at least 12 hours a week on the project. No major changes will be seen after the WikiWinWin Negotiation. Six team members will finish the project on CS577b. A computer unit will be provided to be the server of the system with connection to the web and a scanner; no other hardware interfacing will be involved. All documentation and product will follow the guidelines of ICM EPG. The client will provide us feedback. She also will coordinate with us on the project meetings. The client takes the position of administrator and maintainer of the system. There will be a small amount on the budget for the project. OCR does not directly interact with the system. 2943238cf290f3387d3c727a2eec9d74506d9339.doc 1 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 Milestones and Products A.1.4 Overall Strategy The overall strategy is based on the time factor, which is unchangeable since it has to adjust in two semesters school time. Therefore, we will prioritize client requirements with the Schedule As Independent Variable (SAIV) method. We set the main requirements of the system as initial operation capabilities and consider the rest to be extra features, given by the priority of each requirement. Since requirements will be changing throughout the process of development, the Incremental Commitment Model (ICM) is the best method that works with changing requirements over time as the client comes up with new win conditions. Major changes on the definition of the system and scope of the system are done during the first semester and mainly during negotiations. Through negotiation and client meetings we will shape a clear idea of the system. During the spring semester minor corrections to the system will be made. Major milestones on our system: Valuation Commitment Review (VCR) Foundations Commitment Review (FCR) Development Commitment Review (DCR) Rebaselined Development Commitment Review (RDCR) Core Capability Drive-through (CCD) Transition Readiness Review (TRR) Operation Commitment Review (OCR) The phases are laid clearly on the following figure: 2943238cf290f3387d3c727a2eec9d74506d9339.doc 2 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Figure 1: ICM Phases and Calendar Distribution Version No 9.0 *The phases, milestones and ideas are taken from the ICM EPG and the example it provides [1] 2943238cf290f3387d3c727a2eec9d74506d9339.doc 3 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 A.1.5 Phases The list of milestones at the end of each phase according to schedule: Table 1: Milestone on Different Phases Milestone Valuation Commitment Review Foundations Commitment Review Development Commitment Review Rebaselined Development Commitment Review (RDCR) Core Capability Drive-through (CCD) Transition Readiness Review (TRR) Operation Commitment Review (OCR) Product Delivery Date 09/22/2008 10/23/2008 12/01/2008 02/11/2009 03/24/2009 04/15/2009 04/29/2009 05/04/2009 The complete schedule that includes all the tasks is updated on our website. The link provides the index of MS Projects files. Click on the most recent one: http://greenbay.usc.edu/csci577/spring2009/projects/team16/PR/index.html A.1.6 Project Deliverables .1.6.1 Exploration Phase Table 2: Artifact Deliverable in Exploration Phase Artifact Client Interaction Report Valuation Commitment Package: Operational Concept Description (OCD) Life Cycle Plan (LCP) Feasibility Evidence Description (FED) Evaluation of VC Package Individual Effort Report Progress Report MS Project Risk Analysis Due date 9/17/2008 9/22/2008 Format .doc and .pdf .doc and .pdf Medium Soft copy Soft copy 09/29/2008 Every Monday Every Wednesday Every Wednesday Every Wednesday .doc, .xls Text .xls .mpp Text Soft copy ER System Soft copy Soft copy DART system 2943238cf290f3387d3c727a2eec9d74506d9339.doc 4 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 Client Meeting Notes After Meetings .doc, .pdf Soft copy 2943238cf290f3387d3c727a2eec9d74506d9339.doc 5 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 .1.6.2 Valuation Phase Table 3: Artifact Deliverable in Valuation Phase Artifact Initial Prototype Core Foundations Commitment (FC) Package: OCD LCP FED System and Software Requirements Definition (SSRD) Supporting Information Document (SID) Evaluation of Initial Prototype WikiWinWin Report Draft FC Package: OCD LCP FED SSRD SID UML Model System and Software Architecture Description (SSAD) Evaluation of Core FC Package Response to Evaluation of Core FC Package Evaluation of Draft FC Package FC Package: OCD LCP FED SSRD SID UML Model SSAD Quality Management Plan #1 Response to Evaluation of Draft FC Package Evaluation of FC Package Due date 09/29/2008 10/05/2008 Format .doc, .pdf .doc, .pdf Medium Soft copy Soft copy 10/05/2008 10/08/2008 10/13/2008 .doc, .xls .doc, .pdf .doc, .pdf, .ras Soft copy Soft copy Soft copy 10/13/2008 10/17/2008 10/20/2008 10/27/2008 .doc, .pdf .doc, .xls .doc, .xls .doc, .pdf, .ras Soft copy Soft copy Soft copy Soft copy 10/27/2008 10/29/2008 11/03/2008 .doc, .pdf .doc, .xls .doc, .xls Soft copy Soft copy Soft copy 2943238cf290f3387d3c727a2eec9d74506d9339.doc 6 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 Response to Foundations Commitment Package Evaluation Individual Effort Report Progress Report MS Project Risk Analysis Client Meeting Notes 11/10/2008 Every Monday Every Wednesday Every Wednesday Every Wednesday After Meetings .doc, .xls text .xls .mpp text .doc, .pdf Soft copy ER System Soft copy Soft copy DART system Soft copy .1.6.3 Foundations Phase Table 4: Artifact deliverable in Foundations Phase part 1/2 Artifact Update WikiWinWin Report COTS Integration Analysis Quality Management Plan (QMP) #2 Draft Development Commitment (DC) Package: OCD LCP FED SSRD SID UML Model SSAD QMP Acceptance Test Plan and Cases (ATPC) Transition Plan (TP) Iteration Plan (IP) Evaluation of Draft DC Package Response to Draft DC Package Evaluation DC Package: OCD LCP FED SSRD SID UML Model SSAD Due date 11/10/2008 11/14/2008 11/17/2008 11/24/2008 Format .doc, .pdf .doc, .pdf .doc, .pdf .doc, .pdf, .ras Medium Soft copy Soft copy Soft copy Soft copy 12/1/2008 12/10/2008 12/8/2008 .doc, .xls .doc, .xls .doc, .pdf, .ras Soft copy Soft copy Soft copy 2943238cf290f3387d3c727a2eec9d74506d9339.doc 7 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 QMP ATPC TP IP Evaluation of DC Package Project Archiving Individual Effort Report Progress Report MS Project Risk Analysis Client Meeting Notes 12/15/2008 12/15/2008 Every Monday Every Wednesday Every Wednesday Every Wednesday After Meetings .doc, .pdf .doc, .pdf text .xls .mpp text .doc, .pdf Soft copy Soft copy ER System Soft copy Soft copy DART system Soft copy *The tables' dates are taken from assignment page [2] The deliverables for 577b, which corresponds to spring 2009, are the following: Table 5: Artifact deliverable in Rebaseline (Foundations Phase part 2/2) Artifact Prototype (part of OCD) Draft