Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more.
Course Hero has millions of course specific materials providing students with the best way to expand
their education.
Below is a small sample set of documents:
W. Carolina - PDFS - 304
Advanced Technical Writing Organization A guide for users of a major city library is organized alphabetically. Topics are listed below. Discuss the merits and limitations of alphabetical organization for this document if the readers are first-time us
UMass (Amherst) - CMSTEX - 0544
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>b5300218f10f2e87efa7bdbd80ecf03dc15f29bb.pdf%3Ffile %3Dzv</Key><RequestId>30232869F6772BF1</RequestId><HostId>F8ckQP0vd/73RQG
University of Texas - MIS - 380
Using The Lognormal Random Variable to Model Stock Prices2Using The Lognormal Random Variable to Model Stock PricesIn reality, stock prices can assume any non-negative value. In a binomial tree, of course, only a finite number of stock prices ar
USC - CSCI - 577
Project #8: AAA Petal Pushers Remote R&D Client Meeting Note #6 Date Venue Start time Attendee: Name Chatupoln Taparugssanagorn Ampatcha Satornsantikul Chatchai Sinthop Sattawat Suppalertporn Saranya Iranoppaiboon John Lindsey Apology: Name Ryan Lee
UMass (Amherst) - CMSTEX - 0488
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>081262e20a0e972a572f90cf586ebf5c0058762e.pdf%3Ffile %3Ddu</Key><RequestId>3B3D88EC67A65393</RequestId><HostId>K8lVlKD5XUrVQPp
Emory - E - 411
EMORY UNIVERSITY DEPARTMENT OF ECONOMICS Money and Banking Econ 411 WRInstructor: Stefan Krause (skrause@emory.edu) Classroom: Rich Hall 104 Mon, Wed & Fri 3:00-3:50pmOffice: Rich Hall 321 Off. Hrs.: Mon & Wed 2:00-2:50pm Phone: 404-727-2944Tex
Emory - CS - 0410
GCCCTGTGGTGCCAGTCATAACCCCACGACTCTACTGCCAGACAGTCCGTTGGGCCGTAAAGTCCAGCGCGGCTCGTCATGCTTTGCCAGGCGGATCTCTGTGCTACTGATGAGGGATACTTCCGTCTGACGATAAGTGGAGCGCGGTGGGTTGTGCTGCGTCCATGGTTACCCCTCGTGTAGTCATCTTGAAATTGCGATGGGCACAGGAGCCAAGACCCGATAGTAGTTGTGCGTCCCCGGTAAC
Emory - CS - 0410
ADMINISTRATIVE: Note there are just a bit over two weeks left in thecourse. Expect only one more Perl lab (lab8), probably Monday. If wedo have any other work in the course, it will probably be written, notprogramming. We will have a final exam
USC - CS - 551
Return-Path: william@bourbon.usc.eduDelivery-Date: Wed Sep 3 23:12:15 2008X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.eduX-Spam-Level: X-Spam-Status: No, score=-2.3 required=5.0 tests=AWL,BAYES_00 autolearn=hamversion
UMass (Amherst) - CMSTEX - 7675
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>26056cff7d722f6e4eb85c179cf38fecf0c5e7e8.pdf%3Ffile %3Dou</Key><RequestId>9885A9591B319512</RequestId><HostId>k0jzBl9mjplykCw
USC - CSCI - 577
Quality Management Plan (QMP)Open Source XML Parser-Based Code Count ToolTeam 23Ali Afzal Malik Harsh Nayak Kunal Kulkarni Vannak Touch Naman Modi Matthew Benjamin QMP_IOC1_S06b_T23_V1.2.docProject Manager and Configuration Manager Tester and
W. Carolina - ASSIGN - 401
Style Revision Assignment Due: 1/23 In the following memo, the Vice President of the company (Cindi Tuffboss) required an employee (Billy Joe Bobby Bob) to verify that a co-worker of Billy's (Chris Doe) was falsifying time card data. Basically, Billy
UMass (Amherst) - CMSTEX - 7957
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>305dce5019c0e364c7c7d635ff1734df8b84bb29.pdf%3Ffile %3Ddr</Key><RequestId>40AD95E0135EFE24</RequestId><HostId>RD6bs5Er/Qy5mP0
Allan Hancock College - LNGS - 1005
Writing in an academic style Academic writing tends to be authoritative and objective: the language is formal, technical and impersonal. Academic spoken English is also technical, but slightly less formal and impersonal. The features of spoken and wr
USC - CSCI - 511
USCC S EUniversity of Southern CaliforniaCenter for Software EngineeringCSCI 511 Winter 2003"Project" 2J Increment DeliverablesApril 23, 2003 2009 AW Brown & USC-CSE 24fab538f65bea90a962e07d45c159d5a9a13e42.DOC1 v1.0 - 05/18/09USCCSC
