11 Pages

699

Course: HST 527, Fall 2009
School: MIT
Rating:
 
 
 
 
 

Word Count: 8279

Document Preview

New The England Journal of Medicine C o py r ig ht 2 0 0 1 by t he Ma s s ac h u s e t t s Me d ic a l S o c ie t y VOLUME 344 M A R C H 8, 2001 NUMB ER 10 EFFICACY AND SAFETY OF RECOMBINANT HUMAN ACTIVATED PROTEIN C FOR SEVERE SEPSIS GORDON R. BERNARD, M.D., JEAN-LOUIS VINCENT, M.D., PH.D., PIERRE-FRANCOIS LATERRE, M.D., STEVEN P. LAROSA, M.D., JEAN-FRANCOIS DHAINAUT, M.D., PH.D., ANGEL LOPEZ-RODRIGUEZ,...

Register Now

Unformatted Document Excerpt

Coursehero >> Massachusetts >> MIT >> HST 527

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
New The England Journal of Medicine C o py r ig ht 2 0 0 1 by t he Ma s s ac h u s e t t s Me d ic a l S o c ie t y VOLUME 344 M A R C H 8, 2001 NUMB ER 10 EFFICACY AND SAFETY OF RECOMBINANT HUMAN ACTIVATED PROTEIN C FOR SEVERE SEPSIS GORDON R. BERNARD, M.D., JEAN-LOUIS VINCENT, M.D., PH.D., PIERRE-FRANCOIS LATERRE, M.D., STEVEN P. LAROSA, M.D., JEAN-FRANCOIS DHAINAUT, M.D., PH.D., ANGEL LOPEZ-RODRIGUEZ, M.D., JAY S. STEINGRUB, M.D., GARY E. GARBER, M.D., JEFFREY D. HELTERBRAND, PH.D., E. WESLEY ELY, M.D., M.P.H., AND CHARLES J. FISHER, JR., M.D., FOR THE RECOMBINANT HUMAN ACTIVATED PROTEIN C WORLDWIDE EVALUATION IN SEVERE SEPSIS (PROWESS) STUDY GROUP* ABSTRACT Background Drotrecogin alfa (activated), or recombinant human activated protein C, has antithrombotic, antiinflammatory, and profibrinolytic properties. In a previous study, drotrecogin alfa activated produced dose-dependent reductions in the levels of markers of coagulation and inflammation in patients with severe sepsis. In this phase 3 trial, we assessed whether treatment with drotrecogin alfa activated reduced the rate of death from any cause among patients with severe sepsis. Methods We conducted a randomized, double-blind, placebo-controlled, multicenter trial. Patients with systemic inflammation and organ failure due to acute infection were enrolled and assigned to receive an intravenous infusion of either placebo or drotrecogin alfa activated (24 g per kilogram of body weight per hour) for a total duration of 96 hours. The prospectively defined primary end point was death from any cause and was assessed 28 days after the start of the infusion. Patients were monitored for adverse events; changes in vital signs, laboratory variables, and the results of microbiologic cultures; and the development of neutralizing antibodies against activated protein C. Results A total of 1690 randomized patients were treated (840 in the placebo group and 850 in the drotrecogin alfa activated group). The mortality rate was 30.8 percent in the placebo group and 24.7 percent in the drotrecogin alfa activated group. On the basis of the prospectively defined primary analysis, treatment with drotrecogin alfa activated was associated with a reduction in the relative risk of death of 19.4 percent (95 percent confidence interval, 6.6 to 30.5) and an absolute reduction in the risk of death of 6.1 percent (P=0.005). The incidence of serious bleeding was higher in the drotrecogin alfa activated group than in the placebo group (3.5 percent vs. 2.0 percent, P=0.06). Conclusions Treatment with drotrecogin alfa activated significantly reduces mortality in patients with severe sepsis and may be associated with an increased risk of bleeding. (N Engl J Med 2001;344:699-709.) Copyright 2001 Massachusetts Medical Society. S EVERE sepsis, defined as sepsis associated with acute organ dysfunction, results from a generalized inflammatory and procoagulant response to an infection.1 The rate of death from severe sepsis ranges from 30 to 50 percent despite advances in critical care.2-5 In the United States, approximately 750,000 cases of sepsis occur each year, at least 225,000 of which are fatal.6 The inflammatory and procoagulant host responses to infection are closely related.7 Inflammatory cytokines, including tumor necrosis factor a, interleukin-1b, and interleukin-6, are capable of activating coagulation and inhibiting fibrinolysis, whereas the procoagulant thrombin is capable of stimulating multiple inflammatory pathways.7-11 The end result may be diffuse endovascular injury, multiorgan dysfunction, and death. Activated protein C, an endogenous protein that promotes fibrinolysis and inhibits thrombosis and inflammation, is an important modulator of the coagulation and inflammation associated with severe sepsis (Fig. 1).18 Activated protein C is converted from its inactive precursor, protein C, by thrombin coupled to thrombomodulin.18 The conversion of protein C From the Division of Allergy, Pulmonary and Critical Care Medicine, Vanderbilt University School of Medicine, Nashville (G.R.B., E.W.E.); the Department of Intensive Care, Erasme University Hospital, Brussels, Belgium (J.-L.V.); the Department of Critical Care and Emergency Medicine, Cliniques Universitaires St. Luc, Brussels, Belgium (P.-F.L.); Lilly Research Laboratories, Eli Lilly, Indianapolis (S.P.L., J.D.H., C.J.F.); the Department of Intensive Care, CochinPort Royal University Hospital, Paris V University, Paris (J.-F.D.); the Unidad de Cuidados Intensivos, Servicio de Medicina Intensiva, Hospital Infanta Cristina, Badajoz, Spain (A.L.-R.); the Critical Care Division, Baystate Medical Center, Springfield, Mass., and Tufts University School of Medicine, Boston (J.S.S.); and the Division of Infectious Diseases, University of Ottawa, Ottawa Hospital, Ottawa, Ont., Canada (G.E.G.). Address reprint requests to Dr. Bernard at the Division of Allergy, Pulmonary and Critical Care Medicine, Department of Medicine, T-1208 Medical Center North, Vanderbilt University School of Medicine, Nashville, TN 37232, or at gordon.bernard@mcmail.vanderbilt.edu. *Additional institutions and investigators participating in the study are listed in Appendix 3. N Engl J Med, Vol. 344, No. 10 March 8, 2001 www.nejm.org 699 Downloaded from www.nejm.org at HARVARD UNIVERSITY on April 23, 2007 . Copyright 2001 Massachusetts Medical Society. All rights reserved. The Ne w E n g l a nd Jo u r n a l o f Me d ic i ne Endothelium Coagulation cascade Tissue factor Activated protein C Monocyte Interleukin-6 Interleukin-1 Bacterial, viral, fungal, or parasitic