5 Pages

vzc2

Course: EAS 391, Fall 2009
School: Purdue North Central
Rating:
 
 
 
 
 

Word Count: 762

Document Preview

EAS391Chapter2 VanessaZimmer Photosynthesis Grade67 LessonExcerpt Photosynthesis is one of the most important natural processes that occur. It is also one of the hardest processes to understand. If you are not sure what exactly photosynthesis is do not be alarmed. Many people have an idea of what it is though they do not know what the process does specifically. In its most simple definition photosynthesis is the...

Register Now

Unformatted Document Excerpt

Coursehero >> Indiana >> Purdue North Central >> EAS 391

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
EAS391Chapter2 VanessaZimmer Photosynthesis Grade67 LessonExcerpt Photosynthesis is one of the most important natural processes that occur. It is also one of the hardest processes to understand. If you are not sure what exactly photosynthesis is do not be alarmed. Many people have an idea of what it is though they do not know what the process does specifically. In its most simple definition photosynthesis is the chemical process which changes chemicals and nutrients into food. This definition sums up the entire process nicely. However, the actual reaction that occurs is much harder to explain. Plants are not the only species that use photosynthesis. Algae and even various forms of bacteria use the process to convert chemical energy into food as well. Any species that uses photosynthesis to produce food is called a phototroph. The chemical energy is most often produced by sunlight. This is why sunlight is important to the survival of plant life. Water is also necessary for photosynthesis to occur. You probably already know that when you water a plant the water is absorbed through its roots. The water travels through the roots up long tubes that lead from the roots to other parts of the plant. These tubes are called xylem. As animals breathe in oxygen they release carbon dioxide into the air. The plants take in the carbon dioxide that has been exhaled. Essentially, they recycle the carbon dioxide, using it for the process of photosynthesis. A plant has tiny openings called stomata. Stomata are located in the leaves of the plant. Carbon dioxide is taken into the plant through these openings. Photosynthesis Grade Level: 6-7th Grade Science: Plant Structures and Processes Presented by: Linda Siebert, Lincoln Academy, Arvada, CO Juliann Epple, Cardinal Community Academy, Keenesburg, CO Length of Unit: Five Lessons-Lesson One may be divided into two forty minute classes or taught in a block I. ABSTRACT A. This unit introduces plant structures, processes of vascular plants, and photosynthesis as found in the Core Knowledge Sequence for 6-7th grade. II. OVERVIEW A. Concept Objectives 1. Understand the process of photosynthesis 2. Understand the structure of living systems. B. Content from the Core Knowledge Sequence 1. Nonvascular plants 2. Vascular plants 3. Photosynthesis is an important life process that occurs in plant cells, but not animal cells 4. Role in photosynthesis of: energy from sunlight, chlorophyll, carbon dioxide and water, xylem and phloem, stomata, oxygen, sugar (glucose) C. Skill Objectives 1. The student will ask questions and state predictions that can be addressed through scientific investigation. [Colorado State Standard 1.1] 2. The student will explore the process of photosynthesis. [CSS3] 3. The student will identify plant structures and functions. III. BACKGROUND KNOWLEDGE A. For Students 1. Students should understand the steps involved in the scientific procedure 2. Safe lab techniques and procedure 3. Basic scientific terminology IV. RESOURCES A. Wikipedia B. http://www.ckcolorado.org/units/5th_grade/5_photosynthesis.PDF V. Background Notes 1. Vascular plant systems a. responsible for conduction of water and dissolved nutrients b. examples: celery, carnation, daisy 2. Nonvascular plants a. do not have a conduction system b. dissolved nutrients move directly from cell to cell c. examples: algae, moss VI. Key Vocabulary 1. Vascular system: transports water and dissolved nutrients and offers support for the plant 2. Vascular plant: has a tube like that structure allows water and dissolved nutrients to move from roots to leaves, and food to move from leaves to the rest of the plant 3. Nonvascular plant: does not have a conduction system; dissolved nutrients move from cell to cell 4. Photosynthesis:istheconversionoflightenergyintochemicalenergybyliving organisms. PHOTOSYNTHESIS Write the equation for the chemical reaction called photosynthesis using symbols. CO2 + H2O light energy sugar + O Chlorophyll Write the equation for photosynthesis as a sentence. Carbon dioxide and water with light energy acting on chlorophyll yields sugar and oxygen. Draw the equation for photosynthesis using pictures. Color appropriately. Assessment Directions: Answer the following using the correct names and terms. 1. What did you learn about vascular plants that was demonstrated in Investigation # 1? _____________________________________________________________________________ _ _____________________________________________________________________________ _ _____________________________________________________________________________ _ _____________________________________________________________________________ _ _____________________________________________________________________________ _ 2. What did you learn about vascular plants that was demonstrated in Investigation #2? _____________________________________________________________________________ _ _____________________________________________________________________________ _ _____________________________________________________________________________ _ _____________________________________________________________________________ _ _____________________________________________________________________________ _ 3. What did you learn about the structure and functions of leaves in Investigation #3? _____________________________________________________________________________ _ _____________________________________________________________________________ _ _____________________________________________________________________________ _ _________________________________________________...

