3 Pages

Zoology Course Proposal - Original

Course Number: BPD 137, Fall 2009

College/University: Penn State

Word Count: 410

Rating:

Document Preview

University of Pittsburgh Department of Biological Sciences Zoology (BIOSC 240) I. Introductory Information Department: Departmental Catalogue Number: Course Title: Semester Hours of Credit: Restriction Upon Student Registration: Biological Sciences BIOSC 240 Zoology 3 Prerequisite: Biology II (BIOSC 160) or permission of the instructor. Description of the Course This course will investigate and examine the animal...

Unformatted Document Excerpt
Coursehero >> Pennsylvania >> Penn State >> BPD 137

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

of University Pittsburgh Department of Biological Sciences Zoology (BIOSC 240) I. Introductory Information Department: Departmental Catalogue Number: Course Title: Semester Hours of Credit: Restriction Upon Student Registration: Biological Sciences BIOSC 240 Zoology 3 Prerequisite: Biology II (BIOSC 160) or pe...

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Penn State - IB - 303
Benjamin Davidson 5/4/09 IB 303Pages 39 and 84 in Global Business Today, Sixth Edition Page 39 1. The reason the manufacturing of flat-panel TVs is migrating to other, foreign, countries is because the cost of production is lower in these countries
Washington - OCEAN - 539
>mystery gene 1ATGACTTCTTTCGCAACTAATATCATTTTCAAAGAAAAGATTAACCAAGAAACAAACATAGAAATTGATCACATTCATTTATATGTAAAAGATACAGTTTACTGGACAGAATGGTTTATTAATGTCATGGGTTTTTGCTCCATTGCTGGTGGAAGTAATGAGCATACAAAGACAGAAATTGTCAAAACAGGAGATGAGGAAAACCCGATTATTTTTGTTATTTCTTCTCCTC
Washington - OCEAN - 539
>mystery gene 2ATGAAAGCTGTTGCATATGCAAGATTTTCTTCAGACAACCAGCGGGAAGAAAGCATTACCGCCCAACTTCGCGCCATTCATGATTATGCCGAAAAGAATGGGGTTATTATCGTCCGGGAGTACGTAGACGAAGCTCGATCAGCCACCACCGACGACCGCCCCGAATTCTTACGCATGATTGAGGAAGTGACCTCCGGCTGTCTTCAGGTAGACTATGTTTACGTCCATAAAC
Penn State - BSA - 140
Penn State - BJS - 372
BRADLEY J. SHIVELY JR.(724) 513 8070bradley.shively@psu.edu http:/www.personal.psu.edu/bjs372Campus Address 202 Packer Hall University Park, PA 16802OBJECTIVE: EDUCATION:Permanent Address 1322 9th Street Extension Freedom, PA 15042To obtain
Penn State - BJS - 372
BRADLEY J. SHIVELY JR.(724) 513 8070bradley.shively@psu.edu http:/www.personal.psu.edu/bjs372Campus Address 202 Packer Hall University Park, PA 16802OBJECTIVE:Permanent Address 1322 9th Street Extension Freedom, PA 15042To obtain an internsh
Penn State - BJJ - 5020
Mike Giannelli Mike Kaiserian Samantha Thompson Dan Coughlin Bart Jozwiak As a group, we are well rounded in extraversion. We have people with low, medium, and high scores. Therefore we have some people who are very energetic, and there are also peop
Penn State - BJB - 5213
BR IAN BODNARCAMP US ADDRESS: PSU Mailbox 1434, 435 Ohio Hall 8479 4231 Station Road 3321 MacIntyre Drive Erie, Pennsylvania 16510Mu r rysville, PA 15668 Bjb5213@psu.eduH O M E: (412)-965-bribod10@aol.comOBJECT I VEAn internship position in
Penn State - BJO - 5011
Date SortBrandy Oswald OrderDate 8/4/1994 8/4/1994 8/4/1994 8/5/1994 8/5/1994 8/8/1994 8/8/1994 8/8/1994 8/8/1994 8/8/1994 8/8/1994 8/9/1994 8/9/1994 8/9/1994 8/10/1994 8/10/1994 8/10/1994 8/11/1994 8/11/1994 8/11/1994 8/12/1994 8/12/1994 8/12/1994
Penn State - BJO - 5011
By saying that "man is nothing else but what he makes of himself" Sartre is saying that we are born with nothing. We have no conscience, knowledge of right or wrong, and no sense of humanity when we are born. We are created from experiences. He meant
Penn State - BJO - 5011
www.tractors.com.by/mtw/srs1500.htmThe Modern Tractor circa 1990's- present This is a symbol of the hard working agricultural community of today. This encompasses all aspects of agriculture this is a very important part of American culture. These h
Penn State - BJW - 5096
Category SortOrderID OrderDate ProductID ProductName 10285 9/20/1994 1 Chai 10294 9/30/1994 1 Chai 10317 10/31/1994 1 Chai 10348 12/8/1994 1 Chai 10354 12/15/1994 1 Chai 10370 1/3/1995 1 Chai 10406 2/7/1995 1 Chai 10413 2/14/1995 1 Chai 10477 4/17/
Penn State - BJW - 5096
Data Fill Practice 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 5 Jan 10 Feb 15 Mar 20 Apr 25 May 30 Jun 35 Jul 40 Aug 45 Sep 50 Oct 55 Nov 60 Dec 65 Jan 70 Feb 75 Mar 80 Apr 85 May 90 Jun 95 Jul 100 Aug 1
