Register now to access 7 million high quality study materials (What's Course Hero?) Course Hero is the premier provider of high quality online educational resources. With millions of study documents, online tutors, digital flashcards and free courseware, Course Hero is helping students learn more efficiently and effectively. Whether you're interested in exploring new subjects or mastering key topics for your next exam, Course Hero has the tools you need to achieve your goals.
3 Pages
ReadMe
Course: DOCS 1876, Fall 2009School: USC
Rating:
Word Count: 831
Document Preview
html <!DOCTYPE PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"> <head> <title>Changeset 1876 for ogreaddons/3dv/MouZe/docs/ReadMe.txt - GamePipe...
Unformatted Document Excerpt
Coursehero >> California >> USC >> DOCS 1876Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
html
<!DOCTYPE PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en">
<head>
<title>Changeset 1876 for ogreaddons/3dv/MouZe/docs/ReadMe.txt - GamePipe Game Engine - Trac</title><link rel="start" href="/trac/gge/wiki" /><link rel="search" href="/trac/gge/search" /><link rel="help" href="/trac/gge/wiki/TracGuide" /><link rel="stylesheet" href="/trac/gge/chrome/common/css/trac.css" type="text/css" /><link rel="stylesheet" href="/trac/gge/chrome/common/css/changeset.css" type="text/css" /><link rel="stylesheet" href="/trac/gge/chrome/common/css/diff.css" type="text/css" /><link rel="stylesheet" href="/trac/gge/chrome/common/css/code.css" type="text/css" /><link rel="stylesheet" href="/trac/gge/chrome/tracwysiwyg/wysiwyg.css" type="text/css" /><link rel="icon" href="/trac/gge/chrome/common/trac.ico" type="image/x-icon" /><link rel="shortcut icon" href="/trac/gge/chrome/common/trac.ico" type="image/x-icon" /><link rel="alternate" href="?format=diff&new=1876" title="Unified Diff" type="text/plain" /><link rel="alternate" href="?format=zip&new=1876" title="Zip Archive" type="application/zip" /><style type="text/css">
</style>
<script type="text/javascript" src="/trac/gge/chrome/common/js/trac.js"></script>
</head>
<body>
<div id="banner">
<div id="header"><a id="logo" href="http://motorola.usc.edu/trac/gge"><img src="/trac/gge/chrome/common/trac_banner.png" alt="" /></a><hr /></div>
<form id="search" action="/trac/gge/search" method="get">
</form>
<div id="metanav" class="nav"><ul><li class="first"><a href="/trac/gge/login">Login</a></li><li><a href="/trac/gge/settings">Settings</a></li><li><a accesskey="6" href="/trac/gge/wiki/TracGuide">Help/Guide</a></li><li><a href="/trac/gge/about">About Trac</a></li><li><a href="/trac/gge/register">Register</a></li><li class="last"><a href="/trac/gge/reset_password">Forgot your password?</a></li></ul></div>
</div>
<div id="mainnav" class="nav"><ul><li class="first"><a accesskey="1" href="/trac/gge/wiki">Wiki</a></li><li><a accesskey="2" href="/trac/gge/timeline">Timeline</a></li><li><a accesskey="3" href="/trac/gge/roadmap">Roadmap</a></li><li class="active"><a href="/trac/gge/browser">Browse Source</a></li><li class="last"><a href="/trac/gge/report">View Tickets</a></li></ul></div>