Development Commitment Package (Draft Rebaselined DC Package): Elaborated and updated fall Development Commitment Package Development Commitment Package (DC Package): Elaborated and updated Draft Development Commitment Package Evaluation of Draft Rebaselined Development Commitment (RDC) Package Response Evaluation of Draft RDC Evaluation of RDC Package Evaluation of RDC Package Individual Effort Report Progress Report MS Project Risk Analysis Client Meeting Notes Due date 02/09/2009 02/09/2009 Format .doc, .pdf .doc, .pdf, .ras Medium Soft copy Soft copy 02/20/2009 .doc, .pdf, .ras Soft copy 02/18/2009 02/25/2009 03/02/2009 03/09/2009 Every Monday Every Wednesday Every Wednesday Every Wednesday Every Wednesday .doc, .xls .doc, .xls .doc, .xls .doc, .xls text .xls .mpp text .doc, .pdf Soft copy Soft copy Soft copy Soft copy ER System Soft copy Soft copy DART system Soft copy 2943238cf290f3387d3c727a2eec9d74506d9339.doc 8 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 .1.6.4 Development Phase This section will be updated when more precise information is obtained. Table 6: Artifact deliverable in Development Phase-Construction Iteration Artifact Initial Operational Capability (IOC) Working Set #1: Quality Management Plan (QMP) Iteration Plan (IP) Top-level Test Plan and Cases (TPC) Core Capability Drivethrough (CCD) report IOC Working Set #2: Updated QMP Updated IP Updated TPC Transition Preparation Plan (TP) IOC Working Set #3: Updated IOC Working set #2 TP Test Procedures and Result (TPR) Iteration Assessment Report (IAR) Draft Transition Package Transition Plan (TP) User Manual (UM) Support Plan (SP) Training Materials Regression Test Package (RTP) Individual Effort Report Due date 03/10/2009 Format .doc, .pdf Medium Soft copy 04/03/2009 04/03/2009 .doc, .pdf .doc, .pdf Soft copy Soft copy 04/17/2009 .doc, .pdf Soft copy 04/13/2009 .doc, .pdf Soft copy Every Monday text ER System 2943238cf290f3387d3c727a2eec9d74506d9339.doc 9 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 Progress Report MS Project Risk Analysis Client Meeting Notes Every Wednesday Every Wednesday Every Wednesday Every Wednesday .xls .mpp text .doc, .pdf Soft copy Soft copy DART system Soft copy Table 7: Artifact deliverable in Development Phase-Transition Iteration Artifact Support and Transition Set Updated Draft Transition Package Operations Commitment Package Project Archiving: Source Code Files Executable Components Release Description Individual Effort Report Progress Report MS Project Risk Analysis Client Meeting Notes Due date 04/20/2009 4/27/2009 5/01/2009 Format .doc, .pdf .doc, .pdf .doc, .pdf, .zip Medium Soft copy Soft copy Soft copy Every Monday Every Wednesday Every Wednesday Every Wednesday Every Wednesday text .xls .mpp text .doc, .pdf ER System Soft copy Soft copy DART system Soft copy 2943238cf290f3387d3c727a2eec9d74506d9339.doc10 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 Responsibilities A.1.7 Project-specific stakeholder's responsibilities Table 8: Project Specific Stakeholder's Responsibilities Role All Stakeholders Responsibilities Contribute to the WikiWinWin negotiations Attend weekly meeting and commitment review Be responsible for assigned tasks and assist with secondary responsibilities Provide win conditions Test prototype and provide feedback Users: Staff/Actors Administrator Client Prepare for meetings with development team Inform about current system Coordinate with development team and users Provide information and feedback, review and test the product Test and deploy the product. Define system hardware Be able to take charge after transition phase Receive training for the new system Record and converge all stakeholders' win conditions Gather information regarding current system and provide initial architecture Initiate and complete WikiWinWin negotiation. Produce new architecture for system Build prototype and produce project plan. Build system according to design Report progress to client Meet exit criteria on project documentations Do testing before giving it to client Give training for client/maintainer Verify and validate the project Review and provide feedback to the development team Check quality of the system Developer IIV&V 2943238cf290f3387d3c727a2eec9d74506d9339.doc11 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 Maintainer Receive training for the new system Provide maintenance of the system Update all software that needs upgrade. A.1.8 Responsibilities by Phase The following tables will show more specific details of each member of the development team Table 9: Project Manager's Responsibilities by Phases Stakeholder: Role Primary/ Secondary Exploration Jae Young Bang: Project Manager/ Operational Concept Engineer 577b: Project Manager/ Builder Primary Responsibility Secondary Responsibility Set up an efficient Analyze current system communication route with client and IIV&Vs Arrange responsibility to development team members Set up team meetings and client meetings Monitor project weekly progress Coordinate with all stakeholders Manage project Arrange WikiWinWin negotiations sessions Review artifacts Manage project Coordinate with all stakeholders Prepare team for development phase Evaluate and organize team Coordinate with all stakeholders Manage project Coordinate with all stakeholders Prepare for transition Manage project Coordinate with all stakeholders Verify system final deliverable Define Operational Concepts Valuation Foundations Review artifacts Assess Operational Concepts Rebaseline DevelopmentConstruction Analyze prototype and UML Create front end user interface Assist with programming the modules Provide training DevelopmentTransition 2943238cf290f3387d3c727a2eec9d74506d9339.doc12 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Table 10: Operational Concept Engineer's Responsibility by Phases Version No 9.0 Stakeholder: Role Primary/ Secondary Exploration Sandeep Mikkilineni: Operational Concept Engineer / LCP/ Learning Facilitator 577b: N/A Primary Responsibility Secondary Responsibility Analyze current system and its Analyze core capabilities environment Form a shared vision for concept system Valuation Identify and establish operational concepts Set project scope Assist prototyper on the prototype for the proposed system Assess the OCD Refine OCD and prepare for development phase Ensure that project matches operational concept Assist on estimation of cost Facilitate team learning of the project Foundations Assist updating Life Cycle Plan Review artifacts Table 11: Requirement Engineer's Responsibility by Phases Stakeholder: Role Primary/ Secondary Exploration Gary Lam: Requirements Engineer / Feasibility Analyst/ 577b: Tester Primary Responsibility Secondary Responsibility Analyze current system Explore risks that may exist in creating the new system Analyze main capabilities Provide ways to mitigate risk Analyze final WIOA