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Purdue North Central - EAS - 391
Vanessa Zimmer EAS 391Ch.3 Species Populations, Interactions, and Communities What is disturbance and how does it affect communities? How do invasive species effect the community it overtakes? Students will: 1. Make a list of humanmad disturbances an
Purdue North Central - EAS - 391
Vanessa Zimmer EAS 391Ch. 4 Human Populations What is the relationship between population growth and impact on the environment?Lesson #1 Population and Ecological Footprints Reduce, Reuse, RecycleLocal Groups Coffee Creek Save the Dunes Duneland
Purdue North Central - EAS - 391
VanessaZimmer EAS391Ch.6 Whatisawilderness? Whyarewildernessareasbothcontroversialandimportant?KeyConcepts:Wildernessanareaofundevelopedlandaffectedprimarilybytheforcesofnature;man isonlyavisitor;containingmanyfeaturesofhistoricorscientificvalue;p
Purdue North Central - EAS - 391
Megan Willford Critical Thinking and Discussion 1. Environmental safeguards for Genetically Modified Organisms (GMOs): Know clearly what genes you are splicing Test for results often Keep everything contained and labeled Human safety is key to ev
MIT - HST - 527
Lecture 9 PROTEOMIC APPROACHES GOALS 1. 3. 4. 5. Define the term proteomics Compare proteomic vs. genomic approaches Understand the unique advantages/disadvantages of proteomics as a tool to study endothelial cell biology Consider novel techniques to
MIT - HST - 527
ARTICLESSteps toward mapping the human vasculature by phage displayWADIH ARAP1,2, MIKHAIL G. KOLONIN1, MARTIN TREPEL1, JOHANNA LAHDENRANTA1, MARINA CARD-VILA1, RICARDO J. GIORDANO1, PAUL J. MINTZ1, PETER U. ARDELT1, VIRGINIA J. YAO1, CLAUDIA I. VI
MIT - HST - 527
Cell, Vol. 102, 915, July 7, 2000, Copyright 2000 by Cell PressBiomedical Discovery with DNA ArraysRichard A. Young* Whitehead Institute for Biomedical Research Nine Cambridge Center Cambridge, Massachusetts 02142 Department of Biology Massachuset
MIT - HST - 527
Identification of proangiogenic genes and pathways by high-throughput functional genomics: TBK1 and the IRF3 pathway Christian Korherr, Hendrik Gille, Rolf Schfer, Kerstin Koenig-Hoffmann, Johan Dixelius, Kristi A. Egland, Ira Pastan, and Ulrich Brin
MIT - HST - 527
ENDOTHELIUM IN SEPSIS AND MULTIPLE ORGAN DYSFUNCTION SYNDROME GOALS 1. 2. 3. 4. 5. 6. 7. Define infection, sepsis, severe sepsis, septic shock and multiple organ dysfunction Describe epidemiology of sepsis Identify the major pathophysiological mechan
MIT - HST - 527
Review articleThe role of the endothelium in severe sepsis and multiple organ dysfunction syndromeWilliam C. AirdSevere sepsis, defined as sepsis with acute organ dysfunction, is associated with high morbidity and mortality rates. The developmen
MIT - HST - 527
Thenew england journalofmedicinereview articlemedical progressThe Pathophysiology and Treatment of SepsisRichard S. Hotchkiss, M.D., and Irene E. Karl, Ph.D.From the Departments of Anesthesiology (R.S.H.), Medicine (R.S.H., I.E.K.), an
MIT - HST - 527
The New EnglandJournal of MedicineC o py r ig ht 2 0 0 1 by t he Ma s s ac h u s e t t s Me d ic a l S o c ie t y VOLUME 344M A R C H 8, 2001NUMB ER 10EFFICACY AND SAFETY OF RECOMBINANT HUMAN ACTIVATED PROTEIN C FOR SEVERE SEPSISGORDON R.