<div id="main">
<div id="ctxtnav" class="nav">
<h2>Navigation</h2>
<ul>
<li class="first">
<span class="missing">← Previous Change</span>
</li>
<li class="last">
<span class="missing">Next Change →</span>
</li>
</ul>
</div>
<div class="changeset">
id="content" <div id="title">
<h1>Changeset <a title="Show full changeset" href="/trac/gge/changeset/1876">
1876</a>
for <a title="Show entry in browser" href="/trac/gge/browser/ogreaddons/3dv/MouZe/docs/ReadMe.txt?rev=1876">
ogreaddons/3dv/MouZe/docs/ReadMe.txt</a>
</h1>
</div>
<dl id="overview">
<dt class="property time">Timestamp:</dt>
<dd class="time">04/28/2008 11:05:26 AM
(1 year ago)</dd>
<dt class="property author">Author:</dt>
<dd class="author">greg</dd>
<dt class="property message">Message:</dt>
<dd class="message" id="searchable"><p>
remove unnecesary filres <br />
</p>
</dd>
<dt class="property files">
Files:
</dt>
<dd class="files">
<ul>
<li>
<div class="add"></div>
<a title="Show entry in browser" href="/trac/gge/browser/ogreaddons/3dv/MouZe?rev=1876">ogreaddons/3dv/MouZe</a>
<span class="comment">(added)</span>
</li>
<li>
<div class="add"></div>
<a title="Show entry in browser" href="/trac/gge/browser/ogreaddons/3dv/MouZe/docs?rev=1876">ogreaddons/3dv/MouZe/docs</a>
<span class="comment">(added)</span>
</li>
<li>
<div class="add"></div>
<a title="Show entry in browser" href="/trac/gge/browser/ogreaddons/3dv/MouZe/docs/ReadMe.txt?rev=1876">ogreaddons/3dv/MouZe/docs/ReadMe.txt</a>
<span class="comment">(added)</span>
</li>
</ul>
</dd>
</dl>
<div class="diff">
<div id="legend">
<h3>Legend:</h3>
<dl>
<dt class="unmod"></dt><dd>Unmodified</dd>
<dt class="add"></dt><dd>Added</dd>
<dt class="rem"></dt><dd>Removed</dd>
<dt class="mod"></dt><dd>Modified</dd>
<dt class="cp"></dt><dd>Copied</dd>
<dt class="mv"></dt><dd>Moved</dd>
</dl>
</div>
<ul class="entries"></ul>
</div>
</div>
<script type="text/javascript">searchHighlight()</script>
<div id="altlinks"><h3>Download in other formats:</h3><ul><li class="first"><a href="?format=diff&new=1876" class="diff">Unified Diff</a></li><li class="last"><a href="?format=zip&new=1876" class="zip">Zip Archive</a></li></ul></div>
</div>
<div id="footer">
<hr />
<a id="tracpowered" href="http://trac.edgewall.org/"><img src="/trac/gge/chrome/common/trac_logo_mini.png" height="30" width="107"
alt="Trac Powered"/></a>
<p class="left">
Powered by <a href="/trac/gge/about"><strong>Trac 0.10.4</strong></a><br />
By <a href="http://www.edgewall.org/">Edgewall Software</a>.
</p>
<p class="right">
Visit the Trac open source project at<br /><a href="http://trac.edgewall.org/">http://trac.edgewall.org/</a><script type="text/javascript" charset="utf-8" src="/trac/gge/chrome/tracwysiwyg/wysiwyg.js"></script>
</p>
</div>
</body>
</html>
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more.
Course Hero has millions of course specific materials providing students with the best way to expand
their education.