UMass (Amherst) - CMSTEX - 7606
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>795df3f9baeca670060b28423c51166af305e861.pdf%3Ffile %3Dko</Key><RequestId>95EEE431A5214EDA</RequestId><HostId>SgL9coMwwk9HhA0
USC - CSCI - 577
System and Software Requirements Definition (SSRD)Student Progress Web ApplicationTeam 8NAME Ashish Singh Ritesh Taunk Amarkanth Ranganamayna Ritesh Kothari Patrick Stevens Yue Chen Mike OppenheimROLE Project Manager Developer V&V Developer V
USC - PUB - 20060201
02e9440532072a0c467fb12edc7d286c changelog.txt71397978ea7d95d95ff4fe1c901a7796 mit-scheme-20060201-ix86-gnu-linux.tar.gz9a053c6571741179af3022702a462f28 mit-scheme-20060201-ix86-win32.exe3d05bbec3844959fcec028adab780c4b mit-scheme-20060201-uco
Emory - BAHS - 501
DNA Structure/CompositionSeptember 4, 2003Flow of Genetic InformationRNA Transcription DNA Replication Protein TranslationDNA is the Genetic MaterialsDNA encodes all the information in the cell s The composition of the DNA is the same in al
USC - CSCI - 577
Life Cycle Plan (LCP)Data Mining of Digital Library Usage DataTeam 7 Hui-Hsien Chi FRD Shing-Cheung Chan OCD Maxim Krivokon SSRD Hsiao-Han Huang SSAD Fenny Muliawan LCP/Prototype Pei-Han Li - UMLOctober 11, 2004Life Cycle PlanVersion 1.
UMass (Amherst) - CMSTEX - 7749
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>9f144ccc9f23ad604c3c0ba6a9c8ceea81d1cd87.pdf%3Ffile %3Dab</Key><RequestId>A803F674AEE10FDF</RequestId><HostId>xThmquzcfv7qjGI
USC - CSCI - 577
This directory holds all the USC COCOMO files that were created for this project.
USC - CSCI - 577
Plan SummaryTeam Number: Week: Program Size (SLOC) Base Added Deleted Modified Reused # of COTS Total New SLOC Effort (Hours) Project Mgmt. Requirements COTS Assessment Design Life Cycle Planning Configuration Mgmt. Feasibility Analysis Code COTS Ta
UMass (Amherst) - CMSTEX - 6954
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>0a035b6daf30dadc6a094811c23168930ea81e34.pdf%3Ffile %3Dli</Key><RequestId>18B8BC653093C798</RequestId><HostId>GT0i994GOMror82
USC - CSCI - 577
Section 5: Risk AssessmentTable 1: Risk AssessmentRisks 1. OCR software-Client wants to convert scan file (script images) to text file. To complete this requirement, this system has to be integrated with the OCR software. 2. Budgets for Development
USC - CSCI - 577
Team #10FC PackageVersion 1.0Evaluation of System and Software Requirement Definition (SSRD) Summary: This is the first draft of SSRD. Per assignment, the evaluation is focused on Section 1, 2, 3, 4 and 5. SSRD is expected to be significantly i
USC - CSCI - 577
Evaluation Form for UML Model V3.0Management Overview - List any features of the solution described in this artifact that are particularly good, of which a nontechnical client should be aware of. This is a technical document that requires understand
UMass (Amherst) - CMSTEX - 0887
<?xml version="1.0" encoding="UTF-8"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>0e1c58dd2365196a89e01336b67cff204b4e7225.pdf%3Ffile %3Dlo</Key><RequestId>FDE6FCDFA36707D7</RequestId><HostId>K4vGzbtLILnn7Zi
Michigan State University - CH - 421
Sheet1 8903100.6 8903201.8 8903302.9 8903404 8903505 8903606.1 8903707.9 89038010.1 89039010.9 890310012.7 890311014.4 890312016.6 890313018.1 890314019.9 890315021 890316023.4 890317024.7 890318027.8 8905100.3 8905200.6 8905301 8905401.3 8905503.2 8
Michigan State University - CH - 421
Sheet1 MouseMaterialGPI 1ECM1155 2ECM1170 3ECM1170 4ECM2260 5ECM2265 6ECM2265 7ECM3375 8ECM3370 9ECM3375 10MAT1420 11MAT1425 12MAT1425 13MAT255 14MAT2510 15MAT255 16MAT3610 17MAT3615 18MAT3610Page 1
Penn State - WRA - 5001
5-02-2009<br />2:02:46 amIf any of you who have posted here recently see Bill Austin. Please relay thew message that he needs to call his parents immediately. Thanks&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;- Poste