MIT - HST - 527
MIT - HST - 527
374ReviewTRENDS in Pharmacological Sciences Vol.23 No.8 August 2002EDHF: bringing the concepts togetherRudi Busse, Gillian Edwards, Michel Fltou, Ingrid Fleming, Paul M. Vanhoutte and Arthur H. WestonEndothelial cells synthesize and release v
MIT - HST - 527
insight progressVascular-specific growth factors and blood vessel formationGeorge D. Yancopoulos, Samuel Davis, Nicholas W. Gale, John S. Rudge, Stanley J. Wiegand & Jocelyn HolashRegeneron Pharmaceuticals, Inc., 777 Old Saw Mill River Road, Tarr
MIT - HST - 527
Endothelial Expression of a Mononuclear Leukocyte Adhesion Molecule During Atherogenesis Myron I. Cybulsky; Michael A. Gimbrone, Jr. Science, New Series, Vol. 251, No. 4995. (Feb. 15, 1991), pp. 788-791.Stable URL: http:/links.jstor.org/sici?sici=00
MIT - HST - 527
24 Dec 2005 16:0ARANRV262-ME57-01.texXMLPublishSM (2004/02/24) P1: KUV 10.1146/annurev.med.57.121304.131306Annu. Rev. Med. 2006. 57:118 doi: 10.1146/annurev.med.57.121304.131306 Copyright c 2006 by Annual Reviews. All rights reservedANGIOGE
MIT - HST - 527
HEMOSTASIS GOALS 1. 3. 4. 5. Define the terms hemostasis and coagulation Learn how to classify hemostasis and hypercoagulable states Explain systemic imbalance-local phenotype paradox Describe role for endothelium in mediating hemostasisREADING Req
MIT - HST - 527
Cell, Vol. 109, 693705, June 14, 2002, Copyright 2002 by Cell PressSensory Nerves Determine the Pattern of Arterial Differentiation and Blood Vessel Branching in the SkinYoh-suke Mukouyama,1,2 Donghun Shin,1 Stefan Britsch,3 Masahiko Taniguchi,4 a
MIT - HST - 527
Lecture 7 TRANSCRIPTIONAL REGULATION GOALS 1. 2. 3. 4. Understand principles of transcriptional regulation Explain the term lineage "master switch" Consider transcriptional regulation in context of input-output device Identify certain key transcripti
MIT - HST - 527
Endothelial Cell Gene RegulationTakashi Minami and William C. Aird*Endothelial cells (ECs) display phenotypic heterogeneity. Endothelial cell heterogeneity is mediated, at least in part, by site-specific and timedependent differences in gene trans
MIT - HST - 527
Transcriptional Regulation of Vascular Development Peter Oettgen Circ. Res. 2001;89;380-388 DOI: 10.1161/hh1701.095958Circulation Research is published by the American Heart Association. 7272 Greenville Avenue, Dallas, TX 72514 Copyright 2001 Ameri
MIT - HST - 527
Transcriptional Regulators of Angiogenesis Anne Hamik, Baiqiu Wang and Mukesh K. Jain Arterioscler. Thromb. Vasc. Biol. 2006;26;1936-1947; originally published online Jun 15, 2006; DOI: 10.1161/01.ATV.0000232542.42968.e3Arteriosclerosis, Thrombosis,
MIT - HST - 527
BRAIN ENDOTHELIUM GOALS . to answer the following questions 1. 2. 3. 4. What is the BBB? Where is the BBB? Why do we have a BBB? How is the BBB maintained?READING Required reading: Reese TS, Karnovsky MJ. Fine structural localization of a blood-bra
MIT - HST - 527
FINE STRUCTURAL LOCALIZATION OF A BLOOD-BRAIN BARRIER TO EXOGENOUS PEROXIDASET. S. REESE and MORRIS J. KARNOVSKY From the Departments of Anatomy and Pathology, Tlarvard Medical School, Boston, Massachusetts 0e115. D)r. Reese's present address is th