Negotiation agreements Prioritize Requirements Convert Agreements on negotiation to requirements Generate requirements definitions Assess requirement definition Ensure that the prototype covers all requirements. Identify missing requirements Remove requirements that are no longer deemed necessary. Generate testing plans Look at return on investment and continue to assess old risks along with any new risks Assess and address any risks that still exist and mitigate them Valuation Foundations Rebaseline Review requirement specifications Assess and address any risks that still exist and mitigate them Review requirements and prioritize them 2943238cf290f3387d3c727a2eec9d74506d9339.doc13 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 DevelopmentConstruction DevelopmentTransition Prepare testing environment Perform module testing Review consistency between developed modules and documents Perform final test Correct any documentation according to client needs Help produce support documentation Table 12: Planning and Control Engineer's Responsibility by Phases Stakeholder: Role Primary/ Secondary Exploration Shi Heng Guan: LCP/ Software Architect/ Assistant Shaper 577b: LCP/ Tester Primary Responsibility Secondary Responsibility Understand deliverable artifacts Coordinate with clients and team members Identify responsibilities and skills Draft project plan Coordinate with development team Assist Project Manager in generating project life cycle plan Estimate cost of software with COCOMO II Review milestone and products Optimize life cycle plan Refine cost estimation Review milestone and products Provide a more detail planning per iteration Generate detailed planning for transition Perform final testing Provide support for transition Converge Win Conditions Assist drafting UML models of the system Resolve Conflict on WIOA Negotiation Valuation Foundations Rebaseline DevelopmentConstruction DevelopmentTransition Plan for testing Coordinate with team members Assist on testing criteria Assist on testing Setup system Table 13: System Architect's Responsibilities by Phases Stakeholder: Role Primary/ Secondary Exploration Young Chan Noh: System Architect / Prototyper 577b: Designer/Builder (577b) Primary Responsibility Secondary Responsibility Analyze current system Set up DART Record and organize risk Explore platforms, databases, languages, and servers to be used. Identify possible COTS products 2943238cf290f3387d3c727a2eec9d74506d9339.doc14 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 Valuation Propose system architecture Determine useful COTS for the system Define Technology independent Architecture Draft UML design for the system Define system architecture Define Architecture Style, Patterns and Frameworks Optimize UML design Revise prototype Update system architecture Design modules Integrate modules Prepare for system release Provide support for transition Assist in creation of initial prototype Foundations Improve prototype Rebaseline DevelopmentTransition DevelopmentConstruction Review Prototype Perform integration testing Setup system Table 14: Prototyper's Responsibility by Phases Stakeholder: Role Primary/ Secondary Exploration Valuation Ka Ho Au: Prototyper / Requirement Engineer 577b: Programmer Primary Responsibility Secondary Responsibility Establish new operational Analyze core capabilities concepts Brainstorm requirements Explore ways to design the user interface and acquire required capabilities of product Establish new operational Assist generation of concepts requirements definitions Develop low-fidelity prototype Optimize Prototype Revise prototype Keep the UML model consistent with the prototype Ensure prototype captures all the requirements Improve Prototype and correct according to changes in requirements Develop modules Integrate modules Perform final testing Provide support for transition Review requirement specification Foundations Rebaseline DevelopmentConstruction DevelopmentTransition Review system architecture Perform integration testing Setup system 2943238cf290f3387d3c727a2eec9d74506d9339.doc15 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 Table 15: IIV&V-QFP's Responsibilities by Phases Stakeholder: Role Primary/ Secondary Exploration Nory Nishimura: Integrated & Independent Validation and Verification/ Quality Focal Point/ Quality Focal Point 577b: IV&V/ Tester Primary Responsibility Secondary Responsibility Analyze project business cases Give input to the project with an emphasis on quality Assess possible risks Verify and validate all project artifacts Generate first quality management plan Identify configuration management Generate defect/issue logs Refine quality management plan Identify configuration management strategy Assess quality management strategy Review all documentation Assist preparing final documentations Prepare for final release Valuation Foundations Verify and validate project artifacts Rebaseline DevelopmentConstruction DevelopmentTransition Update QMP Verify and validate project artifacts Perform testing Prepare for system release Provide support for transition Table 16: IIV&V-RE's Responsibilities by Phases Stakeholder: Role Primary/ Secondary Exploration Valuation John Reynolds: Integrated & Independent Validation and Verification/ Requirement Engineer/ Shaper 577b: N/A Primary Responsibility Secondary Responsibility Understand current system Understand what client desires in system Shape WikiWinWin negotiation Define requirements Verify and validate project artifacts Generate Requirement definitions Generate WikiWinWin report Verify and validate project Prepare acceptance test cases Foundations 2943238cf290f3387d3c727a2eec9d74506d9339.doc16 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 artifacts Update WikiWinWin report 2943238cf290f3387d3c727a2eec9d74506d9339.doc17 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 Table 17: Authorized Stakeholder Representatives Stakeholders Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Nory Kealii Nishimura Julie Sanchez Category Developers Organization University of Southern California (USC) Client/ Administrator/ Maintainer JulesTBear's Online Scripto-Rama A.1.9 Skills Table 18: Required Skills of each member of the Team on 577a Team members Jae Young Bang Shi Heng Guan Role primary/secondary Project Manager/Operational Concept Engineer Planning and Control Engineer/ System Architect/ Assistant Shaper Operational Concept Engineer/ Planning and Control Engineer, Learning Facilitator Requirements Engineer/ Feasibility Analyst/ Website Administrator System Architect/ Prototyper/ DART manager Prototyper/ Requirement Engineer IIV&V / QFP IIV&V/ SRE / Shaper Sandeep Mikkilineni Skills Project Management, configuration management Project coordination, MS Project, COCOMO, WikiWinWin-J, UML, JAVA, RSM, JSP Project coordination, MS Project, COCOMO, Motivation for learning