Below is a small sample set of documents:
Below is a small sample set of documents:
USC - CS - 556
Broadcast Encryption and Content Protection ApplicationsYu Shiu & Yih-Feng Chen University of Southern CaliforniaOutline Motivation and Application Framework of Broadcast Encryption Solution to Broadcast Encryption: SubsetCover Revocation Algo
USC - CS - 665
Report 4 (MidTerm) Exit Criteria1. A defined process for analyzing the data and creating a report including all the data under "Task 3" page 772. (Compliant with Section 13.2, pgs. 442-444.) a) Including a process script. (Use any PSP script as a "
USC - SCF - 480
480 TITLES GUIDESPRING 2007Policies:1. No "Film-by" Credit or Similar Per School of Cinema-TV policy, the following title presentations are NOT allowed under any circumstances (the following are examples, the list is not conclusive): A John Doe Fi
USC - CSCI - 577
CLIENT INTERACTION REPORT-TEAM# 16Project Name: Theatre Script Online Database Organization Name: JulesTBear's Online ScriptoRama Current System System name: None. What it provides to users A script filing cabinet. A place to keep hard copies of
USC - CSCI - 577
Supporting Information Document (SID)NEW ECONOMICS FOR WOMENTeam No: 11Team members and roles Name Raghava Aditya Ravula Tejaswi Chadalavada Nitin Bandi Adil Fulara Veena Movva Swarag Segu Abbey Sullivan Role Project Manager & SSRD & Meeting Fa
USC - CSCI - 577
Systems and Software Architecture Design (SSAD)Version 1.0Project #14: Early Medieval East Asian TombsSiavash Gholami (Project Manager, FRD) Derek Zimmermann (SSAD) Aviral Mathur (Prototyper) Yasin Angara (OCD) Xiaoyan Zhang (LCP) Sijie Zhang (S
USC - CSCI - 577
Life Cycle Plan (LCP)Youthink.com Video Uploading and Conversion System Team 10Sandarsh M Kumar Project Management Rajen Sarda System Analysis Peter Thompson Operational Concept Description Pius Pack Feasibility Rational Description Stephen Cather
USC - CSCI - 577
Supporting Information Document (SID)LCA Package Version 2.2Personal Care Technology Team 9Team Members: Preeti Agrawal Project Management, LCP Akash Haswani Operational Concept Neha Singla Prototype / Implementation Prateek Tandon Requireme
USC - CSCI - 577
Operational Concept Description (OCD)Video Uploading & Conversion SystemTeam 10Stephen Cathers Tasneem Hakim Sandarsh Kumar Pius Pack Rajen Sarda Peter Thompson John Marshall Dean Robert(Prototyping) (System & Software Requirements Description
USC - CSCI - 577
USCC S EUniversity of Southern CaliforniaCenter for Software EngineeringValue-Based Software Engineering (VBSE) and the Incremental Commitment Model (ICM)Barry Boehm, USC CS 510, 577a Lectures Fall 2008USCC S EUniversity of Southern C
USC - CSCI - 577
COTS Survey COTS Integration Pre-Assignment Survey1. Team Number: 5 2. Is system largely dependent on COTS products?Yes.3. How many COTS products does your proposed system utilize (including operating system)? 5 4. List the members of you
Loyola Marymount - MBAD - 617
Ragsdale's Chpt 3.9 Investment ProblemsProblem: how to design a retirement income portfolio for retirees using corporate bonds? Client has $750,000 in liquid assets to invest A list of upcoming bond issues from 6 companies has been identified and
USC - CC - 2420
ARCHITECTURE=The default LPL implementation uses a packet train with acknowledgementsenabled, shortened backoffs, and a spinning energy checking loop.The default strategy can be improved by implementing a different architecture.Right now the a
Southern Utah - ECON - 2020
Money, Banking and the Financial SectorChapter 13McGrawHill/IrwinCopyright 2001 by The McGrawHill Companies, Inc. All rights reserved.13 2Laugher Curve A central banker walks into a pizzeria to order a pizza. When the pizza is done, he
USC - CSCI - 351