MIT - HST - 527
Lecture 3 DEVELOPMENTAL MECHANISMS AND MOLECULAR GENETICS OF THE VASCULATURE GOALS 1. 2. 3. 4. Describe the evolution of vascular structures and patterning among different organisms. Understand the embryonic origins of endothelial cells. Define the "
MIT - HST - 527
The Smoke Detector PrincipleNatural Selection and the Regulation of Defensive ResponsesRANDOLPH M. NESSE Department of Psychiatry, The University of Michigan, Ann Arbor, Michigan 48104, USAABSTRACT: Defenses, such as flight, cough, stress, and an
MIT - HST - 527
CopyrightAnnu. Rev. Physiol. 2000. 62:64971 by Annual Reviews. All rights reservedENDOTHELIAL SIGNAL INTEGRATION IN VASCULAR ASSEMBLYThomas O. Daniel1 and Dale Abrahamson2Center for Vascular Biology, Departments of Medicine and Cell Biology, Va
MIT - HST - 527
Lecture 8B BRAIN ENDOTHELIUM GOALS . to answer the following questions 1. 2. 3. 4. What is the BBB? Where is the BBB? Why do we have a BBB? How is the BBB maintained?READING Required reading: Reese TS, Karnovsky MJ. Fine structural localization of
MIT - HST - 527
Clonality and altered behavior of endothelial cells from hemangiomasEileen Boye,1 Ying Yu,2 Gretchen Paranya,2 John B. Mulliken,3 Bjorn R. Olsen,1 and Joyce Bischoff21DepartmentSee related Commentary, pages 665666.of Cell Biology, Harvard Medic
CSU Bakersfield - ECON - 410
Chapter 15Finance and Fiscal Policy for DevelopmentCopyright 2009 Pearson Addison-Wesley. All rights reserved.The Role of Financial System Providing payment services Matching savers and investors Generating/distributing information Allocati
Washington - CONJ - 538
Conjoint 538 Course reminders and requirements course website: courses.washington.edu/conj538 attendance: required all classes and Mini-Symposium Gene Pool: your draw will be the basis for a short oral presentation and paper (see Guidelines on we
Stetson - GPA - 770
CONTENU DU COURSB. CONCEPTS A. MISEEN CONTEXTE LOGICIELS (PROGRAMMATION EN ASSEMBLEUR ET EN C)C. CONCEPTS MATRIELS (COMPOSANTS D'UN MICROCONTRLEUR)INTRAFINALUniversit du Qubeccole de technologie suprieureGPA770: Microlectronique appliq
Stetson - GPA - 770
CONTENU DU COURSUniversit du Qubeccole de technologie suprieureGPA770: Microlectronique applique ric GrangerC.2-1Partie C - Concepts matrielsC.1 Configurations matrielles:architecture du systme, mmoire, et ports d'e/sC.2 Gestion d'excep
Stetson - GPA - 770
CONTENU DU COURSONCEPTS ISE EN CONTEXTE LOGICIELS PROGRAMMATION EN ASSEMBLEUR ET ENONCEPTS ATRIELS COMPOSANTS D UN MICROCONTRLEURINTRAFINALUniversit du Qubeccole de technologie suprieureGPA770: Microlectronique applique ric GrangerC.3
Stetson - GPA - 770
CONTENU DU COURSONCEPTS LOGICIELS PROGRAMMATION EN ASSEMBLEUR ET ENISE EN CONTEXTEONCEPTS ATRIELS COMPOSANTS D UN MICROCONTRLEURINTRAFINALUniversit du Qubeccole de technologie suprieureGPA770: Microlectronique applique ric GrangerC.4
Stetson - GPA - 770
Microlectronique applique GPA770Automne 2008Universit du Qubeccole de technologie suprieureGPA770: Microlectronique applique ric Granger1SommaireOrganisation du cours GPA770:1) Prsentation personnelle 2) Plan dtaill du cours 3) Organisat
Uni. Worcester - CS - 543