Michigan State University - PRR - 485
PRR 485 In Class Exercise #12 September 9, 2002 In this exercise, you are presented with a reference or other information you need to find. You will formulate a short research approach / strategy, present that strategy and have several minutes to try
Michigan State University - CHAPTER - 101
Human DevelopmentFundamental Issues in Developmental Psychology1Developmental Psychology Basic question: What shapes the way we change over time? Focus on psychological changes across the entire life span Every area of psychology can be looke
Michigan State University - SS - 011797
Art/Cultural Grants1/17/97By LAURA A. POTTSCapital News ServiceLANSING - The Virginia McCune Arts Center may receive some financialassistance for expansion of its gallery and theater thanks to a few milliondollars left over from the 1996 sta
ECPI College of Technology - CIS - 121
CIS121 Logic and Design Course Schedule (Tentative)*Class Session 1Topic / DescriptionAssignments Chapter 1 exercises HW: Introduction to Course Chapter 1: An Overview of Computers and Logic Assign a Research Topic ex. 1315 (pg.
ECPI College of Technology - CIS - 201
Project 2: Maze GameDue: Maze Game ProjectCIS201 Game and Simulation FundamentalsProject Background: http:/www.yoyogames.com/make/tutorials (Creating Maze Games)Assignment: Develop a Maze Game (such as: Pac-Man) by following the tutorial on the
Michigan State University - RD - 415
Report Date: 30-Sept-2000Metadata Data Set Name: Pipelines Coverage, Eastern Lake Michigan Mapping Area 1 Identification Information 1.1 Citation: 8 Citation Information: 8.1 Originator:
Michigan State University - FS - 407
Combustion PretestChemistry is easier to understand if you can make connections between what you know now and the new ideas that you are studying. This is a test that will help us to understand what you know now. Please answer these questions as car
Michigan State University - SS - 310
ISS 310 Spring 2002 Prof. Alan Rudy EXAM #1 Tuesday, February 12 READ ALL THE ANSWERS BEFORE CHOOSING THE BEST ANSWER YOU FIND AMONG THE MULTIPLE CHOICES 1) William Cronon uses three kinds of data in his book Changes in the Land, why? a) To provide a
Cal Poly - INF - 6602
DEVOIR 3: Construction d'un model-checker de CTLDATE DE REMISE: 18 novembre 2003 En dpit du dfi technique que cela reprsentera pour certains, cedevoir consistera en la construction d'un model-checker de CTL. C'estla meilleure faon de compren
Michigan State University - CSE - 870
Advanced Software EngineeringCSE870, Spring 2003 Homework 3 Due: March 28, 2003In this assignment, you will learn how to use Design Patterns. You are to develop a program that implements the BECS system in Java. The development of the system will
Michigan State University - CSE - 870
Hypertext transfer family of protocols (HTTP, HTTPS, SOAP) CSE 870 Miniproject on FrameworksAdvanced Software Engineering Contact: Dr. B. Cheng, chengb at cse dot msu dot eduMatt Gerber Adithya KrishnamurthyAgenda Overview of Protocols Ov
University of Texas - SW - 318
SW318 Social Work Statistics Slide 1Frequency: Nominal Variable Practice ProblemThis question asks the frequency of widowed respondents of the survey. And, the variable of interest for this question is "marital status" [marital]. As a rem
Michigan State University - CSE - 870
Advanced Software EngineeringCSE870, Spring 2003Homework 4 /Mini Project Due: April 25th, 2003The purpose of this assignment is to give you hands-on experience with Frameworks. For this assignment, you are to develop a framework for an e-commerce
Cal Poly - INF - 1040
Ingnierie: questions d'thiqueINF1040: introduction au gnie informatique Dpartement de gnie informatique et gnie logicielsurvol de la prsentation quelques cas d'thique dans la vie de tous les jours une classification des problmes thiques q
Cardinal Stritch - CLASS - 516
