46 Pages

SSAD_IOC1_S09b_T16_V9.0

Course: CSCI 577, Fall 2009
School: USC
Rating:
 
 
 
 
 

Word Count: 7455

Document Preview

and System Software Architecture Description (SSAD) Version 9.0 System and Software Architecture Description Theater Script Online Database Team #16 Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Nory Kealii Nishimura Julie Sanchez Project Manager/Non-tech Lead/Developer Requirement Engineer/Tech Lead/Tester System Architect/Developer Prototyper/Developer Planning and Control Engineer/Tester...

Register Now

Unformatted Document Excerpt

Coursehero >> California >> USC >> CSCI 577

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
and System Software Architecture Description (SSAD) Version 9.0 System and Software Architecture Description Theater Script Online Database Team #16 Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Nory Kealii Nishimura Julie Sanchez Project Manager/Non-tech Lead/Developer Requirement Engineer/Tech Lead/Tester System Architect/Developer Prototyper/Developer Planning and Control Engineer/Tester IIV&V / QFP / Quality Lead Client I 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Version History Date Author Version Changes made Rationale 10/13/08 10/21/08 10/27/08 Young Cahn Noh Young Chan Noh Young Chan Noh Young Chan Noh Young Chan Noh Young Chan Noh Young Chan Noh Young Chan Noh 1.0 1.1 1.3 Initial system analysis model Initial technology independent diagram Update system analysis model and technology diagram Modified Use-Case (Table1,2,3,4) and Section 2 and 3 Modified System-Domain Analysis and Initial draft Technology-Specific Design Model Updated Class diagrams Updated Deployment diagram, Software Component diagram, and Interface diagram Updated Figure 2(Artifacts and Information Model), Figure 3(Use-Case Diagram), Added Figure 19(Sequence Diagram). Updated Technology-Specific Diagrams Edited the sequence diagram Added Entity-Relation diagram Updated Class diagrams Updated Table2,4,20 Updated Introduction Chapter Initial draft of SSAD Update system analysis model and Add technology independent diagram Update system analysis model, technology independent diagram and sequence diagram Addressed Agile Artifact Review Addressed Agile Artifact Review and Initial draft Technology-Specific Design Model Updated Technology-Specific class diagrams Peer Review 10/28/08 11/22/08 1.4 2.0 11/23/08 11/29/08 5.0 5.1 12/07/08 6.0 DCR ARB Review Agile Artifact Review 02/09/09 02/22/09 04/06/09 Young Chan Noh Young Chan Noh Young Chan Noh 7.0 8.0 9.0 Peer Review RDCR ARB Review Agile Artifact Review CCD Review II 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Table of Contents System and Software Architecture Description.....................................................................I Version History........................................................................................................................II Table of Contents...................................................................................................................III Table of Tables.......................................................................................................................IV Introduction..............................................................................................................................7 1.1 Purpose of the SSAD.................................................................................................................7 1.2 Status of the SSAD....................................................................................................................7 System Analysis........................................................................................................................7 1.3 System Analysis Overview........................................................................................................7 1.3.1 System Context...................................................................................................................8 1.3.2 Artifacts & Information...................................................................................................10 1.3.3 Behavior............................................................................................................................11 1.3.4 Modes of Operation..........................................................................................................22 1.4 System Analysis Rationale......................................................................................................22 Technology-Specific System Design......................................................................................23 1.5 Design Overview......................................................................................................................23 1.5.1 System Structure..............................................................................................................23 1.5.2 Design Classes...................................................................................................................27 1.5.3 Process Realization...........................................................................................................42 1.5.4 Entity Relation Diagram..................................................................................................44 1.6 Design Rationale......................................................................................................................45 Architecture Styles, Patterns, and Frameworks.................................................................45 III 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Table of Tables Table 1: Actors Summary........................................................................................................9 Table 2: Artifacts and Information Summary....................................................................10 Table 3: Process Description Search Script List..............................................................12 Table 4: Typical Course of Action Search Script List Application................................12 Table 5: Alternate Course of Action Click on "Export".................................................12 Table 6: Process Description View Script and Printing..................................................12 Table 7: Typical Course of Action View Script................................................................13 Table 8: Alternate Course of Action Click on "Print"....................................................13 Table 9: Process Description Account Creation_Request...............................................13 Table 10: Typical Course of Action Account Creation_Request ...................................14 Table 11: Process Description Script Access_Request.....................................................14 Table 12: Typical Course of Action Script Access_Request ..........................................14 Table 13: Process Description - Login..................................................................................15 Table 14: Typical Course of Action Login: Successful ...................................................15 Table 15: Alternate Course of Action Login: Failure......................................................15 Table 16: Process Description Logout...............................................................................16 Table 17: Typical Course of Action Logout......................................................................16 Table 18: Process Description User Profile Manage........................................................16 Table 19: Typical Course of Action User Profile Manage...............................................16 Table 20: Exception Course of Action User Profile Manage..........................................17 Table 21: Process Description Upload Script _Input Script Information.....................17 Table 22: Typical Course of Action Upload Script_Input Script Information.............17 Table 23: Exception Course of Action - Upload Script_Input Script Information..........18 Table 24: Process Description Edit Script_Update Script Information.........................18 Table 25: Typical Course of Action Edit Script_Update Script Information...............18 Table 26: Exception Course of Action - Edit Script_Update Script Information............19 Table 27: Process Description Notify Script change........................................................19 Table 28: Typical Course of Action - Notify Script change................................................20 Table 29: Exception Course of Action - Notify Script change...........................................20 Table 30: Process Description Administrator Profile Manage.......................................20 Table 31: Typical Course of Action Administrator Profile Manage..............................21 Table 32: Exception Course of Action Administrator Profile Manage..........................21 Table 33: Process Description User Account_Script Access Activation........................21 Table 34: Typical Course of Action User Account_Script Access Activation...............21 Table 35: Exception Course of Action User Account_Script Access Activation...........22 Table 36: Hardware Component Description.....................................................................26 Table 