infection or endotoxin Inhibition io n Factor VIIIa Ina c ti va t Activated protein C va io of a Factor Va Ina v c ti c ti at n tio I na n PAI-1 ti v c TNF-a Thrombin Preventio n a ti on Supression of fibrinolysis TAFI Activated protein C Neutrophil Inhibition Fibrin Tissue factor Interleukin-6 Interleukin-1 TNF-a Reduction of rolling Fibrin clot Activated protein C Inflammatory Response to Infection Thrombotic Response to Infection Fibrinolytic Response to Infection Figure 1. Proposed Actions of Activated Protein C in Modulating the Systemic Inflammatory, Procoagulant, and Fibrinolytic Host Responses to Infection. The inflammatory and procoagulant host responses to infection are intricately linked. Infectious agents and inflammatory cytokines such as tumor necrosis factor a (TNF-a) and interleukin-1 activate coagulation by stimulating the release of tissue factor from monocytes and the endothelium. The presentation of tissue factor leads to the formation of thrombin and a fibrin clot. Inflammatory cytokines and thrombin can both impair the endogenous fibrinolytic potential by stimulating the release of plasminogen-activator inhibitor 1 (PAI-1) from platelets and the endothelium. PAI-1 is a potent inhibitor of tissue plasminogen activator, the endogenous pathway for lysing a fibrin clot. In addition, the procoagulant thrombin is capable of stimulating multiple inflammatory pathways and further suppressing the endogenous fibrinolytic system by activating thrombin-activatable fibrinolysis inhibitor (TAFI). The conversion of protein C, by thrombin bound to thrombomodulin, to the serine protease activated protein C is impaired by the inflammatory response. Endothelial injury results in decreased thrombomodulin levels. The end result of the host response to infection may be the development of diffuse endovascular injury, microvascular thrombosis, organ ischemia, multiorgan dysfunction, and death. Activated protein C can intervene at multiple points during the systemic response to infection. It exerts an antithrombotic effect by inactivating factors Va and VIIIa, limiting the generation of thrombin. As a result of decreased thrombin levels, the inflammatory, procoagulant, and antifibrinolytic response induced by thrombin is reduced. In vitro data indicate that activated protein C exerts an antiinflammatory effect by inhibiting the production of inflammatory cytokines (TNF-a, interleukin-1, and interleukin-6) by monocytes and limiting the rolling of monocytes and neutrophils on injured endothelium by binding selectins. Activated protein C indirectly increases the fibrinolytic response by inhibiting PAI-1.12-17 700 N Engl J Med, Vol. 344, No. 10 March 8, 2001 www.nejm.org Downloaded from www.nejm.org at HARVARD UNIVERSITY on April 23, 2007 . Copyright 2001 Massachusetts Medical Society. All rights reserved. E F F ICACY AND SAF ET Y OF RECOMBINA NT H UMA N AC TIVATED PR OTEIN C FOR S EV ERE S EPS IS to activated protein C may be impaired during sepsis as a result of the down-regulation of thrombomodulin by inflammatory cytokines.19 Reduced levels of protein C are found in the majority of patients with sepsis and are associated with an increased risk of death.20-23 Previous preclinical and clinical studies showed that the administration of activated protein C may improve the outcome of severe sepsis. The administration of activated protein C was protective in a baboon model of lethal Escherichia coli sepsis.24 In a placebo-controlled phase 2 trial in patients with severe sepsis, an infusion of drotrecogin alfa (activated), or recombinant human activated protein C (Eli Lilly, Indianapolis), hereafter referred to as drotrecogin alfa activated, resulted in dose-dependent reductions in the plasma levels of D-dimer and serum levels of interleukin-6, markers of coagulopathy and inflammation, respectively.25 We therefore evaluated whether the administration of drotrecogin alfa activated would reduce the rate of death from all causes at 28 days in patients with severe sepsis and have an acceptable safety profile. METHODS Patients From July 1998 through June 2000, eligible patients were enrolled in this randomized, double-blind, placebo-controlled trial, which was conducted at 164 centers in 11 countries. The institutional review board at each center approved the protocol, and written informed consent was obtained from all participants or their authorized representatives. The clinical coordinating center (Vanderbilt Coordinating Center, Nashville) was available 24 hours a day throughout the study to answer investigators questions regarding patients eligibility and safety and the reporting of serious adverse events. Selection Criteria The criteria for severe sepsis were a modification of those defined by Bone et al. (Appendix 1).26 Patients were eligible for the trial if they had a known or suspected infection on the basis of clinical data at the time of screening and if they met the following criteria within a 24-hour period: three or more signs of systemic inflammation and the sepsis-induced dysfunction of at least one organ or system that lasted no longer than 24 hours. Patients had to begin treatment within 24 hours after they met the inclusion criteria. Exclusion criteria are summarized in Appendix 2. Treatment Assignments Patients were randomly assigned in a 1:1 manner to receive drotrecogin alfa activated or placebo (0.9 percent saline with or without 0.1 percent human serum albumin) at each center. Block randomization stratified according to site was used, and all assignments were made through a central randomization center. Drotrecogin alfa activated, at a dose of 24 g per kilogram of body weight per hour, or placebo was administered intravenously at a constant rate from foil-wrapped bags for a total duration of 96 hours. The patients, investigators, and the sponsor were unaware of the patients treatment assignments. Drotrecogin alfa activated was produced from an established mammalian cell line into which the complementary DNA for human protein C had been inserted. 