Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more.
Course Hero has millions of course specific materials providing students with the best way to expand
their education.
Below is a small sample set of documents:
UVA - CS - 101
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGG
UVA - CS - 101
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGG
UVA - CS - 101
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGG
UVA - CS - 101
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGG
UVA - CS - 101
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGG
UVA - CS - 101
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGG
UVA - CS - 101
atattattattata
UVA - CS - 101
ATGATCAAGGCGACGGACAGAAAACTGGTAGTAGGACTGGAGATTGGTACCGCGAAGGTTGCCGCTTTAGTAGGGGAAGTTCTGCCCGACGGTATGGTCAATATCATTGGCGTGGGCAGCTGCCCGTCGCGTGGTATGGATAAAGGCGGGGTGAACGACCTCGAATCCGTGGTCAAGTGCGTACAACGCGCCATTGACCAGGCAGAATTGATGGCAGATTGTCAGATCTCTTCGGTATATCTGGCGCTTT
University of Hawaii - Hilo - X - 3872
%!PS-Adobe-2.0 %Creator: dvipsk 5.66a Copyright 1986-97 Radical Eye Software (www.radicaleye.com) %Title: gam-3pi-Jpsi_prl.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips -o
UVA - CS - 101
GGGAATCACGAGAGCAGACAGATCACACAGGTTTATGGGTTCTACGACGAGTGTTTAGGGAATCATGAGAGCAGACGATCACACAAGTTTATGGTTTCTATGATGAATGTTTA
RIT - P - 07009
2X 0.039 X 450.7110.492 0.003 .003 A B2X 0.010 X 45 BREAK SECTION A-A B 0.591 0.394 0.315 3/4-16 UNF THREAD0.197 0.138 0.059+0.002 0.750 0.000 AAA0.652 UNDERCUT FOR THREADS1.000UNLESS OTHERWISE SPECIFIED:DIMENSIONS ARE IN mm TOLE
UVA - CS - 101
atattatatattata
UVA - CS - 101
atattataatattat
UVA - CS - 101
CGTTAAATAGTATACGGACAGCGACTGCAAAGACGTATGTAGATTCGC
UVA - CS - 101
ATGAAGTGTATATTATTTAAATGGGTACTGTGCCTGTTACTGGGTTTTTCTTCGGTATCCTATTCCCGGGAGTTTACGATAGACTTTTCGACCCAACAAAGTTATGTCTCTTCGTTAAATAGTATACGGACAGAGATATCGACCCCTCTTGAACATATATCTCAGGGGACCACATCGGTGTCTGTTATTAACCACACCCCACCGGGCAGTTATTTTGCTGTGGATATACGAGGGCTTGATGTCTATCAGG
RIT - P - 07009
B .1 A 140 0.50 25.40 A19.05UNLESS OTHERWISE SPECIFIED:DIMENSIONS ARE IN mm TOLERANCES: FRACTIONAL .1 ANGULAR: MACH 1 BEND 1 .10 TWO PLACE DECIMAL THREE PLACE DECIMAL .005INTERPRET GEOMETRIC TOLERANCING PER: MATERIALNAME DRAWN CHECKED ENG APP
UVA - CS - 101
822e106.85e10 0 0 39e3 5e29 pluto.gif8.125e10 0 0 -31e3 5e29 pluto.gif11.875e10 0 0 -11e3 5e29 pluto.gif13.125e10 0 0 -81e3 5e29 pluto.gif-6.85e10 0 0 -39e3 5e29 pluto.gif-8.125e10 0 0 31e3 5e29 pluto.gif-11.875e10 0 0 11e3 5e29 pluto.gif-1
RIT - P - 07009
0.004 0.001 0.10 0.03 FROM TURNED SURFACESECTION B-B SCALE 1 : 1 BREAK ALL BURRS AND SHARP EDGESB 0.413 0.004 10.50 0.10 TURNED DIAMETER NOT TO EXCEED THIS DIMENSION 0.098 0.004 2.50 0.10 B6.102 0.010 155 0.250.118 0.002 3 0.050.472 12 AB
UVA - CS - 101
6012.5E110.0 0.0 0.0 0.0 5.0e30 sun.gif1.6666666666666667E9 0.0 0.0 -20000.0 2.0E10 pluto.gif-1.6666666666666667E9 0.0 0.0 20000.0 2.0E10 pluto.gif0.0 1.6666666666666667E9 20000.0 0.0 2.0E10 pluto.gif0.0 -1.6666666666666667E9 -20000.0 0.0 2.0E1
UVA - CS - 101
692.50e11 1.50e11 0.00e00 0.00e00 -2.29e04 7.45e19 pluto.gif-1.50e11 0.00e00 0.00e00 2.29e04 7.45e19 pluto.gif 0.00e00 -1.50e11 2.29e04 0.00e00 7.45e19 pluto.gif 0.00e00 1.50e11 -2.29e04 0.00e00 7.45e19 pluto.gif 1.48e11 0.00e00 0