37: Software Component Description........................................................................26 Table 38: Web Framework Component Description..........................................................27 Table 39: Interface Class Description..................................................................................28 Table 40: User Login Class Description...............................................................................29 Table 41: Administrator Profile Management Class Description.....................................30 Table 42: Search Script_List Class Description..................................................................32 IV 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Table 43: View Script Class Description..............................................................................33 Table 44: Account Creation_Request Class Description....................................................35 Table 45: Script Access_Request Class Description...........................................................37 Table 46: User Account Activation Class Description........................................................38 Table 47: Upload Script_InputInformation Class Description..........................................40 Table 48: Edit Script_Update Information Class Description...........................................41 Table 49: Architectural Styles, Patterns, & Framework....................................................46 V 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Table of Figures Figure 1: System Context........................................................................................................8 Figure 2: Artifacts and Information Model.........................................................................10 Figure 3: Process Diagram....................................................................................................11 Figure 4: Hardware Component Class Diagram................................................................24 Figure 5: Software Component Class Diagram...................................................................24 Figure 6: Deployment Diagram............................................................................................25 Figure 7: Web Framework Component Classes..................................................................25 Figure 8: Interface Class Diagram.......................................................................................27 Figure 9: User Login Class Diagram....................................................................................29 Figure 10: Administrator Profile Management Class Diagram........................................30 Figure 11: Search Script_List Class Diagram.....................................................................32 Figure 12: View Script Class Diagram.................................................................................33 Figure 13: Account Creation_Request Class Diagram.......................................................35 Figure 14: Script Access_Request Class Diagram..............................................................36 Figure 15: User Account Activation Class Diagram...........................................................38 Figure 16: Upload Script_InputInfomation Class Diagram..............................................40 Figure 17: Edit Script_Update Information Class Diagram..............................................41 Figure 18: Upload Script Sequence Diagram......................................................................43 Figure 19: Edit Script Sequence Diagram..........................................................................43 Figure 20: Entity Relation Diagram.....................................................................................44 VI 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Introduction 1.1 Purpose of the SSAD The purpose of the SSAD is to document the results of the object-oriented analysis and design of the system being developed. The SSAD is to provide the analysis of the operational concept, design the architecture including software and hardware platform, and design the implementation of the Theatre Script Online Database. This system being developed should be faithful to the architecture specified in the SSAD. It serves as system reference to the builder by providing the in-depth architectural design and implementation of the proposed system. Moreover, the SSAD document is used by the maintainer and clients to help understand the structure of the system once the proposed system is delivered. The Initial Operational Capability package of the SSAD document consists of the description of system analysis, system process model including behavior, modes of operation, and technology specific model of the Theatre Script Online Database and the tailored system platform. 1.2 Status of the SSAD The current version of the SSAD is at the initial operational capability phase. At this phase, the structure diagram, domain/system information, artifacts class model, system process model, technology specific design diagram and entity-relation diagram are described and modified. System Analysis 1.3 System Analysis Overview The primary purpose of the Theatre Script Online Database is to manage the theatre paper script efficiently. This system will provide a way to keep various scripts for administrator to continuously edit, change, and upload scripts. A technical theatre website includes announcing of new changes and updates to the scripts and converting image file scripts into text file with OCR software. The web-based system, theatre staff, actors, and visitors can view and print online scripts. They also share script changes among the distributed copies. 7 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 1.3.1System Context Figure 1 shows the operational context of the Theatre Script Online Database. Figure 1: System Context 8 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 describes the actors and their corresponding responsibilities performed to the system. Table 1: Actors Summary Actor System User Description System user includes the administrator and theatre user. To access system, this actor has to login and get privilege. Administrator manages theatre system including script editing, upload, announcement, user activating and software management, etc. Responsibilities Login / Log out (administrator and theatre users) View the script contents and Print Manages theatre system Scan/Upload new scripts Edits existing scripts Notify new changes and updates of scripts (Send comments to actors and staffs via Email) Submits the detail information such as script's title, organization, and actor/staff information to be generated by the new script Activate user account Manages user account Search the scripts View the scripts Print scripts from web browser Receive administrator announcement Update user profile Request script access Search the script list Administrator Theatre User ( Actors/Staffs) Users are involved with the theatre. General User General user includes administrator, theatre user, and visitor. This actor can search the script list without viewing the script contents A person interested in the scripts Visitor Search the script list Request user account 9 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 1.3.2Artifacts & Information This section of the document describes the artifacts and information created by the system. These artifacts can either be used by the end user or reused by the system to produce further artifacts. The artifacts and relationships between/among them are described below. Figure 2: Artifacts and Information Model Table 2 contains a description of each artifact shown above. Table 2: Artifacts and Information Summary Artifact ATF-1: Script file Purpose Scripts are scanned and/or typed by the administrator. This artifact will be generated according to the theatre's schedule and this script file will be uploaded and inserted into database 10 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 ATF-2: Script Information ATF-3: Actor Information ATF-4: Comment Message ATF-5: Script Contents ATF-6: Paper Script ATF-7: User Profile Contains all information included on the script. This includes script title, organization, event date, genre, script file, etc. This information is used as a mean of search keywords and to sort scripts, view, and print out the scripts. Contains the information of the actor involved with the script. This includes names, roles. This comment message is generated automatically by the Notify changes. Whenever the script changes, this notification message is sent to users. This artifact contains script contents. This script contents will be created by uploading script file, and users can view this script contents This artifact will be printed by the View script application. The selected script contents will be printed by the user. Contains the information of the user who is activated by the administrator. This includes name, email, password, etc. Using this artifact and information, the user can view the script contents, print out the scripts and receive comment message 1.3.3Behavior The following Use-Case Diagram shows the processes that were identified when capabilities described in the OCD were analyzed. Figure 3: Process Diagram 