27 The infusion was interrupted 1 hour before any percutaneous procedure or major surgery and was resumed 1 hour and 12 hours later, respectively, in the absence of bleeding complications. The study protocol did not call for a standardized approach to critical care (e.g., the use of antibiotics, fluids, vasopressors, or ventilatory support). Evaluation of Patients Patients were followed for 28 days after the start of the infusion or until death. Base-line characteristics including demographic information and information on preexisting conditions, organ function, markers of disease severity, infection, and hematologic and other laboratory tests were assessed within 24 hours before the infusion was begun. Blood samples obtained at base line, on days 1 through 7, and on days 14 and 28 were assayed for D-dimer levels (Liatest D-D1 latex agglutination test kit, Diagnostica Stago, Asnieres, France) and for interleukin-6 levels (Quantikine HS enzyme immunoassay kit, R & D Systems, Minneapolis). All measurements were performed by a central laboratory (Covance Central Lab Services, Indianapolis). Blood samples for the measurement of neutralizing antibodies against activated protein C were collected on days 14 and 28 or at the time of discharge from the hospital if it occurred before one or both of these dates. Microbiologic-culture results were assessed each day beginning 48 hours after the initiation of the infusion and continuing through day 28. Patients were defined as having a deficiency of protein C if their plasma protein C activity level was below the lower limit of normal (81 percent) within 24 hours before the initiation of the infusion and defined as having septic shock if they met the criteria for cardiovascular dysfunction at any time within 6 hours before the start of the infusion. Statistical Analysis The primary efficacy end point was death from any cause and was assessed 28 days after the initiation of the infusion. Our prospectively defined primary analysis included all patients who received the infusion for any length of time, with patients analyzed according to the treatment group to which they were assigned at randomization. The trial was designed to enroll 2280 patients; two planned interim analyses by an independent data and safety monitoring board occurred after 760 and 1520 patients had been enrolled. Statistical guidelines to suspend enrollment if drotrecogin alfa activated was found to be significantly more efficacious than placebo were determined a priori and used the OBrienFleming spending function according to the method of Lan and DeMets. 28 Data were analyzed according to a prospectively defined plan. The primary analysis was based on a CochranMantelHaenszel test in which the groups were stratified on the basis of three baseline covariates: severity of disease, as reflected by the score on the Acute Physiology and Chronic Health Evaluation II (APACHE II)29 (3 to 19, 20 to 24, 25 to 29, or 30 to 53, with higher scores indicating more severe disease); age (younger than 60 years or 60 years or older); and plasma protein C activity level (40 percent or less, 41 to 60 percent, 61 to 80 percent, 81 percent or more, or unknown). The corresponding relative risk and 95 percent confidence interval were calculated with use of the logit-adjusted method. The time from the start of the infusion to death was compared in the two groups in a similar manner with use of a stratified log-rank test. Results of both stratified and nonstratified analyses are reported. We evaluated the consistency of the effects of treatment on the risk of death in the subgroups by determining whether the relative risk and 95 percent confidence interval for each subgroup included the observed relative risk for the entire population. Changes from base-line levels of plasma D-dimer and serum interleukin-6 were analyzed in patients who had subsequent measurements with the use of analysis of variance of ranked data. For patients with missing data, we used the last-observation-carriedforward method of imputation. The proportion of patients who had serious adverse events and new infections was compared in the two groups with the use of Pearsons chi-square tests. All reported P values are two-sided. RESULTS At the time of the second interim analysis of data from 1520 patients, enrollment was suspended because the differences in the mortality rate between the two groups exceeded the a priori guideline for stopping N Engl J Med, Vol. 344, No. 10 March 8, 2001 www.nejm.org 701 Downloaded from www.nejm.org at HARVARD UNIVERSITY on April 23, 2007 . Copyright 2001 Massachusetts Medical Society. All rights reserved. The Ne w E n g l a nd Jo u r n a l o f Me d ic i ne the trial. Results presented here include data from additional patients who were enrolled before the completion of the second interim analysis. Base-Line Characteristics of the Patients Of 1728 patients who underwent randomization, 1690 received the study drug or placebo. Thirty-eight patients (17 in the placebo group and 21 in the drotrecogin alfa activated group) never received any study drug. In the drotrecogin alfa activated group, 14 patients met at least one exclusion criterion, 4 patients became moribund before the infusion could be started, and consent was withdrawn before the infusion in the case of 3 patients. In the placebo group, 15 patients did not meet the entry criteria for the study, and 2 patients became moribund before the infusion was begun. All randomized patients were followed for the en- TABLE 1. BASE-LINE CHARACTERISTICS OF THE PATIENTS.