WikiWinWin-J, Analysis of Requirements, configuration management, Analysis and Management of Risk UML, JAVA, MySQL, Apache, RSM, DART management, JSP UML, JAVA, MySQL, Apache, WikiWinWin-J, RSM, JSP, OCR integration Quality Management, Agile Artifact Review WikiWinWin-J, Agile Artifact Review Gary Lam Young Chan Noh Ka Ho Au Nory Kealii Nishimura John Christopher Reynolds 2943238cf290f3387d3c727a2eec9d74506d9339.doc18 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Table 19: Required Skills of each member of the Team on 577b Version No 9.0 Team members Jae Young Bang Role primary/secondary Project Manager/ Builder Gary Lam Young Chan Noh Ka Ho Au Nory Kealii Nishimura Shi Heng Guan Tester System Architect/ Builder Builder IIV&V / QFP/Tester LCP/ Tester Skills Project Management, configuration management, UML, JAVA, MySQL, Apache, JSP UML, JAVA, MySQL, Apache, JSP UML, JAVA, MySQL, Apache, RSM, DART management, JSP UML, JAVA, MySQL, Apache, JSP Quality Management, Agile Artifact Review Project coordination, MS Project, JAVA, MySQL, Apache, JSP, OCR, COCOMO II * The client confirmed that she would take the position of maintainer on the system. We take this into consideration so that we may provide a system to maintainers with less technical knowledge. There may still be a case where a major breakdown occurs or a repair of the system is required. Here are the skills for an ideal maintainer of the system in case the client hires one. Table 20: Require Skills for maintainer Role Maintainer Skills Knowledge on database administration using MySQL. Programming language JAVA, JSP and Apache Tomcat, OCR operations 2943238cf290f3387d3c727a2eec9d74506d9339.doc19 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 Approach A.1.10Monitoring and Control The purpose of monitoring and control for the Theater Script Online Database (TSOD) is to acknowledge the current status of each part of the project and track development team productivity. It helps accelerate the process of artifacts that are behind schedule and keep all activities and documents up to date according to plan. The way to monitor our work is to use the following tools so we can check weekly each person's work and group work: Weekly Client Meeting Report This document provides record of client opinion or feedback of our progress in the system and in different artifacts. Weekly Progress Report Shows an overview of the project being developed and the contribution of each member. It also provides a list of high level of problems encountered. Weekly Effort Report Every member of the development team records the time each one spends on the different areas of the project. It gives a clear view of the area of concentration and if any area is overlooked. Project Plan It give an organized view of each person's task and responsibility and the amount of time to be dedicated to each one. Risk management and mitigation (DART) Identifies all the risks and prioritize the top ones that need to be reduced or managed. Software Cost Estimation (USC COCOMO tool) It gives the approximation of the effort and the man-hours of the project and helps put in perspective the scope of the project. Regular Team meeting A minimum of one group meeting per week is done so that we may update each other on the status of our work and look to cooperate on common tasks. 2943238cf290f3387d3c727a2eec9d74506d9339.doc20 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 .1.10.1 Closed Loop Feedback Control In the closed loop feedback we monitor our work through our Progress Report and the Project Plan and be consistent with both artifacts. We update our status in our weekly developer meetings. If any mismatch is found between plan and production we analyze the issue and resolve the problem as soon as possible. By looking on at how critical the problem is we can categorize it into something we must address now or later. .1.10.2 Reviews The reviews for the life cycle plan of the system is done through the phases mostly at the end yet there are others in between. They are listed here: Review Board When we finish a phase, a review board session is conducted to see if the group can proceed to the next phase. All stakeholders are involved. The Architecture Review Boards (ARB) for this semester are the following: o Foundation Commitment Review o Development Commitment Review o Rebaselined Development Commitment Review o Transition Readiness Review Core Capability Drive-through (CCD) Show the client the core capabilities of the system. Client interaction with the system will provide feedback to see if our system is consistent with her view of the system. It will be brought to her each time a new prototype is done. Configuration Management This allows us to have a clear and unified convention for versioning and updating the artifacts. It also allows tracing back too the documents. It uses Fagan's inspection to detect any defects of the peer work. Peer Review Team members will help each other in checking other's artifacts and provide suggestions and corrections. TAs Review The feedback provided by our TAs on our documents provide suggestions on improving deficiencies. Agile Artifact Review Review done by IIV&V students. 2943238cf290f3387d3c727a2eec9d74506d9339.doc21 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 .1.10.3 Project plan The Project Manager elaborates a progress report weekly where he highlights each member task. The team can acknowledge the status of the project and the progress on it. Possible risks are identified and defects are discovered on the process. Moreover, the Project Plan is use to reassure the schedule of the project. The progress report and project plan are at the following link: http://greenbay.usc.edu/csci577/spring2009/projects/team16/PR/index.html A.1.11Methods, Tools and Facilities Table 21: Tools for the Project Tools Microsoft Word 2007 Microsoft Project 2007 Microsoft PowerPoint 2007 Internet Explorer and Mozilla Firefox WikiWinWin-J Rationale Software Modeler Adobe Acrobat Reader iCard System and ER DART OCR Google Custom Search MySQL Tomcat Apache NetBeans 6.1 Bugzilla ABBYY PDF Usage Used to generate all the artifacts of the project Used to create the weekly project plans Used to produce the presentations for the review Used to download documentations and help from ICM EPG. It is also the test environment for the system Used for the WikiWinWin negotiations Produce the UML models Use to read pdf files Submit effort report Manage risk Convert image into text Search within the script Database creation To produce web server IDE for the project To debug bugs on the project To convert PDF into DOC Provider USC USC USC Free software USC USC Freeware USC USC On the scanner software Google freeware Opensource Opensource Opensource Opensource COTS 2943238cf290f3387d3c727a2eec9d74506d9339.doc22 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 A.2. Resources