UVA - CS - 101
292.50e110.000e00 0.000e00 0.000e00 0.000e00 1.989e30 sun.gif5.791e10 0.000e00 0.000e00 4.789e04 3.302e23 mercury.gif1.082e11 0.000e00 0.000e00 3.503e04 4.869e24 venus.gif1.496e11 0.000e00 0.000e00 2.978e04 5.974e24 earth.gif2.279e11 0.000e00 0
UVA - CS - 101
92.50e110.000e00 0.000e00 0.000e00 0.000e00 5.000e30 sun.gif2.000e11 0.000e00 0.000e00 2.000e04 5.000e23 mars.gif-2.000e11 0.000e00 0.000e00 -2.000e04 5.000e23 mars.gif0.000e00 2.000e11 2.000e04 0.000e00 5.000e23 earth.gif0.000e00 -2.000e11 -2.
UVA - CS - 101
66.00e120.000000000e00 0.000e00 0.000e00 0.000e00 1.989e30 sun.gif7.782920478e11 0.000e00 0.000e00 1.306e04 1.899e27 jupiter.gif1.429369806e12 0.000e00 0.000e00 9.638e03 5.685e26 saturn.gif2.874992823e12 0.000e00 0.000e00 6.808e03 8.683e25 uranu
UVA - CS - 101
8 3.00e11-0.900e11 0.000e00 0.000e00 -2.000e04 1.989e30 sun.gif 0.900e11 0.000e00 0.000e00 2.000e04 1.989e30 sun.gif-1.300e11 0.000e00 0.000e00 -8.000e04 5.974e23 earth.gif 1.300e11 0.000e00 0.000e00 8.000e04 5.974e23 earth.gif 0.000e00
UVA - CS - 101
62.50e110.000e00 0.000e00 0.000e00 0.000e00 2e32 sun.gif2e11 0.000e00 0.000e00 2.582e05 6e24 earth.gif-2e11 0.000e00 0.000e00 -2.582e05 6e24 earth.gif0e0 2e11 -2.582e05 0.000e00 6e24 earth.gif0e0 -2e11 2.582e05 0.000e00 6e24 earth.gif2.0001e11
UVA - CS - 101
43.00e11 0.000e00 1.1547e11 -3.6524e4 0.0000 3.300e30 sun.gif 1.000e11 -5.7735e10 1.8262e4 3.1631e4 3.300e30 mars.gif-1.000e11 -5.7735e10 1.8262e4 -3.1631e4 3.300e30 venus.gif-2.500e11 0.0000e00 0.000e00 6.000e04 3.302e20 mercury.g
CSU LA - FIN - 431
Hellohttps:/email.calstatela.edu/exchange/jrefalo@exchange.calstatela.edu/In.Hello Dr. Refalo, You may not remember me but I was a student of yours 2 years ago. I just wanted to say thank you because I realize that your class was one of the most
CSU LA - FIN - 431
A Forward Rate Based Approach to Teaching the Fundamental Futures Hedge: Conveying the Connection Between the Futures Price and the Forward RateJames F. RefaloCalifornia State University, Los AngelesOne of the challenges in teaching the basic fut
CSU LA - FIN - 431
Bernanke's Summary of the 2008 Financial Crisis at Morehouse College: Video: http:/video.google.com/videosearch? q=ben+bernanke+speech+at+morehouse+college&www_google_domain=www.google.c om&hl=en&emb=0# Transcript: http:/www.ritholtz.com/blog/2009/04
CSU LA - FIN - 431
International Finance Lecture 2 International Financial Markets and Institutions 1. Types of Markets a. FX Spot and Forward (FOREX) b. Money (Short term liabilities less than one year) c. Capital (Bonds, Equity, other long-lived assets) d. FX Futures
CSU LA - FIN - 431
Improv Class: As mentioned in class, I recommend the following improv workshop for anyone wishing to improve their presentation skills. It meets once a week for twelve weeks. It will help you learn to think on your feet, and make you more comfortable
CSU LA - FIN - 431
International Finance Homework/Exam Review Essay Questions: Answering these questions fully, using both the notes and book as a resource, will go a long way to develop the knowledge expected of you in this course, and prepare you for the exams. Feel
CSU LA - FIN - 431