* DROTRECOGIN ALFA ACTIVATED GROUP (N=850) CHARACTERISTIC PLACEBO GROUP (N=840) Age (yr) Age (%) <60 yr <65 yr <75 yr Male sex (%) White race (%) Prior or preexisting conditions (%) Hypertension Myocardial infarction Congestive cardiomyopathy Diabetes Pancreatitis Liver disease COPD Cancer Recent trauma Recent surgical history (%) Elective surgery Emergency surgery No history of surgery APACHE II score Other indicators of disease severity (%) Mechanical ventilation Shock Use of any vasopressor Use of dobutamine No. of dysfunctional organs or systems (%) 0 1 2 3 4 5 Time from first organ dysfunction to start of drug infusion (hr) 60.616.5 43.6 53.5 78.5 58.0 82.0 35.0 14.4 9.0 22.4 3.9 2.6 26.1 18.8 5.1 6.2 21.2 72.6 25.07.8 77.6 71.7 75.5 13.5 0 24.2 32.5 26.0 13.8 3.6 17.49.1 60.517.2 44.1 51.4 75.9 56.1 81.8 38.2 12.1 6.4 20.7 3.4 2.1 22.2 17.1 3.3 5.8 20.7 73.5 24.67.6 73.3 70.4 71.8 13.9 0.1 25.3 31.8 25.2 14.0 3.6 17.512.8 tire 28-day study period except for one patient in the drotrecogin alfa activated group who did not receive the study drug. This patient was classified as having died on day 28 in the mortality analysis of all randomized patients. At base line, the demographic characteristics and severity of disease were similar in the placebo group and the drotrecogin alfa activated group (Table 1). Approximately 75 percent of the patients had at least two dysfunctional organs or systems at the time of enrollment. The lungs and the abdomen were the most common sites of infection, occurring in 53.6 percent and 19.9 percent of the patients, respectively, in the two groups combined (Table 2). The incidence of gram-positive and gram-negative infections was similar within each group and between the two groups. A blinded clinical evaluation committee determined that clinically appropriate antibiotic therapy that was based on the site of infection and available culture and susceptiblitily data was started within 48 hours of the diagnosis of severe sepsis and continued for at least five days or until death in 776 patients in the drotrecogin alfa activated group (91.3 percent) and in 766 patients in the placebo group (91.2 percent). Base-line levels of indicators of coagulopathy and inflammation were also similar in the two groups (Table 3). Protein C deficiency was present in 87.6 percent of the patients (1379 of 1574) for whom levels were obtained. In addition, plasma D-dimer and serum interleukin-6 levels were elevated in 99.7 and 98.5 percent of the patients, respectively. Among treated patients, 82.4 percent of those in the placebo group and 81.8 percent of those in the drotrecogin alfa activated group received at least 90 percent of the intended infusion and 8.2 percent and 6.4 percent, respectively, died during the 96-hour period of infusion. Efficacy *Plusminus values are means SD. COPD denotes chronic obstructive pulmonary disease, and APACHE II Acute Physiology and Chronic Health Evaluation II. Because of rounding, not all percentages total 100. Twenty-eight days after the start of the infusion, 259 of 840 patients in the placebo group (30.8 percent) and 210 of 850 (24.7 percent) of the patients in the drotrecogin alfa activated group had died. This difference in the rate of death from any cause was significant (P=0.005 in the nonstratified analysis) (Table 4) and was associated with an absolute reduction in the risk of death of 6.1 percent. The prospectively defined primary analysis in which the groups were stratified according to the base-line APACHE II score, age, and protein C activity produced similar results (P=0.005), as did the analysis that included the 38 patients who underwent randomization but who never received the infusion (P=0.003). The results of the prospectively defined primary analysis represent a reduction in the relative risk of death of 19.4 percent (95 percent confidence interval, 6.6 to 30.5) in association with treatment with drotrecogin alfa activated, as compared with placebo. A KaplanMeier analysis of survival yielded similar results (P=0.006) (Fig. 2). The absolute dif- 702 N Engl J Med, Vol. 344, No. 10 March 8, 2001 www.nejm.org Downloaded from www.nejm.org at HARVARD UNIVERSITY on April 23, 2007 . Copyright 2001 Massachusetts Medical Society. All rights reserved. E F F ICACY AND SAF ET Y OF RECOMBINA NT H UMA N AC TIVATED PR OTEIN C FOR S EV ERE S EPS IS TABLE 2. SITES AND CAUSES OF INFECTION IN WITH SEVERE SEPSIS. PATIENTS TABLE 3. BASE-LINE LEVELS OF INDICATORS AND INFLAMMATION.* OF COAGULATION VARIABLE PLACEBO GROUP (N=840) DROTRECOGIN ALFA ACTIVATED GROUP (N=850) VARIABLE PLACEBO GROUP DROTRECOGIN ALFA ACTIVATED GROUP percent Site of infection* Lung Abdomen Urinary tract Other Positive blood culture Results of Grams staining of bacterial pathogen Purely gram-negative Purely gram-positive Mixed Unconfirmed Culture negative or not obtained Type of organism Gram-positive Staphylococcus aureus Other staphylococcus species Streptococcus pneumoniae Other streptococcus species Enterococcus species Other gram-positive Gram-negative Escherichia coli Klebsiella species Pseudomonas species Enterobacter species Haemophilus influenzae Bacteroides species Other gram-negative Fungus Candida albicans Other candida species Yeast Other fungus 53.6 19.9 10.2 16.3 32.5 23.3 25.1 13.9 5.4 32.3 14.4 6.2 11.3 9.2 6.5 3.0 17.4 6.8 5.1 4.2 4.2 3.0 10.2 1.7 5.0 1.1 0.8 53.6 20.0 10.0 16.4 32.7 21.8 25.8 15.6 3.3 33.5 14.1 7.1 12.5 8.6 7.4 3.9 15.5 5.5 6.6 4.8 3.1 3.6 9.5 2.0 4.5 1.1 0.8 Plasma D-dimer No. of patients Median level (g/ml) Interquartile range (g/ml) Serum interleukin-6 No. of patients Median level (pg/ml) Interquartile range (pg/ml) Plasma protein C activity No. of patients Median level (%) Interquartile range (%) Protein C deficiency (% of patients) Yes No Unknown 758 4.15 2.188.65 808 484 1292540 775 50 3368 79.8 12.5 7.7 792 4.22 2.288.11 827 497 1532701 799 47 3063 83.4 10.6 6.0 *The normal range of D-dimer levels is 0.0 to 0.39 g per milliliter. The normal range of interleukin-6 levels is 0.38 to 10.09 pg per milliliter. The normal range of protein C activity is 81 percent to 173 percent. A deficiency of protein C was defined as an activity level of less than 81 percent. Levels of D -Dimer and Interleukin-6 *The site of infection was either documented or presumed on the basis of clinical findings. Other sites of infection included the blood, skin, central nervous system, bones and joints, cardiac system, and reproductive organs. Patients may have had more than one organism cultured. Plasma D-dimer levels were significantly lower in patients in the drotrecogin alfa activated group than in patients in the placebo group on days 1 through 7 after the start of the infusion (Fig. 3). Decreases in serum interleukin-6 levels were significantly greater in the patients in the drotrecogin alfa activated group than in the patients in the placebo group on day 1 (P=0.009) and on days 4, 5, 6, and 7 (P=0.025, P=0.017, P=0.016, and P=0.022, respectively). Complications ference in survival between the two groups was evident within days after the initiation of the infusion and continued to increase throughout the