CS 543: Computer Graphics Lecture 4 (Part I): 3D Affine transforms Emmanuel AguIntroduction to TransformationsnIntroduce 3D affine transformation:n n n nPosition (translation) Size (scaling) Orientation (rotation) Shapes (shear)n n n nPre
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 1 (Part 4): 2D Graphic Systems Emmanuel Agu2D Graphics: Coordinate Systemsn n n n nScreen coordinate system World coordinate system World window Viewport Window to Viewport mappingScreen Coordinate System
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 2 (Part III): Points, Scalars and Vectors Emmanuel AguPoints, Scalars and VectorsnPoints, vectors defined relative to a coordinate systemVectorsn n n n nMagnitude Direction NO position Can be added, sc
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 3 (Part II): 3D Affine transforms Emmanuel AguIntroduction to TransformationsnIntroduce 3D affine transformation:n n n nPosition (translation) Size (scaling) Orientation (rotation) Shapes (shear)n n n
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 5 (Part I): Projection Emmanuel Agu3D Viewing and View VolumenRecall: 3D viewing set upProjection Transformationn n nView volume can have different shapes (different looks) Different types of projectio
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 5 (Part IV): Hidden Surface Removal Emmanuel AguHidden surface Removaln n n nDrawing polygonal faces on screen consumes CPU cycles We cannot see every surface in scene To save time, draw only surfaces we se
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 7 (Part III): Raytracing (Part II) Emmanuel AguWhere are we?Define the objects and light sources in the scene Set up the camera for(int r = 0; r < nRows; r+= blockSize){ for(int c = 0; c < nCols; c+= blockSiz
Uni. Worcester - CS - 543
CS 543: Computer Graphics Lecture 7 (Part II): Projection Emmanuel Agu3D Viewing and View VolumenRecall: 3D viewing set upProjection Transformationn n nView volume can have different shapes (different looks) Different types of projection: p
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 8 (Part II): Raytracing (Part 4) Emmanuel AguReflection and Transparencyn nRay tracing also handles reflections and refraction of light well We can easily render realistic scenes withn nmirrors, martini
Truman State - CS - 170
CS 170Introduction to Computer ScienceSpring 2009Instructor: John Neitzke Office 8:30 10:20 M W F Office: VH 2242 Hours: 12:30 1:20 M W F Phone: x4529 and by appointment E-Mail: jneitzke@truman.edu Web: http:/www2.truman.edu/~jneitzke Course
Colorado State - FW - 662
Sheet1 vti_encoding:SR|utf8-nl vti_backlinkinfo:VX|overview.htm vti_timelastmodified:TR|23 Jan 1999 14:06:38 -0700 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|gwhite vti_modifiedby:SR|gwhite vti_timecreated:TR|03 Feb 2001 13:49:35 -0000 vti_cache
Colorado State - FW - 662
Sheet1 vti_encoding:SR|utf8-nl vti_backlinkinfo:VX|overview.htm vti_timelastmodified:TR|23 Jan 1999 14:57:58 -0700 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|gwhite vti_modifiedby:SR|gwhite vti_timecreated:TR|23 Jan 1999 21:57:58 -0000 vti_cache
Colorado State - FW - 662