International Finance Problems: 1 Exchange Rates: 1. Indicate whether the following quotations are in American or European Terms, indicate the currency the bank is offering buy/sell, and indicate how much the bank will make for each dollar ($) simult
CSU LA - FIN - 431
International Finance Problemset 3 Hedging & Transaction Exposure 1. Suppose that you will be paid 6,000,000 Pakistani Rupees (PR) in one year, but are concerned that Pakistan and Afghanistan will go to war. The revenues are certain. The current spot
CSU LA - FIN - 533
A Forward Rate Based Approach to Teaching the Fundamental Futures Hedge: Conveying the Connection Between the Futures Price and the Forward RateJames F. RefaloCalifornia State University, Los AngelesOne of the challenges in teaching the basic fut
CSU LA - FIN - 533
Bernanke's Summary of the 2008 Financial Crisis at Morehouse College: Video: http:/video.google.com/videosearch? q=ben+bernanke+speech+at+morehouse+college&www_google_domain=www.google.c om&hl=en&emb=0# Transcript: http:/www.ritholtz.com/blog/2009/04
CSU LA - FIN - 533
Improv Class: As mentioned in class, I recommend the following improv workshop for anyone wishing to improve their presentation skills. It meets once a week for twelve weeks. It will help you learn to think on your feet, and make you more comfortable
CSU LA - FIN - 533
International Finance Homework/Exam Review Essay Questions: Answering these questions fully, using both the notes and book as a resource, will go a long way to develop the knowledge expected of you in this course, and prepare you for the exams. Feel
CSU LA - FIN - 533
International Finance Presentation The presentation is a report on the business climate of a selected country or region (2-3 countries with common characteristics) and will analyze Economic, financial, legal, and political climate of a country Econo
CSU LA - FIN - 533
International Finance Problems: 2 Options: 1. Draw (separately) the Payoff and Profit/Loss diagrams for a Call and Put options on the Australian dollar with a strike of $.75, assuming premia of $.02 and $.025 respectively. Indicate the break-even poi
CSU LA - FIN - 533
International Finance Problemset 3 Hedging & Transaction Exposure 1. Suppose that you will be paid 6,000,000 Pakistani Rupees (PR) in one year, but are concerned that Pakistan and Afghanistan will go to war. The revenues are certain. The current spot
CSU LA - FIN - 533
International Finance Lecture 1 Course Overview Objectives: Understand Exchange Rate Regimes o Why we Trade, What an MNC is, and Trends in Economic Globalization o Benefits/Drawbacks to Monetary Union o Different Types of Exchange Rate Regimes o Dra
CSU LA - FIN - 533
International Finance Lecture 3 International Parity Conditions-PPP: 1. Law of One Price or "PPP" a. Assets must have the same price after currency translation b. Arbitrage Opportunities exist if this does not hold c. Assumes low (or no) transaction
CSU LA - FIN - 533
International Finance Lecture 4Futures and Options Markets: Statistical Data Futures and Options provide virtually unlimited trading volume potential o Contracts are written by investors, not issued like shares of stock or bonds o The value of the
CSU LA - FIN - 331