Penn State - BJK - 5106
Bryan KukodaCivil EngineerPermanent Address 221 Cheshire Circle West Chester, PA 19380 610-692-7715 484-356-4960 Local Address 317 Packer Hall University Park, PA 16802 bjk5106@psu.eduEducation The Pennsylvania State University, University Park,
Penn State - BJS - 372
Shively 1 Bradley J. Shively Jr. Professor Gerry Santoro IST 110 09/28/2006 Anyone that has been to New York City knows just how extreme the epidemic of DVD piracy has grown in recent years. As vendors flock to consumers walking on the busy streets,
Penn State - BJS - 372
Bradley J. Shively 10/4/2006 Professor Santoro SRA 111Home Security Lab: Part 1 Hardware Profile and AnalysisSystem Specificationso o o o Processor AMD Athlon 64 3200+ 64bit processor Memory [2] 512MB Kingston HyperX DDR memory Power Supply 5
Penn State - BJS - 372
Bradley J. Shively 11/20/2006 Professor Santoro SRA 111Home Security Lab: Part 3 Disaster Recovery PlanA quick overview: All of this information was obtained by looking at the programs on my computer and exploring the "About" section under the He
Penn State - BJS - 372
Bradley J. Shively SRA 211 Dr. Bagby 3/25/2007 Slade v. Shearson Hammill
Penn State - BJC - 5046
Brian CoatesBJC PizzeriaThis week marks the start of several interesting, tasty new additions to our menu. Brian invites your down to BJC Pizzeria to experience these new flavors. Samples will be provided to everyone and, if you like what you tas
Penn State - BJW - 217
Aspen Industries Income Statement For the Years Ended December 31, 2004 and 2003 2004 2003 Sales 285,000 190,000 Cost of Goods Sold 215,000 143,000 Gross Profit 70,000 47,000 Operating Expenses Variable Expenses 28,500 19,000 Fixed Expenses 21,000 20
Penn State - BJW - 217
Aspen Industries Income Statement For the Years Ended December 31, 2004 and 2003 2004 2003 Sales 285,000 190,000 Cost of Goods Sold 215,000 143,000 Gross Profit 70,000 47,000 Operating Expenses Variable Expenses 28,500 19,000 Fixed Expenses 21,000 20
Penn State - BJW - 217
Meyerson's Bakery Income Statement For the Year Ended December 31, 2006 2006 Sales $25,000 Less: Variable Costs 7,500 Less: Fixed Costs 20,000 Earnings Before Interest and Taxes (2,500) Less: Interest Expense 3,000 Earnings Before Taxes (5,500) Taxes
Penn State - BJW - 217
Bethany Walker 401K Retirement Plan Options Money Market Fund Compounding Period Annual Quarterly Monthly Bi-weekly Weekly Long-term Bond Fund Compounding Period Annual Quarterly Monthly Bi-weekly Weekly Interest Rate 8% 8% 8% 8% 8% Periods/Year 1 4
Penn State - BJW - 217
Bethany Walker, Investor Confer Coal Company Bonds Face Value $1,000.00 Current Price $872.00 Coupon Rate 9.50% Required Return 11.00% Redemption Value $100.00 Call Price $104.00 Payments per Year 2 Years to Maturity 8 Settlement Date 12/1/2006 Matur
Penn State - BJW - 217
TRM Consulting Services Capital Structure & Weighted Values Source Common Stock Preferred Stock Debt Market Price $41.50 $125.00 $945.00 $1,111.50 Book Price $17.50 $100.00 $1,000.00 $1,117.50 Units 240,000 2,500 3,100 245,600 Total BV Percentage Tot
Penn State - BJW - 217
Exhibit 1Operating Expenses for Years Ending December 31, 2003-2005, and for First Quarter 2006 (thou2003 2004 $9,388 910 7,368 $8,278 1,166 $7,112 2,276 1,936 $340 113 $227 43 $184 2005 $12,201 1,166 9,663 $10,829 1,585 $9,244 2,957 2,538 $418 15
Penn State - BJW - 217
Organizational Analysis: Centre Volunteers in Medicine (CVIM)Brought to you by: Triple "B" Bill Castor Bethany Walker Bowser JuanitaOrganizational Background Nonprofit corporation Provides services to the medically underserved population of Ce
Western Michigan - SLCSP - 101
Citation: Cobern, W. W. (1995). Worldview Reality as Viewed by Students: Additional Methodologies, SLCSP Working Paper No. 101z. Scientific Literacy and Cultural Studies Project: Kalamazoo, MI. This document contains additional research strategies f
Western Michigan - SLCSP - 127
JOURNAL OF RESEARCH IN SCIENCE TEACHINGVOL. 36, NO. 5, PP. 541564 (1999)Conceptualizations of Nature: An Interpretive Study of 16 Ninth Graders' Everyday ThinkingWilliam W. Cobern,1 Adrienne T. Gibson,2 Scott A. Underwood21Departmentof Teachi