Sheet1 vti_encoding:SR|utf8-nl vti_backlinkinfo:VX|overview.htm vti_timelastmodified:TR|23 Jan 1999 14:36:24 -0700 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|gwhite vti_modifiedby:SR|gwhite vti_timecreated:TR|03 Feb 2001 13:47:46 -0000 vti_cache
Colorado State - FW - 662
Sheet1 vti_encoding:SR|utf8-nl vti_backlinkinfo:VX|overview.htm vti_timelastmodified:TR|23 Jan 1999 14:43:14 -0700 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|gwhite vti_modifiedby:SR|gwhite vti_timecreated:TR|03 Feb 2001 13:51:12 -0000 vti_cache
Colorado State - FW - 662
Sheet1 vti_encoding:SR|utf8-nl vti_backlinkinfo:VX|overview.htm vti_timelastmodified:TR|23 Jan 1999 14:53:16 -0700 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|gwhite vti_modifiedby:SR|gwhite vti_timecreated:TR|23 Jan 1999 21:53:16 -0000 vti_cache
IUPUI - CS - 506
Sample Task Tracking: Form TASKOwner ID: Leader Effort Units Hour Period Units Week Date: 9/16/2006Team ID: Part/Level:1 ProposalProject: Health Package Iterations: 1-3TASK Work Flow Strategy Documentation " Documentation Task Name Mngt. & M
IUPUI - CS - 506
The User's GuideThe Guide must be structured so that it begins with a Title followed by the name and identifier of the author and the date. The first paragraph must be a brief statement of the topic that the Guide is going to explain. It must also
IUPUI - CS - 506
6. DESIGN II: DETAILED DESIGNDevelop Architecture - see chapter 5 Identify corporate practices Plan project Analyze requirements Design ImplementSoftware Engineering Roadmap: Chapter 6 FocusPerform Detailed Design - apply design patterns- acco
IUPUI - CS - 506
10. MAINTENANCESoftware Engineering Roadmap: Chapter 10 FocusIdentify corporate practices Plan project Analyze requirements Design Implement Test unitsAdapted from Software Engineering: An Object-Oriented Perspective by Eric J. Braude (Wiley 2001
IUPUI - CS - 506
8. UNIT TESTINGSoftware Engineering Roadmap: Chapter 8 FocusIdentify corporate practices Plan project Analyze requirements Design Implement Test units Maintain Integrate & test systemTest units (parts) separately - use implementations- apply di
Maple Springs - ECON - 5310
Discussion Questions: Andreoni & Payne (AER 03) 1. There are important differences in government spending across countries. This also implies significant differences in the level of private provision of public goods. Based on the material discussed i
Maple Springs - ECON - 5310
Discussion Questions: Brlhart & Jametti (JPubE 2006) 1. 2. 3. 4. B & J use instruments for the endogenous cantonal taxes. Discuss the choice of instruments. Discuss the control variables included in the regression. Why are they necessary? Is anything
Virginia Tech - CSX - 984
cgcgcgctggcgcgagcgatctcagtatccttagccgtatcccgacttatacaccgatccgagagacttccgtttgaacatcttggtgcgacggcggtccatatcgccgtctagaggttattccctaactccacgcactagatggtttcaggtaaggcgagacgtactcgtcgaagggcagagtcgcaacagccggcatggaagcataggagagccttcggctctcagcttcgtaagtatcaccgttccg
Allan Hancock College - LING - 253
Feelings and attitudes Loaded LanguagePersuasion without argument Affective language Sometimes explicit; sometimes implicit2005-10-17LING253: Reasoning12005-10-17LING253: Reasoning2Kinds of opinionObviously subjective opinion Obv