remainder of the study period. Prospectively defined subgroup analyses were performed for a number of base-line characteristics, including the APACHE II score, the number of dysfunctional organs or systems, other indicators of the severity of disease, sex, age, the site of infection, the type of infection (gram-positive, gram-negative, or mixed), and presence or absence of protein C deficiency. A consistent effect of treatment with drotrecogin alfa activated was observed among the subgroups (data not shown), including the subgroup with protein C deficiency and the subgroup with normal protein C levels. The percentage of patients who had at least one serious adverse event was similar in the two groups (Table 5). The incidence of serious bleeding was higher in the drotrecogin alfa activated group than in the placebo group (3.5 percent vs. 2.0 percent) (P=0.06). This difference in the incidence of serious bleeding was observed only during the infusion period; thereafter, the incidence was similar in the two groups. Among the patients who received drotrecogin alfa activated, the incidence of serious bleeding was similar for those who received drotrecogin alfa activated alone and those who also received heparin (3.7 percent and 3.5 percent). In both the drotrecogin alfa activated group and the placebo group, serious bleeding occurred primarily in patients with an identifiable predisposition to bleeding, such as gastrointestinal ulceration, an activated partial-thromboplastin time of more than 120 seconds, a prolonged prothrombin time (an international normalized ratio of more than 3.0), a platelet count that decreased to less than N Engl J Med, Vol. 344, No. 10 March 8, 2001 www.nejm.org 703 Downloaded from www.nejm.org at HARVARD UNIVERSITY on April 23, 2007 . Copyright 2001 Massachusetts Medical Society. All rights reserved. The Ne w E n g l a nd Jo u r n a l o f Me d ic i ne TABLE 4. ANALYSIS OF THE RATES AND RISKS OF DEATH FROM ANY CAUSE AT 28 DAYS.* VARIABLE PLACEBO GROUP DROTRECOGIN ALFA ACTIVATED GROUP P VALUE RELATIVE RISK OF DEATH (95% CI) ABSOLUTE REDUCTION IN RISK (95% CI) % no./total no. (%) Treated patients Nonstratified analysis Stratified analysis Protein C deficiency Yes No Unknown Randomized patients Nonstratified analysis 259/840 (30.8) 215/670 (32.1) 28/105 (26.7) 16/65 (24.6) 268/857 (31.3) 210/850 (24.7) 182/709 (25.7) 14/90 (15.6) 14/51 (27.5) 216/871 (24.8) 0.005 0.005 0.009 0.06 0.73 0.003 0.80 (0.69 to 0.94) 0.81 (0.70 to 0.93) 0.80 (0.68 to 0.95) 0.58 (0.33 to 1.04) 1.12 (0.60 to 2.07) 0.79 (0.68 to 0.92) 6.1 (1.9 to 10.4) 6.2 (1.6 to 10.8) 6.4 (1.6 to 11.2) 11.1 (0.4 to 22.6) 2.8 (19.0 to 13.4) 6.5 (2.2 to 10.7) *Patients were analyzed in the treatment group to which they were assigned at randomization. CI denotes confidence interval. Two-sided P values for the nonstratified and subgroup analyses are based on Pearsons chi-square tests, and the P value for the primary stratified analysis is based on the CochranMantelHaenszel test. The relative risk of death is calculated as the mortality rate in the drotrecogin alfa activated group divided by the mortality rate in the placebo group. For the stratified analysis, the absolute reduction in risk was estimated with use of the average of the absolute reduction in risk within strata. In the prospectively defined stratified analysis, the relative risk of death was calculated after an adjustment for the base-line APACHE II quartile, age, and protein C activity. This analysis included 38 patients who were randomly assigned to treatment but who never received the study drug. 100 90 Survival (%) Drotrecogin alfa activated 80 Placebo 70 60 0 0 7 14 P=0.006 21 28 Days after the Start of the Infusion NO. AT RISK Drotrecogin alfa activated Placebo 850 840 737 705 684 639 657 602 640 581 Figure 2. KaplanMeier Estimates of Survival among 850 Patients with Severe Sepsis in Drotrecogin the Alfa Activated Group and 840 Patients with Severe Sepsis in the Placebo Group. Treatment with drotrecogin alfa activated was associated with a significantly higher rate of survival (P=0.006 by the stratified log-rank test). 704 N Engl J Med, Vol. 344, No. 10 March 8, 2001 www.nejm.org Downloaded from www.nejm.org at HARVARD UNIVERSITY on April 23, 2007 . Copyright 2001 Massachusetts Medical Society. All rights reserved. E F F ICACY AND SAF ET Y OF RECOMBINA NT H UMA N AC TIVATED PR OTEIN C FOR S EV ERE S EPS IS 5.0 4.5 Plasma D-Dimer (mg/ml) Placebo 4.0 P<0.001 P=0.002 P<0.001 P=0.014 3.5 P<0.001 P<0.001 P<0.001 Drotrecogin alfa activated 3.0 2.5 0 1 2 3 4 5 6 7 Days after the Start of the Infusion Figure 3. Changes in Median Plasma D-Dimer Levels in 770 Patients with Severe Sepsis in the Drotrecogin Alfa Activated Group and 729 Patients in the Placebo Group. Only patients with base-line values and at least one subsequent value were included in the analysis. The P values are for the comparison with the placebo group. 30,000 per cubic millimeter and remained at that level despite standard therapy, traumatic injury of a blood vessel, or traumatic injury of a highly vascular organ. There was a fatal intracranial hemorrhage in two patients in the drotrecogin alfa activated group during the infusion (on day 1 and day 4) and in one patient in the placebo group six days after the end of the infusion. After adjustment for the duration of survival, blood-transfusion requirements were similar in the two groups (P=0.90). There were no other safety concerns associated with treatment with drotrecogin alfa activated on the basis of assessments of organ dysfunction, vital signs, serum chemical data, or hematologic data. The incidence of thrombotic events was similar in the two groups (Table 5). New infections occurred in 25.5 percent of the patients in the drotrecogin alfa activated group and 25.1 percent of the patients in the placebo group (P=0.85). Neutralizing antibodies against activated protein C were not detected in any patient. DISCUSSION TABLE 5. INCIDENCE OF SERIOUS ADVERSE EVENTS. DROTRECOGIN ALFA ACTIVATED GROUP (N=850) VARIABLE PLACEBO GROUP (N=840) P VALUE no. of patients (%) At least one serious adverse event Serious bleeding event* Gastrointestinal Intraabdominal Intrathoracic Retroperitoneal Intracranial Skin or soft tissue