Using the COCOMO II 2000.3 tool we show the estimated cost for the project development in terms of the time and the number of people it needs. Here are the numbers we have for our team using what we have been given. They can be used to see if it fits according to the factors we set, or if we need to reduce the scope of the project. Even though there are more than 10 weeks for this class, it takes time to form groups during our first time. Rebaseline and transition will take a couple of weeks, as well, leaving us with 10 weeks. Spring 2009 577b Effort: (in assumption that everyone is still on the team) 6 team members at 12 hrs/week for 10 weeks Spring schedule will be: 720 hours Our project is separated into the following modules: Login: access or use system Administrator Profile Management: The administrator's capabilities to grant access to user to view specific script and for the administrator to register or change information. Search Script: The search inside the script that produces the pages where the keyword appears User Interface (View Scripts): Every visual and inputs for the user to interact with the system including view the scripts. Account Creation: the visitor register into the system and wait for permission Script Management: interface with the OCR, upload and edit the scripts. *Calibration will be done after better understanding of Code Count. The scale drivers for the module are the same so they will remain as one, yet the cost driver will vary. These are the tables for each module. Table 22: COCOMOII Scale Driver Scale Factor PREC Value NOMINAL FLEX RESL HIGH HIGH Rationale On the surface, this project appears to be fairly similar to basic database search / web interface applications. However, this specific implementation doesn't appear to have been done yet. There is good flexibility from the client and they are all based on schedule so capabilities can be eliminated The architecture clearly defines all the risks involved and is managed on a weekly-basis using DART. 2943238cf290f3387d3c727a2eec9d74506d9339.doc23 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 TEAM PMAT NOMINAL NOMINAL We are from different backgrounds and we have not worked together before yet the client is easy to reach The project has to be developed in fast pace and be matured quickly. However, ICM is a new approach to develop the system so the process maturity will be nominal Table 23: COCOMOII Cost Driver Module 1 - Login Cost Driver RELY DATA DOCU CPLX RUSE TIME STOR PVOL Value LOW LOW NOMINAL LOW LOW NOMINAL NOMINAL LOW Rationale If user cannot login, the administrator can always revert to the old system of manually retrieving and copying scripts for the users. There is no monetary loss. The amount of users data require for testing will not be small. However, it is small part of the database size. The amount of documentation will be suitable for its life-cycle needs, as this project seems to be fairly straightforward. It is a component most have done for a previous project. It won't be reused It requires less than 50% of execution time. There is few data to be stored for each user so it is less than 50%. Software will not get updated in a short amount of time. Even if it does it is always comparable to previous versions and will not alter the login. Analysts have had experience in the industry. Since our team consists of members from different backgrounds and different countries, not all are familiar with the procedures we plan to use. In addition, our coding styles will be different, as well as our methods of attack. This is a challenge that we will have to get through. More than 75% of the team will continue. Most of the team members have experience constructing a login and some even have experience with industry standards. ACAP PCAP NOM NOM PCON APEX HIGH HIGH 2943238cf290f3387d3c727a2eec9d74506d9339.doc24 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 LTEX NOMINAL Everyone in the team has had some coding experience and although it is not specifically JAVA or JSP, I believe that all high level coding languages are similar enough where one could just pick up another high-level language and learn it quickly. We will be using NetBeans, which comes with a small learning curve. The web server Apache Tomcat and database is MySQL. They are commonly use platforms and most of not all have experience with them for more than 1 year. Besides it is on Windows a common OS that everyone has use more than a year. NetBeans can be used to edit, debug, and test our code Seven of eight members of the team are in Los Angeles County and the client is located on campus. Our schedule will follow the schedule given in class. We will have 24 weeks spanning two semesters PLEX NOMINAL TOOL SITE SCED HIGH HIGH NOMINAL Table 24: COCOMOII Cost Driver Module 2 Administrator Profile Management Cost Driver RELY DATA DOCU CPLX RUSE TIME STOR PVOL ACAP PCAP Value NOMINAL NOMINAL NOMINAL NOMINAL LOW NOMINAL LOW LOW NOM NOM Rationale The administrator needs to be able to work reliably on the system. We require some data for testing different part of system the administrator control will have all the different parts except a search will be a good amount but still below 100, D/P<100. The amount of documentation will be suitable for its life-cycle needs, as this project seems to be fairly straightforward. So far the controls just involve uploading the scripts and activating user accounts It won't be reused Those are simple operations that might not take so long This module is more about functionality so it does not require much storage. Administration control will not have evolution Analysts have had experience in the industry. Since our team consists of members from different backgrounds and different countries, not all are familiar with the procedures 2943238cf290f3387d3c727a2eec9d74506d9339.doc25 Version Date: 04/02/09 Life Cycle Plan (LCP) _ Team 16 Version No 9.0 we plan to use. In addition, our coding styles will be different, as well as our method of attack. This is a challenge that we will have to get through. PCON APEX LTEX HIGH NOMINAL NOMINAL More than 75% of the team will continue. Those are web admin capabilities that most of us have developed Everyone in the team has had some coding experience and although it is not specifically JAVA or JSP, I believe that all high level coding languages are similar enough where one could just pick up another high-level language and learn it quickly. We will be using NetBeans, which comes with a small learning curve. The web server Apache Tomcat and database is MySQL. They are commonly use platforms and most of not all have experience with them for more than 1 year. Besides it is on Windows a common OS that everyone has use more than a year. NetBeans can be used to edit, debug, and test our code Seven of eight members of the team are in Los Angeles County and the clie...