<XMP><HTML><HEAD> <TITLE>Homework #5: List</TITLE> <STYLE type="text/css"> OL { color: Navy; font: bold 16px times new roman; list-style-type: upper-roman; } OL OL { color: Blue; font: bold italic 16px t
Virginia Tech - CS - 4984
33 F.3d 1526 63 USLW 2088, 31 U.S.P.Q.2d 1545 (Cite as: 33 F.3d 1526) RICH, Circuit Judge, with whom: United States Court of Appeals, Federal Circuit In re Kuriappan P. ALAPPAT, Edward E. Averill and James G. Larsen. No. 92-1381. July 29, 1994. *1529
SUNY Potsdam - WIDRICCR - 191
Spanish Vocabulary Practice This is an amazing site that provides a variety of categories to choose from to practice and learn Spanish vocabulary with options of having it pronounced for you. Spanish Verb Conjugations This is an amazing site that all
SUNY Potsdam - GLASERIM - 191
Vocabulary QuizNY State Algebra I Chapter 8 Systems of Equations and Inequalities phschool.com Homework Tutor ata-00801 through ata-0806 Name: _ Date Set TopicsCHA 8-1 CHA 8-2Ata-0851 Chapter Test PracticeAssignmentJournal Find the errorZe
University of Texas - BIO - 301
name (required) _revise 2. (4pts) Why is it difficult to measure the harmful effects of the levels and types of ionizing radiation that we think is most relevant to our population? MTF A) Sample size: too few people are exposed to any dose of ionizi
University of Texas - BIO - 301
name _ (required)Exam 4, Bio301D, 6 Dec 061. (4 pts) Key code, box #, and name. Fill in (A B) to indicate your key for this version of the exam. Be sure your name and box number are correctly bubbled in on the scantron and that you have signed th
Alverno College - CS - 270
Finding Your Inner Flyor How Do I Find My Inner Calling and Integrate It Into a Career?What's My Inner Fly?Human fruit flies often seem genetically predisposed to do what they do Instinctively combine their passions with their aptitudesThe r
UMass (Amherst) - CMSTEX - 7427
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>d45388c39de57138e50b0c9c7f576e503d4a146b.pdf%3Ffile %3Dga</Key><RequestId>C54CA1FF88F18B1A</RequestId><HostId>XC9Y3bs5njIkwgF
UMass (Amherst) - CMSTEX - 6757
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>376d9e7e270963f427b491168cab228bef0ea56c.pdf%3Ffile %3Dka</Key><RequestId>B3BFDEA49E0E623F</RequestId><HostId>2ildKFi1Y4DZcYB
SUNY Potsdam - JOHNSOJD - 190
NY State Algebra I Chapter 8 Systems of Equations and Inequalities phschool.com hh Homework Tutor ata0801 through ata0806Vocabulary Quiz Ata-0851 Chapter Test Practice Ata-0852Name: _SetCHA 8-1 CHA 8-2 CHA 8-3 CHA 8-4 CHA 8-5 CHA 8-7DateTo
W. Carolina - CS - 361
8 6 world x and y dims0 0 -3 viewpoint (x, y, z)14 plane2 2 2 r g b ambient6 6 6 r g b diffuse0 0 0 r g b specular0 1 0 normal0 -4 0 point13 sphere1 1 1
W. Carolina - CS - 361
8 6 world x and y dims0 0 -3 viewpoint (x, y, z)14 plane0.0 0.0 0.0 amb, diffuse, spec2.6 2.0 0.0 amb, diffuse, spec0.7 0.7 0.7 amb, diffuse, spec0 1 0 normal0 -4 0 point16
Emory - CS - 323000
I fixed Notes.txt ("Cut Property" and "Cycle Property" were reversed).We did not do the correctness of Prim's algorithm, but it is a prettysimple consequence of the Cut Property. We'll talk about performancenext time.
Emory - CS - 153000
We had to edit lcs.pl during class to make it work, filelcs.pl.orig is the original version. It has "lcs_cache" inone place, instead of "llcs_cache", and no "use strict"which would have caught the error.The original version falls back into the
Emory - CS - 0126
In class I edited ./0123/hw1.pl with the resulting file"hw1-nodefault.pl", so we did not look at the prepared file"hw1-rewrite.pl" (and the "Tom Toady" motto).We did look at example5-6.pl and example5-7.pl, but (as Iexpected) we did not have tim
Emory - CS - 323000