Bernanke's Summary of the 2008 Financial Crisis at Morehouse College: Video: http:/video.google.com/videosearch? q=ben+bernanke+speech+at+morehouse+college&www_google_domain=www.google.c om&hl=en&emb=0# Transcript: http:/www.ritholtz.com/blog/2009/04
CSU LA - FIN - 331
PV Problem Set 1. Assume a .05 (5%) time value of money. We have a debt to pay and are given a choice of paying $1,000 now or some amount X five years from now. What is the maximum amount that X can be for us to be willing to defer payment for 5 year
CSU LA - FIN - 331
1. Suppose that a share of IBM stock costs $100 today, the 1-year forward is $110 per share, and the 1-year risk free rate is 9% (assume that you can both borrow and lend at the risk-free rate). Is there a way to earn arbitrage (that is risk-free pro
CSU LA - FIN - 331
Government Bailout Plan Overview: http:/www.kfwb.com/-700B-Rescue-Plan-Finalized-House-to-Vote-Monday/3043388 Actual Legislation: http:/i.cdn.turner.com/cnn/2008/images/09/28/ayo08c04_xml.pdf Government Summary: http:/www.house.gov/apps/list/press/fi
CSU LA - FIN - 331
Improv Class: As mentioned in class, I recommend the following improv workshop for anyone wishing to improve their presentation skills. It meets once a week for twelve weeks. It will help you learn to think on your feet, and make you more comfortable
CSU LA - FIN - 331
Presentation Topics: Banking Crisis and Scandals BCCI Scandal, what happened, how, and why? (What could have prevented Scandal?) MGRM what happened, how, and why? (How could it have avoided its losses?) The impact of the Ruble Crisis, what was it,
CSU LA - FIN - 335
Fin 335 Project The purpose of this project is to force you contemplate your personal, professional, and financial goals, and to begin creating plans to obtain them. The project can be easy or hard, and fun or miserable. It will be easy if you know w
CSU LA - FIN - 335
California State University FIN 335: Personal Finance M 6:10-10:00PM Associate Professor: James F. Refalo Office Hours: M: 4:00-6:00PM, Simpson 611 Email: jrefalo@calstatela.edu, Website: http:/instructional1.calstatela.edu/jrefalo/ Course Descriptio
CSU LA - FIN - 335
Improv Class: As mentioned in class, I recommend the following improv workshop for anyone wishing to improve their presentation skills. It meets once a week for twelve weeks. It will help you learn to think on your feet, and make you more comfortable
CSU LA - FIN - 403
California State University FIN 403: Intermediate Business Finance MW 4:20-6:00PM Associate Professor: James F. Refalo Office Hours: TBA, Simpson 611 Email: jrefalo@calstatela.edu, Website: http:/instructional1.calstatela.edu/jrefalo/ Course Descript
CSU LA - FIN - 531
Bernanke's Summary of the 2008 Financial Crisis at Morehouse College: Video: http:/video.google.com/videosearch? q=ben+bernanke+speech+at+morehouse+college&www_google_domain=www.google.c om&hl=en&emb=0# Transcript: http:/www.ritholtz.com/blog/2009/04
CSU LA - FIN - 531
PV Problem Set 1. Assume a .05 (5%) time value of money. We have a debt to pay and are given a choice of paying $1,000 now or some amount X five years from now. What is the maximum amount that X can be for us to be willing to defer payment for 5 year