Western Michigan - SLCSP - 151
Culturally Important Issues and Science: A Gender and Science-Interest InvestigationPaper presented at the 2002 annual meeting of the National Association for Research in Science Teaching, New Orleans, LA.One gender effect and an interest effect
Penn State - BJN - 5049
Introduction The objective of the driver-assist program is to decrease casualties caused by car collisions. Some systems already exist that reduce casualties after a collision, but this can only go so far eventually the root of the problem has to be
Penn State - BJN - 5049
Identifying NeedsNeeds Survey The design team created a survey to be answered by previously deployed military personnel because of their experience in the eld. To accomplish this a team brainstorming session was held to gather questions to be answe
Penn State - BJN - 5049
System Specifications Once the survey and the physics analysis was complete the next step was to collect all of the needs for the final product. This was done by considering how the product would be used and what the requirements for use would be. O
Penn State - BJN - 5049
Concept Generation The rst process that needed to be completed in the concept generation phase was a decomposition of the overall system into smaller problems. The design team decomposed the system into four sub-categories: sensor hardware, convoy h
Penn State - BJN - 5049
Concept Selection Now that a master concept list was in place a means of eliminating less promising concepts was needed. This was the purpose of the concept selection process. This process is necessary because it is unreasonable and inefficient to d
Penn State - BJN - 5049
Final Concept DesignComputer Aided Drafting (CAD) A visual model of the final concept was made using a CAD program called solidworks. This process was very helpful because it allowed the group to clearly see how the final project would look. This a
Penn State - BJN - 5049
Cost Analysis An analysis of the cost to eld the driver-assist program was completed using estimations of the key components to the cost of the system. These key components are material costs and labor cost for instillation and calibration. To calcu
Penn State - BJN - 5049
Prototype A scale model was made of one humvee with all of the additional components from the driver-assist program was made of cardboard. This portion of the project was completed mostly to help the group further visualize the final concept but als
Penn State - BJN - 5049
Overall Conclusions Looking back on the whole project some helpful conclusions can be made. The group decided that if the project were to start over a better physics analysis would be done in order to establish more realistic metrics for the project
Penn State - BJN - 5049
Final Design ConceptLidar Sensor SuiteTeam 8BAE Systems Driver-Assist Program Team 8Members: Ehric Haggard, Brandon Newpher, Hamilton Gubanc, and Dan ClauseHUD Laser ProjectorFor Additional Information Contact C.H.N.G. Engineering email: b
Penn State - BJO - 5031
Bobbie Jo O'ConnorObjectiveI am seeking a position with a technology advancing organization to utilize my skills obtained through formal education in addition to life and work experiences.Experience2003 - PresentPaint Shop QC InspectorSprings
Penn State - BJO - 5031
Introduction to Project Management Discussion Topic The triple (or quadruple) constraint is one of the most important concepts in project management. Do you feel that one of these constraints is always more important than the others? If you were
Penn State - BJO - 5031
NetworksandSecurityDiscussionTopicWhataretheprivacyimplicationsinregardstobiometricsecuritydevices,face recognition,voicerecognition,andmatchingdatabases,whichcomparebiologicaldatato actualpeople?Dothebenefitsoutweightheindividualprivacyissues?Re
Penn State - BJO - 5031
ePortfolio Discussion Topic Describe a piece of evidence you would include in an ePortfolio. Describe why this piece of evidence would illustrate the quality of your work and assist in acquiring a job or internship. Response I would choose a c
Virginia Tech - HORT - 6004