I just spoke today, no code. Here are summary notes of whatI recall discussing. We should see working code Friday.I started with a high-level preview of shortest paths andthe three algorithms, as listed in Notes.txt.I defined shortest paths o
Emory - IBS - 574
For today's class we will meet in the computer lab, B28 of the Dental School building. We will go over the following papers. See the blackboard for copies of the papers. Kulkarni-Kale, 2007. Jeenduang, 2008. Jongejan, 2008.We will review new mod
USC - CSCI - 201
/Figure 2-27import java.util.Vector;import Item;class ProducerConsumerMonitor extends Object { private final int N = 5; private int count = 0; private Vector theData; synchronized public void insert(Item data) { whil
USC - CSCI - 201
TYPICAL TRANSMISSIONS FOR ARRIVALS AT LOS ANGELES TOWERSWA111/112-Southwest One Eleven/Twelve LC-2-Local Control Two (North Tower) GC-2-Ground Control Two (North Ground) CD-Clearance DeliverySWA111 Los Angeles Tower, this is Southwest One Eleven fi
Emory - BENSON - 361
PHYSICS 361:Analytical Mechanics I BensonMWF11:45-12:35MAX: 6WRT: NoFor B.A. physics and other mathematical science majors (B.S. physicsmajors should take Physics 361S). More complete mathematicaltreatment of classical mechanics, focusing
Emory - CS - 323000
Reminder: hw4 program due 11:59pm Monday (4/13)There are only about two weeks left, expect only one more regularhomework+program homework, hw5, probably Monday. (If there isanything else, it will only be written or makeup work.)Today we'll go
W. Carolina - PDFS - 304
Advanced Technical Writing Organization A guide for users of a major city library is organized alphabetically. Topics are listed below. Discuss the merits and limitations of alphabetical organization for this document if the readers are first-time us
UMass (Amherst) - CMSTEX - 0544
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>b5300218f10f2e87efa7bdbd80ecf03dc15f29bb.pdf%3Ffile %3Dzv</Key><RequestId>30232869F6772BF1</RequestId><HostId>F8ckQP0vd/73RQG
University of Texas - MIS - 380
Using The Lognormal Random Variable to Model Stock Prices2Using The Lognormal Random Variable to Model Stock PricesIn reality, stock prices can assume any non-negative value. In a binomial tree, of course, only a finite number of stock prices ar
USC - CSCI - 577
Project #8: AAA Petal Pushers Remote R&D Client Meeting Note #6 Date Venue Start time Attendee: Name Chatupoln Taparugssanagorn Ampatcha Satornsantikul Chatchai Sinthop Sattawat Suppalertporn Saranya Iranoppaiboon John Lindsey Apology: Name Ryan Lee
UMass (Amherst) - CMSTEX - 0488
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>081262e20a0e972a572f90cf586ebf5c0058762e.pdf%3Ffile %3Ddu</Key><RequestId>3B3D88EC67A65393</RequestId><HostId>K8lVlKD5XUrVQPp
Emory - E - 411
EMORY UNIVERSITY DEPARTMENT OF ECONOMICS Money and Banking Econ 411 WRInstructor: Stefan Krause (skrause@emory.edu) Classroom: Rich Hall 104 Mon, Wed & Fri 3:00-3:50pmOffice: Rich Hall 321 Off. Hrs.: Mon & Wed 2:00-2:50pm Phone: 404-727-2944Tex
Emory - CS - 0410
GCCCTGTGGTGCCAGTCATAACCCCACGACTCTACTGCCAGACAGTCCGTTGGGCCGTAAAGTCCAGCGCGGCTCGTCATGCTTTGCCAGGCGGATCTCTGTGCTACTGATGAGGGATACTTCCGTCTGACGATAAGTGGAGCGCGGTGGGTTGTGCTGCGTCCATGGTTACCCCTCGTGTAGTCATCTTGAAATTGCGATGGGCACAGGAGCCAAGACCCGATAGTAGTTGTGCGTCCCCGGTAAC
Emory - CS - 0410
ADMINISTRATIVE: Note there are just a bit over two weeks left in thecourse. Expect only one more Perl lab (lab8), probably Monday. If wedo have any other work in the course, it will probably be written, notprogramming. We will have a final exam
USC - CS - 551
Return-Path: william@bourbon.usc.eduDelivery-Date: Wed Sep 3 23:12:15 2008X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.eduX-Spam-Level: X-Spam-Status: No, score=-2.3 required=5.0 tests=AWL,BAYES_00 autolearn=hamversion
UMass (Amherst) - CMSTEX - 7675