11 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 1.3.3.1 Online Script 1.3.3.1.1 Search Script List (main page) Table 3: Process Description Search Script List Identifier Purpose Requirements Development Risks Pre-conditions Post-conditions UC- Search Script List After the script is uploaded, All users can view script List through the Search Script List application page. CR-5: Archive System, CR-14: Visitor Access, CR-19: Search in Script None System database is properly initialized Users have loaded Script List application page All script list including title, organization, and script file are displayed on the screen Table 4: Typical Course of Action Search Script List Application Seq# 1 Actor Actions Select search category or no select. Fill in search word and click on show all scripts button. System Response 2 3 Retrieve the script information from the database Display the search results Table 5: Alternate Course of Action Click on "Export" Seq# 1 2 Actor Actions If the user is the authorized administrator, the administrator can click Script Export button System Response POP-UP screen - Display the history and log of the archived files (scripts) and display files on the screen in order to provide export function 1.3.3.1.2 View Script and Printing Table 6: Process Description View Script and Printing Identifier Purpose UC- View Script and Printing Once the script is clicked on the Search Script List page, users can view the selected script and print the selected script contents through View Script and Printing application including script information such as title, genre, actors, and staffs. 12 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Requirements Development Risks Pre-conditions Post-conditions CR-4: Script Printing, CR-17: System displays Script as DOC None System database is properly initialized Users must do login and Users have loaded view application page Script contents and information are displayed on the screen Table 7: Typical Course of Action View Script Seq# 1 Actor Actions Click on script title on the Search Script List screen [hyperlink] or "View Script and Printing" menu click System Response 2 3 Sends user profile to the system in order to check whether this user can access this script or not. If the user has the access authority, Retrieve script file and information from the database, otherwise return the screen. Display the Script Contents and the script Information Table 8: Alternate Course of Action Click on "Print" Seq# 1 2 3 4 Actor Actions Select Print option: All page, Input page range or page number If the user want to print the script, Click On "Print" button System Response Send the script contents to the printer Display an "Printing OK" 1.3.3.2 Authentication 1.3.3.2.1 Account Creation_Request Table 9: Process Description Account Creation_Request Identifier Purpose UC- : Account Creation_Request Determine if a person logging into the system can be authenticated, and, if so, what the person's privileges are as a user of the system, what the person is authorized to do when using the system. Administrator will determine privilege level CR-2:User Account Notification,CR-3: Account Creation None System database is properly initialized. 13 Requirements Development Risks Pre-conditions 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Post-conditions If user is authorized s/he is given access to system operations appropriate to his/her role; otherwise, s/he is denied access to the system. Table 10: Typical Course of Action Account Creation_Request Seq# 1 2 3 Actor Action Click on Account Creation_Request Menu Fill in user profile fields. Click on Account Creation_Request Button System Response Sends user profile to the User Account Activation module of the Theatre Script online system Save the user's profile to the database and then Sends e-mail(Notification Message) to the administrator 1.3.3.2.2 Script Access_Request Table 11: Process Description Script Access_Request Identifier Purpose Requirements Development Risks Pre-conditions Post-conditions UC- : Script Access_Request The system shall allow a User to request from an Administrator permission to access a Script. CR-8:Script Access-User Request,CR-9:Script Access-Request Notification None System database is properly initialized. The request, consisting of the Username and the Script requested, will be stored in the database. If the script is authorized s/he is given access to the script appropriate to his/her role; otherwise, s/he is denied access to the script. Table 12: Typical Course of Action Script Access_Request Seq# 1 2 3 Actor Action Click on Script Access_Request Menu Select Script List user wants to access. Click on Request Button System Response Sends the script list to the Account Creation_ Request module of the Theatre Script online system Save the user's script list to the database 14 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 and then Sends e-mail (Notification Message) to the administrator 1.3.3.2.3 Login Table 13: Process Description - Login Identifier Purpose UC- : Login Determine if a person logging into the system can be authenticated, and, if so, what the person's privileges are as a user of the system, what the person is authorized to do when using the system CR-12 Authentication, CR-13 User Lockout None System database is properly initialized. If user is authorized s/he is given access to system operations appropriate to his/her role; otherwise, s/he is denied access to the system. Requirements Development Risks Pre-conditions Post-conditions Table 14: Typical Course of Action Login: Successful Seq# 1 2 3 4 5 Actor Action [user] Enters a user name and password [user] Clicks Login button System Response Sends username and password to the authentication module of the Theatre Script online system [Theatre Script Online system] Sends authentication verification and user session data [valid] User The user has privileges to view the script contents Administrator The user can access to Upload Script page, Edit Script page, Notify changes page, or Administrator management page, as appropriate Table 15: Alternate Course of Action Login: Failure Seq# 14 5 Actor Action System Response Refer to typical course of action After 5 consecutive unsuccessful login, Displays An error message: "You have to contact the administrator" in a dialog box. User's account locked out 15 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 6 Redirects the user to the Search Script List main page 1.3.3.2.4 Logout Table 16: Process Description Logout Identifier Purpose Requirements Risks Pre-conditions Post-conditions UC- : Logout To log out of the system N/A The user is the Administrator or activated user The user's login session still exists The user login session is terminated. The user is detached from the system Table 17: Typical Course of Action Logout Seq# 1 2 3 4 5 Click OK button Redirect the user to main page(Search Script List page) Actor Actions User clicks the "log out" button on the Search Script List page System Response Expire the user session data Display a message: "you have logged out of the system" in a dialog box 1.3.3.2.5 User Profile Manage Table 18: Process Description User Profile Manage Identifier Purpose Requirements Risks Pre-conditions Post-conditions UC- : User Profile Manage To update user profile CR-15: User Password Change, CR-16: User Profile Edit N/A The user is a activated user The user's login session still exists User profile fields in the database are updated Table 19: Typical Course of Action User Profile Manage Seq# 1 2 3 Actor Actions Click on User Profile Manage Menu Update user profile fields. Click on UPDATE Button System Response Sends user profile field to the User Profile Manage module of the Theatre 16 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 4 Script online system Update the user's profile field to the database Display a message: "Your Profile is updated!" in a dialog box Table 20: Exception Course of Action User Profile Manage Seq# 1 Actor Actions System Response Display Database error message *Database error : A message Database Error Code + " This data cannot update table" 2 Check error message and each field format. Retry the typical course of action 1.3.3.3 Script Management 1.3.3.3.1 Upload Script _Input Script Information Table 21: Process Description Upload Script _Input Script Information Identifier Purpose Requirements Development Risks Pre-conditions Post-conditions UC- Upload Script_ Input Script Information Allows the administrator to upload each script and input the information. Moreover, the administrator can upload archived file and import database backup CR-6: Upload Script, CR-20: Restore System N/A User is only administrator Database is properly initialized Script file is on the local computer (text file or image file) New script file and information are recorded to the database Table 22: Typical Course of Action Upload Script_Input Script Information Seq# 1 2 3 3 4 Enters Organization, Title, Genre, Date, Actors Info., Staffs Info. Click on "Browse" button Display the Choose file Pop-up box 17 Actor Actions Click on "Upload & Input Script" link System Response Display Upload Script_Input Script Information screen 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 5 6 7 8 9 10 11 12 Select the script file Display the file directory Check the converted script