Genitourinary Source unidentified Thrombotic events 102 17 9 4 1 0 1 0 0 2 25 (12.1) (2.0) (1.1) (0.5) (0.1) (0.1) (0.2) (3.0) 106 30 9 3 6 4 2 2 2 2 17 (12.5) (3.5) (1.1) (0.4) (0.7) (0.5) (0.2) (0.2) (0.2) (0.2) (2.0) 0.84 0.06 0.20 *A serious bleeding event was defined as any intracranial hemorrhage, any life-threatening bleeding, any bleeding event classified as serious by the investigator, or any bleeding that required the administration of 3 units of packed red cells on two consecutive days. These patients received 3 units of packed red cells on two consecutive days but had no identifiable source of bleeding. In this study, the administration of drotrecogin alfa activated reduced the rate of death from any cause at 28 days in patients with a clinical diagnosis of severe sepsis, resulting in a 19.4 percent reduction in the relative risk of death and an absolute reduction of 6.1 percent. A survival benefit was evident throughout N Engl J Med, Vol. 344, No. 10 March 8, 2001 www.nejm.org 705 Downloaded from www.nejm.org at HARVARD UNIVERSITY on April 23, 2007 . Copyright 2001 Massachusetts Medical Society. All rights reserved. The Ne w E n g l a nd Jo u r n a l o f Me d ic i ne the 28-day study period, whether or not the groups were stratified according to the severity of disease. Our results indicate that in this population, 1 additional life would be saved for every 16 patients treated with drotrecogin alfa activated. Though the study population was heterogeneous with respect to clinical features, it was homogeneous with respect to the biochemical evidence of systemic inflammation and coagulopathy. In these patients, the benefit of drotrecogin alfa activated is most likely explained by the drugs biologic activity. Activated protein C inhibits the generation of thrombin by inactivating factor Va and factor VIIIa.30,31 As compared with the patients who received placebo, patients who received drotrecogin alfa activated had greater decreases in plasma D-dimer levels during the first seven days after the infusion was initiated, indicating a reduction in the generation of thrombin. The rise in D-dimer levels after the completion of the 96-hour infusion of drotrecogin alfa activated indicates incomplete resolution of the procoagulant state seen in patients with sepsis. An evaluation of longer periods of infusion of drotrecogin alfa activated may be warranted. Treatment with drotrecogin alfa activated decreased inflammation, as indicated by decreases in interleukin-6 levels, a finding consistent with the known antiinflammatory activity of activated protein C. The antiinflammatory activity of drotrecogin alfa activated may be mediated indirectly through the inhibition of the generation of thrombin, which leads to decreased activation of platelets, recruitment of neutrophils, and degranulation of mast cells.8 Furthermore, preclinical studies demonstrated that activated protein C has direct antiinflammatory properties, including the inhibition of neutrophil activation, the production of cytokines by lipopolysaccharide-challenged monocytes, and E-selectinmediated adhesion of cells to vascular endothelium.32-34 A consistent effect of treatment with drotrecogin alfa activated was seen among the subgroups examined, including those stratified according to age, APACHE II score, sex, number of dysfunctional organs or systems, type of infection (gram-positive, gram-negative, or mixed), site of infection, and presence or absence of protein C deficiency at study entry. Reductions in the relative risk of death were observed regardless of whether the patients had a deficiency of protein C at base line, suggesting that drotrecogin alfa activated has pharmacologic effects that go beyond simple physiologic replacement of activated protein C. This observation further suggests that measurements of protein C are not necessary to identify which patients would benefit from treatment with drotrecogin alfa activated. A consistent treatment effect was also observed regardless of the site of infection or the type of infection. It was consistent with the antithrombotic activity of drotrecogin alfa activated that bleeding was the most common adverse event associated with the administration of the drug. The incidence of serious bleeding suggests that 1 additional serious bleeding event would occur for every 66 patients treated with drotrecogin alfa activated. Serious bleeding tended to occur in patients with predisposing conditions, such as gastrointestinal ulceration, traumatic injury of a blood vessel or highly vascular organ injury, or markedly abnormal values for indicators of coagulation (e.g., the platelet count, the activated partial-thromboplastin time, and the prothrombin time). The incidence of thrombotic events was not increased by treatment with drotrecogin alfa activated, and the antiinflammatory effect was not associated with an increased incidence of new infections. Treatment with drotrecogin alfa activated was not associated with the development of neutralizing antibodies against activated protein C. In summary, the biologic activity of drotrecogin alfa activated was demonstrated by the finding of greater decreases in D-dimer and interleukin-6 levels in patients who received drotrecogin alfa activated than in those who received placebo. The higher incidence of serious bleeding during infusion in the drotrecogin alfa activated group is consistent with the antithrombotic activity of the drug and occurs predominantly in patients with a predisposition to bleeding. In patients with severe sepsis, an intravenous infusion of drotrecogin alfa activated at a dose of 24 g per kilogram per hour for 96 hours was associated with a significant reduction in mortality and a safety profile that was acceptable within the context of this clinical trial. Supported by Eli Lilly. Drs. LaRosa, Helterbrand, and Fisher are employees of Eli Lilly; Drs. Helterbrand and Fisher are stockholders; and Drs. Bernard, Garber, Dhainaut, Vincent, and Laterre have served as consultants to Eli Lilly. 706 N Engl J Med, Vol. 344, No. 10 March 8, 2001 www.nejm.org Downloaded from www.nejm.org at HARVARD UNIVERSITY on April 23, 2007 . Copyright 2001 Massachusetts Medical Society. All rights reserved. E F F ICACY AND SAF ET Y OF RECOMBINA NT H UMA N AC TIVATED PR OTEIN C FOR S EV ERE S EPS IS APPENDIX 1. SUMMARY INFECTION CRITERIA MODIFIED SIRS CRITERIA OF INCLUSION CRITERIA.