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>26056cff7d722f6e4eb85c179cf38fecf0c5e7e8.pdf%3Ffile %3Dou</Key><RequestId>9885A9591B319512</RequestId><HostId>k0jzBl9mjplykCw
USC - CSCI - 577
Quality Management Plan (QMP)Open Source XML Parser-Based Code Count ToolTeam 23Ali Afzal Malik Harsh Nayak Kunal Kulkarni Vannak Touch Naman Modi Matthew Benjamin QMP_IOC1_S06b_T23_V1.2.docProject Manager and Configuration Manager Tester and
W. Carolina - ASSIGN - 401
Style Revision Assignment Due: 1/23 In the following memo, the Vice President of the company (Cindi Tuffboss) required an employee (Billy Joe Bobby Bob) to verify that a co-worker of Billy's (Chris Doe) was falsifying time card data. Basically, Billy
UMass (Amherst) - CMSTEX - 7957
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>305dce5019c0e364c7c7d635ff1734df8b84bb29.pdf%3Ffile %3Ddr</Key><RequestId>40AD95E0135EFE24</RequestId><HostId>RD6bs5Er/Qy5mP0
Allan Hancock College - LNGS - 1005
Writing in an academic style Academic writing tends to be authoritative and objective: the language is formal, technical and impersonal. Academic spoken English is also technical, but slightly less formal and impersonal. The features of spoken and wr
USC - CSCI - 511
USCC S EUniversity of Southern CaliforniaCenter for Software EngineeringCSCI 511 Winter 2003"Project" 2J Increment DeliverablesApril 23, 2003 2009 AW Brown & USC-CSE 24fab538f65bea90a962e07d45c159d5a9a13e42.DOC1 v1.0 - 05/18/09USCCSC
UMass (Amherst) - CMSTEX - 7606
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>795df3f9baeca670060b28423c51166af305e861.pdf%3Ffile %3Dko</Key><RequestId>95EEE431A5214EDA</RequestId><HostId>SgL9coMwwk9HhA0
USC - CSCI - 577
System and Software Requirements Definition (SSRD)Student Progress Web ApplicationTeam 8NAME Ashish Singh Ritesh Taunk Amarkanth Ranganamayna Ritesh Kothari Patrick Stevens Yue Chen Mike OppenheimROLE Project Manager Developer V&V Developer V
USC - PUB - 20060201
02e9440532072a0c467fb12edc7d286c changelog.txt71397978ea7d95d95ff4fe1c901a7796 mit-scheme-20060201-ix86-gnu-linux.tar.gz9a053c6571741179af3022702a462f28 mit-scheme-20060201-ix86-win32.exe3d05bbec3844959fcec028adab780c4b mit-scheme-20060201-uco
Emory - BAHS - 501
DNA Structure/CompositionSeptember 4, 2003Flow of Genetic InformationRNA Transcription DNA Replication Protein TranslationDNA is the Genetic MaterialsDNA encodes all the information in the cell s The composition of the DNA is the same in al
USC - CSCI - 577
Life Cycle Plan (LCP)Data Mining of Digital Library Usage DataTeam 7 Hui-Hsien Chi FRD Shing-Cheung Chan OCD Maxim Krivokon SSRD Hsiao-Han Huang SSAD Fenny Muliawan LCP/Prototype Pei-Han Li - UMLOctober 11, 2004Life Cycle PlanVersion 1.
UMass (Amherst) - CMSTEX - 7749
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>9f144ccc9f23ad604c3c0ba6a9c8ceea81d1cd87.pdf%3Ffile %3Dab</Key><RequestId>A803F674AEE10FDF</RequestId><HostId>xThmquzcfv7qjGI
USC - CSCI - 577
This directory holds all the USC COCOMO files that were created for this project.
USC - CSCI - 577
Plan SummaryTeam Number: Week: Program Size (SLOC) Base Added Deleted Modified Reused # of COTS Total New SLOC Effort (Hours) Project Mgmt. Requirements COTS Assessment Design Life Cycle Planning Configuration Mgmt. Feasibility Analysis Code COTS Ta
UMass (Amherst) - CMSTEX - 6954
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>0a035b6daf30dadc6a094811c23168930ea81e34.pdf%3Ffile %3Dli</Key><RequestId>18B8BC653093C798</RequestId><HostId>GT0i994GOMror82
USC - CSCI - 577
Section 5: Risk AssessmentTable 1: Risk AssessmentRisks 1. OCR software-Client wants to convert scan file (script images) to text file. To complete this requirement, this system has to be integrated with the OCR software. 2. Budgets for Development