contents, Click "Submit" button Upload, insert this file and script information into the database Display an OK message Screen clear If the upload file is archived or dump file, Select this file. Click "Import" button Using this file, archived files will insert or update existing Script files Display an Import OK message Table 23: Exception Course of Action - Upload Script_Input Script Information Seq# 1 Actor Actions System Response Display error message * Display error : A message " Retry display " *Database error : A message Database Error Code + " This data cannot insert into table" 2 Check error message and database error code. Retry the typical course of action 1.3.3.3.2 Edit Script_ Update Script Information Table 24: Process Description Edit Script_Update Script Information Identifier Purpose Requirements Development Risks Pre-conditions Post-conditions UC- Edit Script_Update Script Information To Edit script and Update script information CR-17: System displays Script as DOC None User is only administrator Database is properly initialized Update information such as script contents, title, organization, actor, staff, event date and genre in the database Table 25: Typical Course of Action Edit Script_Update Script Information 18 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Seq# 1 2 3 4 5 6 7 8 9 10 11 Actor Actions Click on "Edit Script_Update Information" Script link Fill in Search word such as Title or Organization or Genre, Event Date, etc. Click on "Search" button System Response Display Edit Script_Update Script Information screen Display search results on the grid sheet. Click on the selected row on the greed sheet Display Script contents and Information in the field Edit Organization, Title, Genre, Date, Actors Info., Staffs Info or Edit script contents Click on "Update" button Save the script file to the local computer and then upload, update this file and information into the database Display an OK message Clear field and grid Table 26: Exception Course of Action - Edit Script_Update Script Information Seq# 1 Actor Actions System Response Display error message *Database error : A message Database Error Code + " This data cannot update table" 2 Check error message and database error code. Retry the typical course of action 1.3.3.3.3 Notify Script change Table 27: Process Description Notify Script change Identifier Purpose UC- Notify Script change The administrator has the ability to notify comment messages that includes announcement of script changes. Whenever the administrator changes the script, the system automatically send the comment message to users CR-1 Script Modification Notification None The administrator must change script contents or script 19 04/06/09 Requirements Development Risks Pre-conditions 379614bfec60d5d4d238a748135ad681c1bfafa6.doc System and Software Architecture Description (SSAD) Version 9.0 Post-conditions information. Send comment messages to users via e-mail Comment messages are recorded in the database Table 28: Typical Course of Action - Notify Script change Seq# 1 2 3 4 5 6 5 Actor Actions Click the "Edit Script_Update Script Information" link Edit Organization, Title, Genre, Date, Actors Info., Staffs Info or Edit script contents Input comment message in the comment field Click on "Update" button System Response Save the script file to the local computer and then upload, update this file and information into the database If the comment message is in the comment field, automatically send comment message to users Display an Send Ok message Table 29: Exception Course of Action - Notify Script change Seq# 1 2 Actor Actions Update the user information and then Refer to typical course of action 3-4 System Response Display returned e-mail(bounced email) address 1.3.3.4 Administrator Management 1.3.3.4.1 Administrator Profile Manage Table 30: Process Description Administrator Profile Manage Identifier Purpose Requirements Development Risks Pre-conditions Post-conditions UC- Administrator Profile Manage To update administrator profile CR-15: User Password Change, CR-16: User Profile Edit None The user is the Administrator The user's login session still exists Administrator profile fields in the database are updated 20 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Table 31: Typical Course of Action Administrator Profile Manage Seq# 1 2 Actor Actions Click on Administrator Profile Manage Menu Update Administrator profile fields (Administrator's password, user id, name, etc.) Click on UPDATE Button System Response 3 4 Sends Administrator profile field to the Administrator Profile Manage module of the Theatre Script online system Update the administrator's profile field to the database Display an OK message Table 32: Exception Course of Action Administrator Profile Manage Seq# 1 Actor Actions System Response Display Database error message *Database error : A message Database Error Code + " This data cannot update table" 2 Check error message and each field format. Retry the typical course of action 1.3.3.4.2 User Account_ Script Access Activation Table 33: Process Description User Account_Script Access Activation Identifier Purpose Requirements Development Risks Pre-conditions Post-conditions UC- User Account Activation Administrator can approve user's account, script list request to become a activated user CR-7:User Account Activation, CR-18: User Account Activation Notification,CR-10:Script Access-Update Request,CR-11:Script Access-User Notification None A visitor had to submit a profile including script list into the system Admission or denial will generate an email to the User to update the User on status. Table 34: Typical Course of Action User Account_Script Access Activation Seq# 1 Actor Actions Click on User Account Activation Menu System Response 21 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 2 3 Check Admission field or Denial field to give account activation and select script list of permissible script Click on "Submit" button Display visitor's submission list on the screen 4 5 Update the flag(status) field and to user account table Send activation results and notification to the visitors Table 35: Exception Course of Action User Account_Script Access Activation Seq# 1 Actor Actions System Response Display error message * E-mail error : A message "Display return e-mail address" *Database error : A message Database Error Code + " This data cannot update table" 2 Check user's information and then Refer to typical course of action 1-4 1.3.4Modes of Operation The Theatre Script Online Database, as we envision implementing it, will operate in only one mode, so nothing further needs be said about modes of operation. 1.4 System Analysis Rationale Based on our analysis of how the users interact with the system, as shown in the Behavior subsection of System Behavior Analysis, we have identified 3 classes of operational stakeholders. Administrator this user is maintainer on the Theatre Script Online Database. This user requires authentication in order to access administrator application. Using administrator application, this user can upload, edit scripts, and input script information such as actors, staff, and organization, etc. This user also can announce of new changes and updates to the scripts. 22 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Users (Theatre Staffs and Actors) these users include actors, director, designer, and theatre managers. These users involved in theatre can view, print, and download scripts from webpage over the Internet. They also receive comments from administrator in order to share changes among the distributed script copies. Visitors these are users who are interested in theatre script. Such users connect to the application form webpage over the Internet, with no authentication or authorization being required. They can only search the scripts and view the script lists. Technology-Specific System Design 1.5 Design Overview 1.5.1System Structure The following Hardware Component Diagram shows the Hardware structure. The web/application server will be connected with the client workstations through the Intranet Network and provides both Database system access and Business Logic. 23 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Figure 4: Hardware Component Class Diagram Figure 5: Software Component Class Diagram 24 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Figure 6: Deployment Diagram Figure 7: Web Framework Component Classes Table 36 and Table 37 contain the descriptions of the hardware and software components that make up the Theatre Script Online Database. 