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

USC - CSCI - 577
Feasibility Evidence Description (FED)Theater Script Online Database Team No 16Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Nory Nishimura Julie SanchezProject Manager / Non-tech Lead / Developer Requirements Engineer / Tech Lea
USC - CSCI - 577
Quality Management Plan (QMP)Theater Script Online DatabaseTeam No 16Quality Management Plan (QMP)Version 9.0Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Nory Kealii Nishimura Julie SanchezNon-technical Lead Requirements
USC - CSCI - 577
System and Software Architecture Description (SSAD)Version 9.0System and Software Architecture DescriptionTheater Script Online Database Team #16Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Nory Kealii Nishimura Julie Sanchez
USC - CSCI - 577
Proposal for Ada to AADL TranslatorFeasibility Rationale Description(FRD)Team# 18Team Members DeWitt Latimer IV Mridu Sethi Nidhi Gulati Sapan Lalani Suprabha Ray Swapnil Patel Vijay KakadiaIndependent Verification &amp; Validation System and Soft
USC - CSCI - 577
Project DetailDue : Monday, December 15, 2008 at 11:59 PM Submission : Post the file under Final Deliverables page in your team website File name : ProjectDetail_20083_Txx.doc (xx is your team no.) -Instruction: Fill in this form. Make sure that the
USC - CSCI - 577
System and Software Requirements Definition (SSRD)Theater Script Online DatabaseTeam No 16Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Sandeep Mikkilineni Nory Kealii Nishimura John Christopher Reynolds Julie SanchezProject M
USC - MEDIA - 1105
&lt;!DOCTYPE html PUBLIC &quot;-/W3C/DTD XHTML 1.0 Strict/EN&quot; &quot;http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd&quot;&gt;&lt;html xmlns=&quot;http:/www.w3.org/1999/xhtml&quot; lang=&quot;en&quot; xml:lang=&quot;en&quot;&gt;&lt;head&gt; &lt;title&gt;Changeset 1105 for tools/DotSceneLoaderTemplate/media/
USC - MISC - 2438
&lt;!DOCTYPE html PUBLIC &quot;-/W3C/DTD XHTML 1.0 Strict/EN&quot; &quot;http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd&quot;&gt;&lt;html xmlns=&quot;http:/www.w3.org/1999/xhtml&quot; lang=&quot;en&quot; xml:lang=&quot;en&quot;&gt;&lt;head&gt; &lt;title&gt;Changeset 2438 for ogre/Tests/OgreMain/misc/ArchiveTes
USC - MISC - 2438
&lt;!DOCTYPE html PUBLIC &quot;-/W3C/DTD XHTML 1.0 Strict/EN&quot; &quot;http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd&quot;&gt;&lt;html xmlns=&quot;http:/www.w3.org/1999/xhtml&quot; lang=&quot;en&quot; xml:lang=&quot;en&quot;&gt;&lt;head&gt; &lt;title&gt;Changeset 2438 for ogre/Tests/OgreMain/misc/ArchiveTes
USC - DOCS - 1876
&lt;!DOCTYPE html PUBLIC &quot;-/W3C/DTD XHTML 1.0 Strict/EN&quot; &quot;http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd&quot;&gt;&lt;html xmlns=&quot;http:/www.w3.org/1999/xhtml&quot; lang=&quot;en&quot; xml:lang=&quot;en&quot;&gt;&lt;head&gt; &lt;title&gt;Changeset 1876 for ogreaddons/3dv/MouZe/docs/WorkingDi
USC - DOCS - 1876
&lt;!DOCTYPE html PUBLIC &quot;-/W3C/DTD XHTML 1.0 Strict/EN&quot; &quot;http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd&quot;&gt;&lt;html xmlns=&quot;http:/www.w3.org/1999/xhtml&quot; lang=&quot;en&quot; xml:lang=&quot;en&quot;&gt;&lt;head&gt; &lt;title&gt;Changeset 1876 for ogreaddons/3dv/MouZe/docs/ReadMe.tx
USC - CS - 556
Broadcast Encryption and Content Protection ApplicationsYu Shiu &amp; Yih-Feng Chen University of Southern CaliforniaOutline Motivation and Application Framework of Broadcast Encryption Solution to Broadcast Encryption: SubsetCover Revocation Algo
USC - CS - 665
Report 4 (MidTerm) Exit Criteria1. A defined process for analyzing the data and creating a report including all the data under &quot;Task 3&quot; page 772. (Compliant with Section 13.2, pgs. 442-444.) a) Including a process script. (Use any PSP script as a &quot;
USC - SCF - 480
480 TITLES GUIDESPRING 2007Policies:1. No &quot;Film-by&quot; Credit or Similar Per School of Cinema-TV policy, the following title presentations are NOT allowed under any circumstances (the following are examples, the list is not conclusive): A John Doe Fi
USC - CSCI - 577
CLIENT INTERACTION REPORT-TEAM# 16Project Name: Theatre Script Online Database Organization Name: JulesTBear's Online ScriptoRama Current System System name: None. What it provides to users A script filing cabinet. A place to keep hard copies of
USC - CSCI - 577
Supporting Information Document (SID)NEW ECONOMICS FOR WOMENTeam No: 11Team members and roles Name Raghava Aditya Ravula Tejaswi Chadalavada Nitin Bandi Adil Fulara Veena Movva Swarag Segu Abbey Sullivan Role Project Manager &amp; SSRD &amp; Meeting Fa
USC - CSCI - 577
Systems and Software Architecture Design (SSAD)Version 1.0Project #14: Early Medieval East Asian TombsSiavash Gholami (Project Manager, FRD) Derek Zimmermann (SSAD) Aviral Mathur (Prototyper) Yasin Angara (OCD) Xiaoyan Zhang (LCP) Sijie Zhang (S
USC - CSCI - 577
Life Cycle Plan (LCP)Youthink.com Video Uploading and Conversion System Team 10Sandarsh M Kumar Project Management Rajen Sarda System Analysis Peter Thompson Operational Concept Description Pius Pack Feasibility Rational Description Stephen Cather
USC - CSCI - 577
Supporting Information Document (SID)LCA Package Version 2.2Personal Care Technology Team 9Team Members: Preeti Agrawal Project Management, LCP Akash Haswani Operational Concept Neha Singla Prototype / Implementation Prateek Tandon Requireme