/* SwitchDemo1.java A switch Demo/Quiz or possible question for a final. John Sklar - CEd 516 - Fall, 2007 */ import java.awt.*; import java.awt.event.*; import javax.swing.*; public class SwitchDemo1 extends JFrame {
Michigan State University - ECE - 482
Fuzzy Logic Appliance Management with Embedded SystemsDesign Team 1 Home AppliancesOral Presentation 3Progress Report March 2, 1999Team MemberssKeith Luis ManagementsDan Mellinger Design IntegrationsPaul Saxman Web Coordinat
University of Texas - ASE - 167
Computer Assignment 3Numerical Integration of the Equations of Motion for Gliding FlightGregory R. Whitney David HughlingTA: Eduardo GildinNovember 5, 2001University of Texas at Austin ASE 167MTable of ContentsPROGRAM IDENTIFICATION..1 P
Lycoming - M - 400
123456789
Michigan State University - ECE - 480
Autonomous Robotic Fish to detect Harmful Algae Blooms (HABS)PREPROPOSAL: Design Team:4 Team Facilitator: Dean Aslam Team members: Taha Tareen, Jamie Jacobs, Stephen Garrett, Woodard Williams Eric Jackson, Carl Coppola, Robert Morris, Allen Eyler Da
Catholic - ARCH - 402
Navigate CUA Dean's MessageAbout The School Academic Programs Student Work Faculty and Staff Study Abroad Programs Summer Institute for Architecture Experiences in ArchitectureDesign Collaborative (CUAdc)Resources Search this Websit
Michigan State University - ECE - 482
Model Rocket Trajectory Logger Pre-proposalSeptember 21, 2001Design Team #1 Facilitator: Ed Rothwell Shuantia Butler Keith Lennard Andrew Stolen David Warren Kris Kimball Grace Ott Scott TownsendExecutive StatementThe purpose of this project is
Catholic - ARCH - 402
Navigate CUA Dean's MessageAbout The School Academic Programs Student Work Faculty and Staff Study Abroad Programs Summer Institute for Architecture Experiences in ArchitectureDesign Collaborative (CUAdc)Resources Search this Websit
Catholic - ARCH - 136
Navigate CUA Dean's MessageAbout The School Academic Programs Student Work Faculty and Staff Study Abroad Programs Summer Institute for Architecture Experiences in ArchitectureDesign Collaborative (CUAdc)Resources Search this Websit
Catholic - ARCH - 402
Navigate CUA Dean's MessageAbout The School Academic Programs Student Work Faculty and Staff Study Abroad Programs Summer Institute for Architecture Experiences in ArchitectureDesign Collaborative (CUAdc)Resources Search this Websit
Michigan State University - ECE - 482
User Interface: Our goal is to create an intuitive GUI to make monitoring and control of the PPB system user friendly. It will be accessible for any authorized user with access to our web server through a wide-area communication network. Optional Sof
Catholic - ISMA - 500
Principles of Information Systems, Ninth EditionChapter 8 Electronic and Mobile CommerceAn Introduction to Electronic Commerce Electronic commerce Conducting business activities electronically over computer networks Business activities that ar
BYU - ET - 335
Chapter 12Drilling Rock and EarthCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.DRILLING ROCK & EARTHDRILLING ROCKWhen work on the Hoosac Tunnel first began in the 1850's hand drills were still the
BYU - ET - 217
Masonry Chapter 1Benefits Many color options Very durable Easy to clean Many applications Many sizes and shapes available Flexibility of designTwo Main Types Brick Made of clay Fired Block Made of concrete CuredModern Brick5 Maj
BYU - ET - 335
SOIL OR ROCK MAXIMUM ALLOWABLE TYPE SLOPES (H:V) FOR EXCAVATIONS < 20' DEEP STABLE ROCK TYPE A 1 TYPE B TYPE C VERTICAL 3/4:1 1:1 1 :1 (90) (53) (45) (34)Footnote1 A short-term maximum allowable slope of 1/2H:1V (63) is allowed in excavations in Ty
Michigan State University - TSM - 493
Final Internship Evaluation Form (to be completed by supervisor at completion)INSTRUCTIONS: Students are responsible for providing this form to their supervisor. Supervisors should complete this final evaluation which provides feedback to the intern