25 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Table 36: Hardware Component Description Hardware Component Workstation Web Application Server Description A workstation that connects to the Theatre script Online Database over the Internet Area. A workstation located at the USC campus (administrator) or outside of the campus (users). A Web Application Server that accepts connections from general user and administrator Workstations. Such connections are forwarded to the Web Application Server through the Internet Area Network. The Web Application server communicates with the middleware and provides database access as well as the business logic (component). Table 37: Software Component Description Software Component User Interface Component User Login Component Description This component contains Theatre Script Online Database System web pages for use by all Theatre Script Online Database System users. This component allows the administrator or users to access applications. After login, the administrator can access Upload Script Insert Information, Edit Script Update Information, and Notify Script Change page, Administrator Profile Management Component and the user can access View_Print Script page. This component performs functions involved in administrator information relating to authenticated users of the Theatre Script Online Database system. This component performs script search with search keyword. This component performs display of the script information and opens script file in order to view script contents. This component creates a visitor profile and requests permission to administrator. Request Account Activation Request Script Access Activation Send Notification email to the administrator This component performs all the main functionalities of the Theatre Script management process. These functionalities include: Upload Script and Input Script detail Information Edit Script Contents and Update Script detail Information Notify Script changes Generate user account and script list activation Using JDBC driver, each business logic component can connect to the MySQL Database This is the Database Management System (DBMS) that stores all data used by the Theatre Script Online Database System. Administrator Profile Management Component Search Script_List Component View Script Component Account Creation_ Request Component Script Management Component Java DB Connector MySQL DBMS 26 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Table 38 contains the descriptions of the web framework components used in the Theatre Script Online Database System. These framework components are the supporting structure of the system, but are not implemented by the developers. Table 38: Web Framework Component Description Web Component Browser (Internet Explorer, FireFox) Web Application Server Component (Apache Tomcat) Web Pages (Java Script Language) Description An Internet browser that connects to the Theatre Script Online Database System web application and is responsible for displaying the Theatre Script Online Database web pages. The server component that routes all network traffic and requests between external workstations and the web application server. The server component where the Theatre Script Online Database system resides on. All the logical computations are done on this component. The actual web pages created by the Theatre Script Online Database system. 1.5.2Design Classes The Design Class Diagrams shown below describe the relationships among the boundary, entity, and the control classes for the Theatre Script Online Database System. 1.5.2.1 Interface Classes Figure 8: Interface Class Diagram 27 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 Table 39 contains the description for each design class described for the set of interface classes. Table 39: Interface Class Description Class SearchScript_ListPage View_PrintScriptPage Type Boundary (JSP web page) Boundary (JSP web page) Boundary (JSP web page) Boundary (JSP web page) Boundary (JSP web page) Boundary (JSP web page) Boundary (JSP web page) Description The page to display the script list. Displays the list of all the results searched by user.(main page) Displays the full script contents and script information such as title, organization, actor, etc. Print the script contents. Display the form to submit Log in Displays the form to upload the script and insert script information. Displays the form to edit the script and update script information. Update the administrator information such as User ID, Password, and email, etc. Displays the actors and staffs information involved in the script and allows administrator to send comment message via email. Update the user information such as Password, and email, etc. Display visitor's submission list on the screen and the administrator can update activation flag of the user profile and update access flag of the user script profile. Display account request form, and insert user information into database in order to get permission. Display script request form, and insert user information and script information into database in order to get permission. UserLoginPage UploadScript_InputInformationPage EditScript_UpdateInformationPage AdminProfileManagePage NotifyScriptChangePage UserProfileManagePage Boundary (JSP web page) UserAccount_ScriptAccessActivationPage Boundary (JSP web page) AccountCreationRequestPage ScriptAccessRequestPage Boundary (JSP web page) Boundary (JSP web page) 28 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 1.5.2.2 User Login Classes Figure 9: User Login Class Diagram Table 40 contains the description for each design class described in the User Login classes. Table 40: User Login Class Description Class UserLoginPage UserLoginController (Java Business Logic Class) AdminProfile Type Description Boundary Display the form to submit Log in Component Contains the logical computations for login and checks user profile related account activation. Entity Contains the information submitted by the administrator. This information includes personal information such as Id, password, etc. Entity Contains the information submitted by a user. This information includes personal information such as Id, password, activation flag, etc. 29 04/06/09 UserProfile 379614bfec60d5d4d238a748135ad681c1bfafa6.doc System and Software Architecture Description (SSAD) Version 9.0 MySQL DBMS (COTS) Java DataBase Connector (COTS) Component MySQL Database will be used as a DataBase Management System Component Java DataBase Connector provides connections between business logic component and DBMS 1.5.2.3 Administrator Profile Management Classes Figure 10: Administrator Profile Management Class Diagram Table 41 contains the description for each design class described in the Administrator Profile Management classes. Table 41: Administrator Profile Management Class Description Class AdminProfileManagePage UserProfileManagePage AdminManageController Type Boundary Description Update the administrator information such as User ID, Password, and email, etc. Boundary Update the user information such as Password, and email, etc. Component Contains all the logical computations for 30 04/06/09 379614bfec60d5d4d238a748135ad681c1bfafa6.doc System and Software Architecture Description (SSAD) Version 9.0 (Java Business Logic Class) AdminProfile UserProfileController (Java Business Logic Class) UserProfile MySQL DBMS (COTS) Java DataBase Connector (COTS) updating the administrator profile. Entity Contains the information submitted by the administrator. This information includes personal information such as Id, password, email, name, etc. Component Contains all the logical computations for updating the user profile. Entity Contains the information submitted by a user. This information includes personal information such as Id, password, email, name, permission flag, etc. Component MySQL Database will be used as a DataBase Management System Component Java DataBase Connector provides connections between business logic component and DBMS 31 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 1.5.2.4 Search Script_List Classes Figure 11: Search Script_List Class Diagram Table 42 contains the description for each design class described in the Search Script_List classes. Table 42: Search Script_List Class Description Class SearchScript_ListPage SearchScript_ListController (Java Business Logic Class) ScriptInformation ActorInformation Type Boundary Description The page to display the script list. Displays the list of all the results searched by user. Component Contains all the logical computations for searching the script title. Entity Contains information of a script inserted by the administrator. This information includes script title, genre, and organization. Entity Contains the actor information submitted by the administrator. This information includes actor name, actor role, script_id. 32 04/06/09 379614bfec60d5d4d238a748135ad681c1bfafa6.doc System and Software Architecture Description (SSAD) Version 9.0 ScriptDBfile MySQL DBMS (COTS) Java DataBase Connector (COTS) Entity Contains individual script files Component MySQL Database will be used as a DataBase Management System Component Java DataBase Connector provides connections between business logic component and DBMS 1.5.2.5 View Script Classes Figure 12: View Script Class Diagram Table 43 contains the description for each design class described in the View Script classes. Table 43: View Script Class Description Class View_PrintScriptPage ViewScriptController (Java Business Logic Class) Type Boundary Description Displays the full script contents and script information such as title, organization, actor, etc. Print the script contents. Component Contains all the logical computations for viewing script's contents and script 33 379614bfec60d5d4d238a748135ad681c1bfafa6.doc 04/06/09 System and Software Architecture Description (SSAD) Version 9.0 ScriptInformation ScriptDBfile ActorInformation MySQL DBMS (COTS) Java DataBase Connector (COTS) information such as actors, staffs, and organization. This controller includes printing function to print script contents. Entity Contains information of a script inserted by ...