_ Name_TheVirginia Gardenerhttp:/www.hort.vt.edu/envirohortFun with Plants: Create a Plant Draw a large plant on poster board (18-24 inches tall). Your plant should include a flower, leaves, stems, roots, seeds, and some fruit. Collect s
Virginia Tech - HORT - 6004
_ Name_TheVirginia Gardenerhttp:/www.hort.vt.edu/envirohortHerb Gardening: Herb AcrosticFill in the blank beside each letter with words to make a sentence.Example: H arry E ats R eal B asilYour Turn: H__ E_ R_ B_Sage Now try these he
Penn State - WEN - 104
Construction Management BreadthIntroduction For my first breadth study, I wanted to elaborate more on the idea of energy saving lamps and how much could be saved if a construction management cost analysis was done. After designing my lighting system
Penn State - WEN - 104
Depth Executive Summary The depth and breadth proposals summarize the areas of the Hawthorn Building that I will be focusing on in the spring semester. The unique uses for some of the rooms as well as the multipurpose uses in others create some chall
Penn State - WEN - 104
Breadth Executive Summary Other areas of architectural engineering that I want to explore include an acoustical redesign of the music room, as well as a cost comparison between economic fixtures and lamps vs. the existing fixtures and lamps. Due to t
Penn State - WEN - 104
Executive SummaryThe depth and breadth proposals summarize the areas of the Hawthorn Building that I will be focusing on in the spring semester. The unique uses for some of the rooms as well as the multipurpose uses in others create some challenges
Penn State - WEN - 104
Sandra Doesn't need to know that there are blue plastic chairs in the space.excessive info, ceiling heights are good and such, wants to know more about thinking, not necessarily colors and little details Reading too much information Careful showing a
Penn State - WEN - 104
HawthornBuildingPennStateAltoonaCampus Altoona,PAWalterNicholsLighting/ElectricalOption FacultyAdvisor:Dr.RichardMistrickBuildingOverview 58,800sq.ft. 2Storiesabovegrade Steelframewithcurtain wallconstruction Replacedtheoldcomputer labbuild
Penn State - WEN - 104
Executive SummaryThe following report analyzes the existing electrical distribution system in the Hawthorn Building, as well as evaluating the electrical consumption calculations according the NEC 2002 edition building loads. Existing documents incl
Penn State - WEN - 104
Penn State - WEN - 104
Walter E. Nichols IIICurrent Address: 747 E. Beaver Ave. Apartment #3-314 State College, PA 16801 (814) 777-2837 Objective Educationwen104@psu.eduhttp:/www.arche.psu.edu/thesis/eportfolio/current/portfolios/wen104/Home Address: 229 Bedford Stre
Penn State - WEN - 104
Executive SummaryThis report is an analysis of the existing lighting conditions for the Computer Labs, Pechter Family Music Room, Lecture Hall/Video Conferencing Room, and Main Corridor of the Hawthorn Building at Penn State Altoona's campus. I star
Penn State - WEN - 104
Walter Nichols AE 481 Lighting Proposal Memo Part ALarge Work Space: For my large work space, I want to use the main computer lab in the 2nd floor of the building, as well as the computer lab classrooms attached to the sides of the main lab. The ma
Penn State - WEN - 104
Executive SummaryThis report is an analysis of the existing lighting conditions for the Computer Labs, Pechter Family Music Room, Lecture Hall/Video Conferencing Room, and Main Corridor of the Hawthorn Building at Penn State Altoona's campus. I star
Penn State - WEN - 104
Executive SummaryThe following report analyzes the existing electrical distribution system in the Hawthorn Building, as well as evaluating the electrical consumption calculations according the NEC 2002 edition building loads. Existing documents incl
Penn State - WEN - 104
Hawthorn BuildingPenn State Altoona Campus Altoona, PAWalter NicholsLighting/Electrical Option Faculty Advisor: Dr. Richard MistrickBuilding Overview 58,800 sq.ft. 2 Stories above grade Steel frame with curtain wall construction Replaced th
Penn State - WEN - 104
Hawthorn BuildingPenn State Altoona Campus Altoona, PAWalter NicholsLighting/Electrical Option Faculty Advisor: Dr. Richard MistrickThe Hawthorn BuildingBuilding Overview Location: Altoona, PA Owner: Penn State University Architect: W