USC - CSCI - 577
Operational Concept Description (OCD)Video Uploading &amp; Conversion SystemTeam 10Stephen Cathers Tasneem Hakim Sandarsh Kumar Pius Pack Rajen Sarda Peter Thompson John Marshall Dean Robert(Prototyping) (System &amp; Software Requirements Description
USC - CSCI - 577
USCC S EUniversity of Southern CaliforniaCenter for Software EngineeringValue-Based Software Engineering (VBSE) and the Incremental Commitment Model (ICM)Barry Boehm, USC CS 510, 577a Lectures Fall 2008USCC S EUniversity of Southern C
USC - CSCI - 577
COTS Survey COTS Integration Pre-Assignment Survey1. Team Number: 5 2. Is system largely dependent on COTS products?Yes.3. How many COTS products does your proposed system utilize (including operating system)? 5 4. List the members of you
Loyola Marymount - MBAD - 617
Ragsdale's Chpt 3.9 Investment ProblemsProblem: how to design a retirement income portfolio for retirees using corporate bonds? Client has $750,000 in liquid assets to invest A list of upcoming bond issues from 6 companies has been identified and
USC - CC - 2420
ARCHITECTURE=The default LPL implementation uses a packet train with acknowledgementsenabled, shortened backoffs, and a spinning energy checking loop.The default strategy can be improved by implementing a different architecture.Right now the a
Southern Utah - ECON - 2020
Money, Banking and the Financial SectorChapter 13McGrawHill/IrwinCopyright 2001 by The McGrawHill Companies, Inc. All rights reserved.13 2Laugher Curve A central banker walks into a pizzeria to order a pizza. When the pizza is done, he
USC - CSCI - 351
&lt;XMP&gt;&lt;HTML&gt;&lt;HEAD&gt; &lt;TITLE&gt;Homework #5: List&lt;/TITLE&gt; &lt;STYLE type=&quot;text/css&quot;&gt; OL { color: Navy; font: bold 16px times new roman; list-style-type: upper-roman; } OL OL { color: Blue; font: bold italic 16px t
Virginia Tech - CS - 4984
33 F.3d 1526 63 USLW 2088, 31 U.S.P.Q.2d 1545 (Cite as: 33 F.3d 1526) RICH, Circuit Judge, with whom: United States Court of Appeals, Federal Circuit In re Kuriappan P. ALAPPAT, Edward E. Averill and James G. Larsen. No. 92-1381. July 29, 1994. *1529
SUNY Potsdam - WIDRICCR - 191
Spanish Vocabulary Practice This is an amazing site that provides a variety of categories to choose from to practice and learn Spanish vocabulary with options of having it pronounced for you. Spanish Verb Conjugations This is an amazing site that all
SUNY Potsdam - GLASERIM - 191
Vocabulary QuizNY State Algebra I Chapter 8 Systems of Equations and Inequalities phschool.com Homework Tutor ata-00801 through ata-0806 Name: _ Date Set TopicsCHA 8-1 CHA 8-2Ata-0851 Chapter Test PracticeAssignmentJournal Find the errorZe
University of Texas - BIO - 301
name (required) _revise 2. (4pts) Why is it difficult to measure the harmful effects of the levels and types of ionizing radiation that we think is most relevant to our population? MTF A) Sample size: too few people are exposed to any dose of ionizi
University of Texas - BIO - 301
name _ (required)Exam 4, Bio301D, 6 Dec 061. (4 pts) Key code, box #, and name. Fill in (A B) to indicate your key for this version of the exam. Be sure your name and box number are correctly bubbled in on the scantron and that you have signed th
Alverno College - CS - 270
Finding Your Inner Flyor How Do I Find My Inner Calling and Integrate It Into a Career?What's My Inner Fly?Human fruit flies often seem genetically predisposed to do what they do Instinctively combine their passions with their aptitudesThe r
UMass (Amherst) - CMSTEX - 7427
&lt;?xml version=&quot;1.0&quot; encoding=&quot;UTF-8&quot;?&gt; &lt;Error&gt;&lt;Code&gt;NoSuchKey&lt;/Code&gt;&lt;Message&gt;The specified key does not exist.&lt;/Message&gt;&lt;Key&gt;d45388c39de57138e50b0c9c7f576e503d4a146b.pdf%3Ffile %3Dga&lt;/Key&gt;&lt;RequestId&gt;C54CA1FF88F18B1A&lt;/RequestId&gt;&lt;HostId&gt;XC9Y3bs5njIkwgF
UMass (Amherst) - CMSTEX - 6757
&lt;?xml version=&quot;1.0&quot; encoding=&quot;UTF-8&quot;?&gt; &lt;Error&gt;&lt;Code&gt;NoSuchKey&lt;/Code&gt;&lt;Message&gt;The specified key does not exist.&lt;/Message&gt;&lt;Key&gt;376d9e7e270963f427b491168cab228bef0ea56c.pdf%3Ffile %3Dka&lt;/Key&gt;&lt;RequestId&gt;B3BFDEA49E0E623F&lt;/RequestId&gt;&lt;HostId&gt;2ildKFi1Y4DZcYB
SUNY Potsdam - JOHNSOJD - 190
NY State Algebra I Chapter 8 Systems of Equations and Inequalities phschool.com hh Homework Tutor ata0801 through ata0806Vocabulary Quiz Ata-0851 Chapter Test Practice Ata-0852Name: _SetCHA 8-1 CHA 8-2 CHA 8-3 CHA 8-4 CHA 8-5 CHA 8-7DateTo
W. Carolina - CS - 361
8 6 world x and y dims0 0 -3 viewpoint (x, y, z)14 plane2 2 2 r g b ambient6 6 6 r g b diffuse0 0 0 r g b specular0 1 0 normal0 -4 0 point13 sphere1 1 1
W. Carolina - CS - 361
8 6 world x and y dims0 0 -3 viewpoint (x, y, z)14 plane0.0 0.0 0.0 amb, diffuse, spec2.6 2.0 0.0 amb, diffuse, spec0.7 0.7 0.7 amb, diffuse, spec0 1 0 normal0 -4 0 point16
Emory - CS - 323000
I fixed Notes.txt (&quot;Cut Property&quot; and &quot;Cycle Property&quot; were reversed).We did not do the correctness of Prim's algorithm, but it is a prettysimple consequence of the Cut Property. We'll talk about performancenext time.
Emory - CS - 153000
See the lab6 handout for an explanation.