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

USC - CSCI - 577
Proposal for Ada to AADL TranslatorFeasibility Rationale Description(FRD)Team# 18Team Members DeWitt Latimer IV Mridu Sethi Nidhi Gulati Sapan Lalani Suprabha Ray Swapnil Patel Vijay KakadiaIndependent Verification & Validation System and Soft
USC - CSCI - 577
Project DetailDue : Monday, December 15, 2008 at 11:59 PM Submission : Post the file under Final Deliverables page in your team website File name : ProjectDetail_20083_Txx.doc (xx is your team no.) -Instruction: Fill in this form. Make sure that the
USC - CSCI - 577
System and Software Requirements Definition (SSRD)Theater Script Online DatabaseTeam No 16Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Sandeep Mikkilineni Nory Kealii Nishimura John Christopher Reynolds Julie SanchezProject M
USC - MEDIA - 1105
<!DOCTYPE html PUBLIC "-/W3C/DTD XHTML 1.0 Strict/EN" "http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"><html xmlns="http:/www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head> <title>Changeset 1105 for tools/DotSceneLoaderTemplate/media/
USC - MISC - 2438
<!DOCTYPE html PUBLIC "-/W3C/DTD XHTML 1.0 Strict/EN" "http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"><html xmlns="http:/www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head> <title>Changeset 2438 for ogre/Tests/OgreMain/misc/ArchiveTes
USC - MISC - 2438
<!DOCTYPE html PUBLIC "-/W3C/DTD XHTML 1.0 Strict/EN" "http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"><html xmlns="http:/www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head> <title>Changeset 2438 for ogre/Tests/OgreMain/misc/ArchiveTes
USC - DOCS - 1876
<!DOCTYPE html PUBLIC "-/W3C/DTD XHTML 1.0 Strict/EN" "http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"><html xmlns="http:/www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head> <title>Changeset 1876 for ogreaddons/3dv/MouZe/docs/WorkingDi
USC - DOCS - 1876
<!DOCTYPE html PUBLIC "-/W3C/DTD XHTML 1.0 Strict/EN" "http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"><html xmlns="http:/www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head> <title>Changeset 1876 for ogreaddons/3dv/MouZe/docs/ReadMe.tx
USC - CS - 556
Broadcast Encryption and Content Protection ApplicationsYu Shiu & Yih-Feng Chen University of Southern CaliforniaOutline Motivation and Application Framework of Broadcast Encryption Solution to Broadcast Encryption: SubsetCover Revocation Algo
USC - CS - 665
Report 4 (MidTerm) Exit Criteria1. A defined process for analyzing the data and creating a report including all the data under "Task 3" page 772. (Compliant with Section 13.2, pgs. 442-444.) a) Including a process script. (Use any PSP script as a "
USC - SCF - 480
480 TITLES GUIDESPRING 2007Policies:1. No "Film-by" Credit or Similar Per School of Cinema-TV policy, the following title presentations are NOT allowed under any circumstances (the following are examples, the list is not conclusive): A John Doe Fi
USC - CSCI - 577
CLIENT INTERACTION REPORT-TEAM# 16Project Name: Theatre Script Online Database Organization Name: JulesTBear's Online ScriptoRama Current System System name: None. What it provides to users A script filing cabinet. A place to keep hard copies of
USC - CSCI - 577
Supporting Information Document (SID)NEW ECONOMICS FOR WOMENTeam No: 11Team members and roles Name Raghava Aditya Ravula Tejaswi Chadalavada Nitin Bandi Adil Fulara Veena Movva Swarag Segu Abbey Sullivan Role Project Manager & SSRD & Meeting Fa
USC - CSCI - 577
Systems and Software Architecture Design (SSAD)Version 1.0Project #14: Early Medieval East Asian TombsSiavash Gholami (Project Manager, FRD) Derek Zimmermann (SSAD) Aviral Mathur (Prototyper) Yasin Angara (OCD) Xiaoyan Zhang (LCP) Sijie Zhang (S
USC - CSCI - 577
Life Cycle Plan (LCP)Youthink.com Video Uploading and Conversion System Team 10Sandarsh M Kumar Project Management Rajen Sarda System Analysis Peter Thompson Operational Concept Description Pius Pack Feasibility Rational Description Stephen Cather
USC - CSCI - 577
Supporting Information Document (SID)LCA Package Version 2.2Personal Care Technology Team 9Team Members: Preeti Agrawal Project Management, LCP Akash Haswani Operational Concept Neha Singla Prototype / Implementation Prateek Tandon Requireme
USC - CSCI - 577
Operational Concept Description (OCD)Video Uploading & Conversion SystemTeam 10Stephen Cathers Tasneem Hakim Sandarsh Kumar Pius Pack Rajen Sarda Peter Thompson John Marshall Dean Robert(Prototyping) (System & Software Requirements Description
USC - CSCI - 577
USCC S EUniversity of Southern CaliforniaCenter for Software EngineeringValue-Based Software Engineering (VBSE) and the Incremental Commitment Model (ICM)Barry Boehm, USC CS 510, 577a Lectures Fall 2008USCC S EUniversity of Southern C
USC - CSCI - 577
COTS Survey COTS Integration Pre-Assignment Survey1. Team Number: 5 2. Is system largely dependent on COTS products?Yes.3. How many COTS products does your proposed system utilize (including operating system)? 5 4. List the members of you
Loyola Marymount - MBAD - 617
Ragsdale's Chpt 3.9 Investment ProblemsProblem: how to design a retirement income portfolio for retirees using corporate bonds? Client has $750,000 in liquid assets to invest A list of upcoming bond issues from 6 companies has been identified and
USC - CC - 2420
ARCHITECTURE=The default LPL implementation uses a packet train with acknowledgementsenabled, shortened backoffs, and a spinning energy checking loop.The default strategy can be improved by implementing a different architecture.Right now the a
Southern Utah - ECON - 2020
Money, Banking and the Financial SectorChapter 13McGrawHill/IrwinCopyright 2001 by The McGrawHill Companies, Inc. All rights reserved.13 2Laugher Curve A central banker walks into a pizzeria to order a pizza. When the pizza is done, he
USC - CSCI - 351
<XMP><HTML><HEAD> <TITLE>Homework #5: List</TITLE> <STYLE type="text/css"> OL { color: Navy; font: bold 16px times new roman; list-style-type: upper-roman; } OL OL { color: Blue; font: bold italic 16px t
Virginia Tech - CS - 4984
33 F.3d 1526 63 USLW 2088, 31 U.S.P.Q.2d 1545 (Cite as: 33 F.3d 1526) RICH, Circuit Judge, with whom: United States Court of Appeals, Federal Circuit In re Kuriappan P. ALAPPAT, Edward E. Averill and James G. Larsen. No. 92-1381. July 29, 1994. *1529
SUNY Potsdam - WIDRICCR - 191
Spanish Vocabulary Practice This is an amazing site that provides a variety of categories to choose from to practice and learn Spanish vocabulary with options of having it pronounced for you. Spanish Verb Conjugations This is an amazing site that all
SUNY Potsdam - GLASERIM - 191
Vocabulary QuizNY State Algebra I Chapter 8 Systems of Equations and Inequalities phschool.com Homework Tutor ata-00801 through ata-0806 Name: _ Date Set TopicsCHA 8-1 CHA 8-2Ata-0851 Chapter Test PracticeAssignmentJournal Find the errorZe
University of Texas - BIO - 301
name (required) _revise 2. (4pts) Why is it difficult to measure the harmful effects of the levels and types of ionizing radiation that we think is most relevant to our population? MTF A) Sample size: too few people are exposed to any dose of ionizi
University of Texas - BIO - 301
name _ (required)Exam 4, Bio301D, 6 Dec 061. (4 pts) Key code, box #, and name. Fill in (A B) to indicate your key for this version of the exam. Be sure your name and box number are correctly bubbled in on the scantron and that you have signed th
Alverno College - CS - 270
Finding Your Inner Flyor How Do I Find My Inner Calling and Integrate It Into a Career?What's My Inner Fly?Human fruit flies often seem genetically predisposed to do what they do Instinctively combine their passions with their aptitudesThe r
UMass (Amherst) - CMSTEX - 7427
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>d45388c39de57138e50b0c9c7f576e503d4a146b.pdf%3Ffile %3Dga</Key><RequestId>C54CA1FF88F18B1A</RequestId><HostId>XC9Y3bs5njIkwgF
UMass (Amherst) - CMSTEX - 6757
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>376d9e7e270963f427b491168cab228bef0ea56c.pdf%3Ffile %3Dka</Key><RequestId>B3BFDEA49E0E623F</RequestId><HostId>2ildKFi1Y4DZcYB
SUNY Potsdam - JOHNSOJD - 190
NY State Algebra I Chapter 8 Systems of Equations and Inequalities phschool.com hh Homework Tutor ata0801 through ata0806Vocabulary Quiz Ata-0851 Chapter Test Practice Ata-0852Name: _SetCHA 8-1 CHA 8-2 CHA 8-3 CHA 8-4 CHA 8-5 CHA 8-7DateTo
W. Carolina - CS - 361
8 6 world x and y dims0 0 -3 viewpoint (x, y, z)14 plane2 2 2 r g b ambient6 6 6 r g b diffuse0 0 0 r g b specular0 1 0 normal0 -4 0 point13 sphere1 1 1
W. Carolina - CS - 361
8 6 world x and y dims0 0 -3 viewpoint (x, y, z)14 plane0.0 0.0 0.0 amb, diffuse, spec2.6 2.0 0.0 amb, diffuse, spec0.7 0.7 0.7 amb, diffuse, spec0 1 0 normal0 -4 0 point16
Emory - CS - 323000
I fixed Notes.txt ("Cut Property" and "Cycle Property" were reversed).We did not do the correctness of Prim's algorithm, but it is a prettysimple consequence of the Cut Property. We'll talk about performancenext time.
Emory - CS - 153000
See the lab6 handout for an explanation.