Emory - CS - 153000
We had to edit lcs.pl during class to make it work, filelcs.pl.orig is the original version. It has &quot;lcs_cache&quot; inone place, instead of &quot;llcs_cache&quot;, and no &quot;use strict&quot;which would have caught the error.The original version falls back into the
Emory - CS - 0126
In class I edited ./0123/hw1.pl with the resulting file&quot;hw1-nodefault.pl&quot;, so we did not look at the prepared file&quot;hw1-rewrite.pl&quot; (and the &quot;Tom Toady&quot; motto).We did look at example5-6.pl and example5-7.pl, but (as Iexpected) we did not have tim
Emory - CS - 323000
I just spoke today, no code. Here are summary notes of whatI recall discussing. We should see working code Friday.I started with a high-level preview of shortest paths andthe three algorithms, as listed in Notes.txt.I defined shortest paths o
Emory - IBS - 574
For today's class we will meet in the computer lab, B28 of the Dental School building. We will go over the following papers. See the blackboard for copies of the papers. Kulkarni-Kale, 2007. Jeenduang, 2008. Jongejan, 2008.We will review new mod
USC - CSCI - 201
/Figure 2-27import java.util.Vector;import Item;class ProducerConsumerMonitor extends Object { private final int N = 5; private int count = 0; private Vector theData; synchronized public void insert(Item data) { whil
USC - CSCI - 201
TYPICAL TRANSMISSIONS FOR ARRIVALS AT LOS ANGELES TOWERSWA111/112-Southwest One Eleven/Twelve LC-2-Local Control Two (North Tower) GC-2-Ground Control Two (North Ground) CD-Clearance DeliverySWA111 Los Angeles Tower, this is Southwest One Eleven fi
Emory - BENSON - 361
PHYSICS 361:Analytical Mechanics I BensonMWF11:45-12:35MAX: 6WRT: NoFor B.A. physics and other mathematical science majors (B.S. physicsmajors should take Physics 361S). More complete mathematicaltreatment of classical mechanics, focusing
Emory - CS - 323000
Reminder: hw4 program due 11:59pm Monday (4/13)There are only about two weeks left, expect only one more regularhomework+program homework, hw5, probably Monday. (If there isanything else, it will only be written or makeup work.)Today we'll go
W. Carolina - PDFS - 304
Advanced Technical Writing Organization A guide for users of a major city library is organized alphabetically. Topics are listed below. Discuss the merits and limitations of alphabetical organization for this document if the readers are first-time us
UMass (Amherst) - CMSTEX - 0544
&lt;?xml version=&quot;1.0&quot; encoding=&quot;UTF-8&quot;?&gt; &lt;Error&gt;&lt;Code&gt;NoSuchKey&lt;/Code&gt;&lt;Message&gt;The specified key does not exist.&lt;/Message&gt;&lt;Key&gt;b5300218f10f2e87efa7bdbd80ecf03dc15f29bb.pdf%3Ffile %3Dzv&lt;/Key&gt;&lt;RequestId&gt;30232869F6772BF1&lt;/RequestId&gt;&lt;HostId&gt;F8ckQP0vd/73RQG
University of Texas - MIS - 380
Using The Lognormal Random Variable to Model Stock Prices2Using The Lognormal Random Variable to Model Stock PricesIn reality, stock prices can assume any non-negative value. In a binomial tree, of course, only a finite number of stock prices ar
USC - CSCI - 577
Project #8: AAA Petal Pushers Remote R&amp;D Client Meeting Note #6 Date Venue Start time Attendee: Name Chatupoln Taparugssanagorn Ampatcha Satornsantikul Chatchai Sinthop Sattawat Suppalertporn Saranya Iranoppaiboon John Lindsey Apology: Name Ryan Lee
UMass (Amherst) - CMSTEX - 0488
&lt;?xml version=&quot;1.0&quot; encoding=&quot;UTF-8&quot;?&gt; &lt;Error&gt;&lt;Code&gt;NoSuchKey&lt;/Code&gt;&lt;Message&gt;The specified key does not exist.&lt;/Message&gt;&lt;Key&gt;081262e20a0e972a572f90cf586ebf5c0058762e.pdf%3Ffile %3Ddu&lt;/Key&gt;&lt;RequestId&gt;3B3D88EC67A65393&lt;/RequestId&gt;&lt;HostId&gt;K8lVlKD5XUrVQPp
Emory - E - 411
EMORY UNIVERSITY DEPARTMENT OF ECONOMICS Money and Banking Econ 411 WRInstructor: Stefan Krause (skrause@emory.edu) Classroom: Rich Hall 104 Mon, Wed &amp; Fri 3:00-3:50pmOffice: Rich Hall 321 Off. Hrs.: Mon &amp; Wed 2:00-2:50pm Phone: 404-727-2944Tex
Emory - CS - 0410
GCCCTGTGGTGCCAGTCATAACCCCACGACTCTACTGCCAGACAGTCCGTTGGGCCGTAAAGTCCAGCGCGGCTCGTCATGCTTTGCCAGGCGGATCTCTGTGCTACTGATGAGGGATACTTCCGTCTGACGATAAGTGGAGCGCGGTGGGTTGTGCTGCGTCCATGGTTACCCCTCGTGTAGTCATCTTGAAATTGCGATGGGCACAGGAGCCAAGACCCGATAGTAGTTGTGCGTCCCCGGTAAC
Emory - CS - 0410
ADMINISTRATIVE: Note there are just a bit over two weeks left in thecourse. Expect only one more Perl lab (lab8), probably Monday. If wedo have any other work in the course, it will probably be written, notprogramming. We will have a final exam
USC - CS - 551
Return-Path: william@bourbon.usc.eduDelivery-Date: Wed Sep 3 23:12:15 2008X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.eduX-Spam-Level: X-Spam-Status: No, score=-2.3 required=5.0 tests=AWL,BAYES_00 autolearn=hamversion
UMass (Amherst) - CMSTEX - 7675
&lt;?xml version=&quot;1.0&quot; encoding=&quot;UTF-8&quot;?&gt; &lt;Error&gt;&lt;Code&gt;NoSuchKey&lt;/Code&gt;&lt;Message&gt;The specified key does not exist.&lt;/Message&gt;&lt;Key&gt;26056cff7d722f6e4eb85c179cf38fecf0c5e7e8.pdf%3Ffile %3Dou&lt;/Key&gt;&lt;RequestId&gt;9885A9591B319512&lt;/RequestId&gt;&lt;HostId&gt;k0jzBl9mjplykCw
USC - CSCI - 577
Quality Management Plan (QMP)Open Source XML Parser-Based Code Count ToolTeam 23Ali Afzal Malik Harsh Nayak Kunal Kulkarni Vannak Touch Naman Modi Matthew Benjamin QMP_IOC1_S06b_T23_V1.2.docProject Manager and Configuration Manager Tester and
W. Carolina - ASSIGN - 401
Style Revision Assignment Due: 1/23 In the following memo, the Vice President of the company (Cindi Tuffboss) required an employee (Billy Joe Bobby Bob) to verify that a co-worker of Billy's (Chris Doe) was falsifying time card data. Basically, Billy
UMass (Amherst) - CMSTEX - 7957
&lt;?xml version=&quot;1.0&quot; encoding=&quot;UTF-8&quot;?&gt; &lt;Error&gt;&lt;Code&gt;NoSuchKey&lt;/Code&gt;&lt;Message&gt;The specified key does not exist.&lt;/Message&gt;&lt;Key&gt;305dce5019c0e364c7c7d635ff1734df8b84bb29.pdf%3Ffile %3Ddr&lt;/Key&gt;&lt;RequestId&gt;40AD95E0135EFE24&lt;/RequestId&gt;&lt;HostId&gt;RD6bs5Er/Qy5mP0
Allan Hancock College - LNGS - 1005
Writing in an academic style Academic writing tends to be authoritative and objective: the language is formal, technical and impersonal. Academic spoken English is also technical, but slightly less formal and impersonal. The features of spoken and wr