Emory - CS - 153000
We had to edit lcs.pl during class to make it work, filelcs.pl.orig is the original version. It has "lcs_cache" inone place, instead of "llcs_cache", and no "use strict"which would have caught the error.The original version falls back into the
Emory - CS - 0126
In class I edited ./0123/hw1.pl with the resulting file"hw1-nodefault.pl", so we did not look at the prepared file"hw1-rewrite.pl" (and the "Tom Toady" motto).We did look at example5-6.pl and example5-7.pl, but (as Iexpected) we did not have tim
Emory - CS - 323000
I just spoke today, no code. Here are summary notes of whatI recall discussing. We should see working code Friday.I started with a high-level preview of shortest paths andthe three algorithms, as listed in Notes.txt.I defined shortest paths o
Emory - IBS - 574
For today's class we will meet in the computer lab, B28 of the Dental School building. We will go over the following papers. See the blackboard for copies of the papers. Kulkarni-Kale, 2007. Jeenduang, 2008. Jongejan, 2008.We will review new mod
USC - CSCI - 201
/Figure 2-27import java.util.Vector;import Item;class ProducerConsumerMonitor extends Object { private final int N = 5; private int count = 0; private Vector theData; synchronized public void insert(Item data) { whil
USC - CSCI - 201
TYPICAL TRANSMISSIONS FOR ARRIVALS AT LOS ANGELES TOWERSWA111/112-Southwest One Eleven/Twelve LC-2-Local Control Two (North Tower) GC-2-Ground Control Two (North Ground) CD-Clearance DeliverySWA111 Los Angeles Tower, this is Southwest One Eleven fi
Emory - BENSON - 361
PHYSICS 361:Analytical Mechanics I BensonMWF11:45-12:35MAX: 6WRT: NoFor B.A. physics and other mathematical science majors (B.S. physicsmajors should take Physics 361S). More complete mathematicaltreatment of classical mechanics, focusing
Emory - CS - 323000
Reminder: hw4 program due 11:59pm Monday (4/13)There are only about two weeks left, expect only one more regularhomework+program homework, hw5, probably Monday. (If there isanything else, it will only be written or makeup work.)Today we'll go
W. Carolina - PDFS - 304
Advanced Technical Writing Organization A guide for users of a major city library is organized alphabetically. Topics are listed below. Discuss the merits and limitations of alphabetical organization for this document if the readers are first-time us
UMass (Amherst) - CMSTEX - 0544
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>b5300218f10f2e87efa7bdbd80ecf03dc15f29bb.pdf%3Ffile %3Dzv</Key><RequestId>30232869F6772BF1</RequestId><HostId>F8ckQP0vd/73RQG
University of Texas - MIS - 380
Using The Lognormal Random Variable to Model Stock Prices2Using The Lognormal Random Variable to Model Stock PricesIn reality, stock prices can assume any non-negative value. In a binomial tree, of course, only a finite number of stock prices ar
USC - CSCI - 577
Project #8: AAA Petal Pushers Remote R&D Client Meeting Note #6 Date Venue Start time Attendee: Name Chatupoln Taparugssanagorn Ampatcha Satornsantikul Chatchai Sinthop Sattawat Suppalertporn Saranya Iranoppaiboon John Lindsey Apology: Name Ryan Lee
UMass (Amherst) - CMSTEX - 0488
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>081262e20a0e972a572f90cf586ebf5c0058762e.pdf%3Ffile %3Ddu</Key><RequestId>3B3D88EC67A65393</RequestId><HostId>K8lVlKD5XUrVQPp
Emory - E - 411
EMORY UNIVERSITY DEPARTMENT OF ECONOMICS Money and Banking Econ 411 WRInstructor: Stefan Krause (skrause@emory.edu) Classroom: Rich Hall 104 Mon, Wed & Fri 3:00-3:50pmOffice: Rich Hall 321 Off. Hrs.: Mon & Wed 2:00-2:50pm Phone: 404-727-2944Tex
Emory - CS - 0410
GCCCTGTGGTGCCAGTCATAACCCCACGACTCTACTGCCAGACAGTCCGTTGGGCCGTAAAGTCCAGCGCGGCTCGTCATGCTTTGCCAGGCGGATCTCTGTGCTACTGATGAGGGATACTTCCGTCTGACGATAAGTGGAGCGCGGTGGGTTGTGCTGCGTCCATGGTTACCCCTCGTGTAGTCATCTTGAAATTGCGATGGGCACAGGAGCCAAGACCCGATAGTAGTTGTGCGTCCCCGGTAAC
Emory - CS - 0410
ADMINISTRATIVE: Note there are just a bit over two weeks left in thecourse. Expect only one more Perl lab (lab8), probably Monday. If wedo have any other work in the course, it will probably be written, notprogramming. We will have a final exam
USC - CS - 551
Return-Path: william@bourbon.usc.eduDelivery-Date: Wed Sep 3 23:12:15 2008X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.eduX-Spam-Level: X-Spam-Status: No, score=-2.3 required=5.0 tests=AWL,BAYES_00 autolearn=hamversion
UMass (Amherst) - CMSTEX - 7675
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>26056cff7d722f6e4eb85c179cf38fecf0c5e7e8.pdf%3Ffile %3Dou</Key><RequestId>9885A9591B319512</RequestId><HostId>k0jzBl9mjplykCw
USC - CSCI - 577
Quality Management Plan (QMP)Open Source XML Parser-Based Code Count ToolTeam 23Ali Afzal Malik Harsh Nayak Kunal Kulkarni Vannak Touch Naman Modi Matthew Benjamin QMP_IOC1_S06b_T23_V1.2.docProject Manager and Configuration Manager Tester and
W. Carolina - ASSIGN - 401
Style Revision Assignment Due: 1/23 In the following memo, the Vice President of the company (Cindi Tuffboss) required an employee (Billy Joe Bobby Bob) to verify that a co-worker of Billy's (Chris Doe) was falsifying time card data. Basically, Billy
UMass (Amherst) - CMSTEX - 7957
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>305dce5019c0e364c7c7d635ff1734df8b84bb29.pdf%3Ffile %3Ddr</Key><RequestId>40AD95E0135EFE24</RequestId><HostId>RD6bs5Er/Qy5mP0
Allan Hancock College - LNGS - 1005
Writing in an academic style Academic writing tends to be authoritative and objective: the language is formal, technical and impersonal. Academic spoken English is also technical, but slightly less formal and impersonal. The features of spoken and wr
USC - CSCI - 511
USCC S EUniversity of Southern CaliforniaCenter for Software EngineeringCSCI 511 Winter 2003"Project" 2J Increment DeliverablesApril 23, 2003 2009 AW Brown & USC-CSE 24fab538f65bea90a962e07d45c159d5a9a13e42.DOC1 v1.0 - 05/18/09USCCSC
UMass (Amherst) - CMSTEX - 7606
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>795df3f9baeca670060b28423c51166af305e861.pdf%3Ffile %3Dko</Key><RequestId>95EEE431A5214EDA</RequestId><HostId>SgL9coMwwk9HhA0
USC - CSCI - 577
System and Software Requirements Definition (SSRD)Student Progress Web ApplicationTeam 8NAME Ashish Singh Ritesh Taunk Amarkanth Ranganamayna Ritesh Kothari Patrick Stevens Yue Chen Mike OppenheimROLE Project Manager Developer V&V Developer V