* SYSTEMS CRITERIA FOR DYSFUNCTIONAL ORGANS OR Patients had to have a Patients had to meet at least one of the following five criteria: for cardiovascularPatients had to meet at least three of the known infection or a system dysfunction, the arterial systolic blood pressure had to be 90 mm Hg following four criteria: a core temperasuspected infection, as or the mean arterial pressure 70 mm Hg for at least 1 hour despite adequate ture of 38C (100.4F) or 36C evidenced by one or fluid resuscitation, adequate intravascular volume status or the use of vasopres(96.8F); a heart rate of 90 beats/min, more of the following: sors in an attempt to maintain a systolic blood pressure of 90 mm Hg or a except in patients with a medical condiwhite cells in a normally mean arterial pressure of 70 mm Hg; for kidney dysfunction, urine output tion known to increase the heart rate or sterile body fluid; perfohad to be <0.5 ml/kg of body weight/hr for 1 hour, despite adequate fluid those receiving treatment that would prerated viscus; radiographresuscitation; for respiratory-system dysfunction, the ratio of PaO2 to FiO2 had vent tachycardia; a respiratory rate of to be 250 in the presence of other dysfunctional organs or systems or 200 ic evidence of pneumo20 breaths/min or a PaCO2 of 32 mm Hg or the use of mechanical ventilaif the lung was the only dysfunctional organ; for hematologic dysfunction, the nia in association with tion for an acute respiratory process; a platelet count had to be <80,000/mm3 or to have decreased by 50 percent the production of puruin the 3 days preceding enrollment; in the case of unexplained metabolic aciwhite-cell count of 12,000/mm3 or lent sputum; a syndrome 4,000/mm3 or a differential count dosis, the pH had to be 7.30 or the base deficit had to be 5.0 mmol/liter associated with a high showing >10 percent immature neuin association with a plasma lactate level that was >1.5 times the upper limit risk of infection (e.g., trophils. of the normal value for the reporting laboratory. ascending cholangitis). *SIRS denotes systemic inflammatory response syndrome, PaCO2 partial pressure of arterial carbon dioxide, PaO2 partial pressure of arterial oxygen, and FiO2 fraction of inspired oxygen. The first sepsis-induced organ or system dysfunction had to develop within 24 hours before study enrollment. APPENDIX 2. SUMMARY OF EXCLUSION CRITERIA. Pregnancy or breast-feeding Age <18 yr or weight >135 kg Platelet count <30,000/mm3 Conditions that increased the risk of bleeding: surgery requiring general or spinal anesthesia within 12 hours before the infusion, the potential need for such surgery during the infusion, or evidence of active bleeding postoperatively; a history of severe head trauma requiring hospitalization, intracranial surgery, or stroke within 3 months before the study or any history of intracerebral arteriovenous malformation, cerebral aneurysm, or mass lesions of the central nervous system; a history of congenital bleeding diatheses; gastrointestinal bleeding within 6 weeks before the study unless corrective surgery had been performed; and trauma considered to increase the risk of bleeding Known hypercoagulable condition, including resistance to activated protein C; hereditary deficiency of protein C, protein S, or antithrombin III; presence of anticardiolipin antibody, antiphospholipid antibody, lupus anticoagulant, or homocysteinemia; or recently documented (within 3 months before the study) or highly suspected deep-vein thrombosis or pulmonary embolism Patients family, physician, or both not in favor of aggressive treatment of patient or presence of an advanced directive to withhold life-sustaining treatment Patient not expected to survive 28 days because of uncorrectable medical condition, such as poorly controlled neoplasm or other end-stage disease Moribund state in which death was perceived to be imminent Human immunodeficiency virus infection in association with a last known CD4 count of 50/mm3 History of bone marrow, lung, liver, pancreas, or small-bowel transplantation Chronic renal failure requiring hemodialysis or peritoneal dialysis* Known or suspected portosystemic hypertension, chronic jaundice, cirrhosis, or chronic ascites Acute pancreatitis with no established source of infection Participation in another investigational study within 30 days before the current study Use of any of the following medications or treatment regimens: unfractionated heparin to treat an active thrombotic event within 8 hours before the infusion; low-molecular-weight heparin at a higher dose than recommended for prophylactic use (as specified in the package insert) within 12 hours before the infusion; warfarin (if used within 7 days before study entry and if the prothrombin time exceeded the upper limit of the normal range for the institution); acetylsalicylic acid at a dose of more than 650 mg/day within 3 days before the study; thrombolytic therapy within 3 days before the study; glycoprotein IIb/IIIa antagonists within 7 days before study entry; antithrombin III at a dose of more than 10,000 U within 12 hours before the study; or protein C within 24 hours before the study *Acute renal failure was not an exclusion criterion. Prophylactic treatment with a dose of unfractionated heparin of up to 15,000 U per day was permitted. Thrombolytic agents were permitted for the treatment of thromboses within a catheter. N Engl J Med, Vol. 344, No. 10 March 8, 2001 www.nejm.org 707 Downloaded from www.nejm.org at HARVARD UNIVERSITY on April 23, 2007 . Copyright 2001 Massachusetts Medical Society. All rights reserved. The Ne w E n g l a nd Jo u r n a l o f Me d ic i ne APPENDIX 3 In addition to the authors, the following institutions and investigators participated in the study: Clinical Evaluation Committee: D. Heiselman, G. Kinasewitz, H. Levy, R. Light, D. Maki, P. Morris, J. Sollet; Vanderbilt Coordinating Center: B. Swindell, M. Stroud, S. Higgins, M. Burdett, J. Burger, S. Calderon, J. Gottesman, T. Thomas; Data Safety and Monitoring Board: S. Opal, E. Abraham, J. Wittes, S. Lowry; Clinical Sites: Australia: R. Bellomo, I. Baldwin, Heidelberg; R. Boots, C. Rickard, Hersten; G. Dobb, G. Morris, Perth; M. Chapman, J. Myburgh, S. Creed, D. Rea, Adelaide; S. Finfer, R. Lee, M. Madnaye, St. Leonards; P. van Heerden, B. Roberts, Nedlands; C. Joyce, T. Limpus, Woolloongabba; J. Cade, C. Boyce, Parkville; D. Breen, D. Rajbhandari, Camperdown; A. Bersten, T. Hunt, Bedford Park; A. Davies, G. Hanlon, L. Howard, Prahan; Belgium: P. Hantson, M. Reynaert, X. Wittebolle, H. Spapen, I. Hubloue, D. De Backer, P. Weyers, Brussels; F. Fort, D. Valadi, Mons; M. Simon, Arlon; Brazil: E. Knobel, E. Silva, J. Amaral, F. Machado, So Paulo; Canada: G. Jones, D. Garber, I. Watpool, Ottawa; J. Russell, V. Dunlop, T. Lehman, Vancouver; E. Jacobsohn, D. Bell, T. Wilson, Winnipeg; D. Zuege, D. Conley, Calgary; R. Johnston, D. Kutsogiannis, S. Marcushamer, D. Matheson, W. Murtha, A. Shustack, E. Konopad, P. Nicholls, N. Whalen, Edmonton; R. Light, M. Dominique, Winnipeg; C. Doig, L. Cranshaw, Calgary; I. Mayers, C. Carbonaro, B. Litwiniwich, M. Miller, Edmonton; F. Rutledge, V. Binns, J. Kehoe, London; T. Smith, J. Fuhrmann, B. Horodyski, Toronto; D. Heyland, E. Flynn, D. Witham, Kingston; J. Fenwick, L. Grandolfo, Vancouver; S. Mehta, R. MacDonald, Toronto; R. Hall, Y. Stolworthy, Halifax; J. Marshall, M. Steinberg, Toronto; K. Williams, B. Peters, Saskatoon; France: A. Cariou, Paris; J. Sollet, G. Bleichner, Argenteuil; F. Zeni, Saint-Etienne; D. Dreyfuss, A. de Lassence, Colombes; J. Timsit, E. Vantalon, Paris; J. Vedrinne, S. Duperret, Lyons; A. Tenaillon, J. Camuset, Evry; C. Martin, J. Albanese, Marseilles; C. Arich, R. Cohendy, Nmes; B. Vallet, P. Rodie-Talbere, Lille; M. Wolff, F. Delatour, Paris; G. Fournier, D. Jacques, Pierre-Bnite; Germany: P. Kujath, A. Stolfa, Lbeck; C. Erley, W. Shbel, Tbingen; T. Klss, J. Kramer, Hamburg; F. Forycki, B. Ehrecke, H. Riess, D. Barckow, Berlin; D. Schmitt, J. Garbade, Leipzig, H. Darius, M. Spiecker, Mainz; M. Wehling, Mannheim; the Netherlands: J. Bakker, J. Hofhuis, M. Disberg, Apeldoorn; C. van der Linden, Heerlen; S. van der Geest, L. Steens, B. Solberg, Maastricht; G. Ong, W. int Veld, Rotterdam; B. Speelberg, Tilburg; H. Delwig, J. Tulleken, J. Bottema, R. Spanjersberg, Groningen; New Zealand: R. Freebairn, L. Chadwick, Hastings; S. Henderson, J. Mehrtens, Christchurch; C. McArthur, L. Newby, J. Roberts, Auckland; South Africa: J. Brown, S. Tshukutsoane, Soweto; J. Pretorius, F. van Rensburg, Pretoria; J. Kilian, M. Landman, Lynnwood Ridge; M. Beale, D. Steyn, Tygerberg; Spain: R. Bayo Poleo, J. Juli Navarez, L. Lpez Snchez, Badajoz; A. Esteban de la Torre, J. Lorente Balanza, J. Colchon, P. Vadillo, Madrid; A. Artigas Raventos, F. Baigorri Gonzlez, G. Goma, Barcelona; C. Len Gil, J. Castillo Caballero, F. Lucena Caldern, F. Ortega Vinuesa, Seville; J. Boveda Trevino, J. Caballero Lpez, J. Ruiz Rodriguez, Barcelona; J. Caturla Such, J. Cnovas Robles, M. Delgado Lacosta, A. Silla Lpez, Alicante; J. Gmez Rub, V. Bixquert Montagud, A. Snchez Martos, J. San Martin Monzo, Murcia; United States: K. Lafleur, Springfield, Mass.; B. Margolis, C. Doombos, Oak Park, Ill.; G. Kinasewitz, C. Castle, A. Eid, Oklahoma City; H. Shanies, H. Luttinger, Elmhurst, N.Y.; H. Levy, M. Niedhart, T. Roughface, Albuquerque, N.M.; L. Anderson, E. Jones, M. Morrissey, Bay Pines, Fla.; G. Matuschak, P. Dettenmeier, St. Louis; D. Heiselman, B. Park, Akron, Ohio; J. Otoshi, L. Weber, Escondido, Calif.; J. Taylor, C. Tweten, Tacoma, Wash.; R. Wunderink, C. Jones, Memphis, Tenn.; G. Kohler, C. Reed, Lake Charles, La.; M. Harrison, J. Cwengros, S. Shore, K. Hogeterp, Grand Rapids, Mich.; D. Lusbader, N. Dengler, V. Reichert, Manhasset, N.Y.; P. Comp, C. Comp, D. Spence, Oklahoma City; J. Fraiz, C. Bunce, M. Watson, Indianapolis; T. Berne, J. Murray, L. Sarmiento, N. Solera, Los Angeles; G. Rubeiz, J. Miessen, Indianapolis; J. Kellum, M. Cohen, Pittsburgh; R. Carlson, C. Johnson, Phoenix, Ariz.; H. Simms, M. Levy, S. Lizotte, J. Houtchen, Providence, R.I.; R. Schmid, J. Bauwens, S. Weise, Sun City, Ariz.; R. Taylor, J. OBrien, St. Louis; C. Givens, T. Thompson, Newport News, Va.; D. Ziegler, D. Burns, Fort Worth, Tex.; P. Morris, A. HowardCarroll, Winston-Salem, N.C.; G. Gomez, D. Allen, M. Spires, Indianapolis; A. Multz, I. Balatsky, New Hyde Park, N.Y.; D. Smith, J. Josephs, T. Houlihan, Lackland AFB, Tex.; M. Polkow, T. McKiernan, Hackensack, N.J.; T. Verville, V. Zimmer, Charlotte, N.C.; P. Edelstein, A. Seiver, N. Novick, Stanford, Calif.; D. Graham, V. Molnar, Springfield, Ill.; J. Siever, Phoenix, Ariz.; F. Booth, K. Brunton, R. Kerins, Buffalo, N.Y.; E. Diamond, M. Borkgren, Elk Grove Village, Ill.; V. Bandi, G. Lingle, C. Pope, Houston; D. Green, M. Majewski, Chicago; K. Bagheri, C. Murphy, T. Peters, San Diego, Calif.; S. Berman, J. Doll, E. Johnson, Honolulu; D. Maki, V. Knasinski, A. Jones, Madison, Wis.; R. Riker, D. Schlichting, Portland, Me.; S. Weiss, J. Broughton, W. Silvers, Denver; G. Coppa, M. Temperino, Staten Island, N.Y.; R. Kearl, K. Oelschlager, Phoenix, Ariz.; J. Kennedy, Jr., J. Ryder, Birmingham, Ala.; C. Naum, T. Isaacs, Indianapolis; J. Mc- Feely, V. Perry, Berkeley, Calif.; J. Turner, B. Welcher, Sacramento, Calif.; J. Stasek, Jr., Houston; P. Papadakos, A. Holberton, Rochester, N.Y.; J. Travaline, D. Pollard, Philadelphia; B. de Boisblanc, E. Dimitry, New Orleans; M. Siegel, C. Roberts, New Haven, Conn.; D. Shasby, T. Gross, Iowa City, Iowa; D. Gervich, D. Foshe, Des Moines, Iowa; R. Light, T. Johnson, J. Rogers, Nashville; P. Kearney, J. Carpenter-Warner, A. Rockich, Lexington, Ky.; M. Birmingham, J. Hassett, D. Serrianne, Buffalo, N.Y.; M. Astiz, P. ONeil, New York; J. Whitney, E. Tobin, A. Sheehan, Albany, N.Y.; C. Oliphant, Casper, Wyo.; R. Miller, S. Graham, Greenville, S.C.; T. Rushton, R. Ashford, Huntington, W.Va.; C. Piquette, J. Melson, Omaha, Nebr.; R. Lodato, A. Mirza, S. Schippers, Houston, R. Corbin, Beaufort, N.C.; R. Baughman, M. Kerr, Cincinnati; J. Lamberti, Falls Church, Va.; S. Pingleton, S. Porras, Kansas City, Kans.; A. Anzueto, A. Roldan, San Antonio, Tex.; D. Resnick, K. Rodvold, D. Bearden, Chicago; J. Kruse, C. Hemmen, M. Thill, Detroit; T. Lo, M. Terry, Loma Linda, Calif.; A. Wheeler, S. Bozeman, L. Collins, Nashville; V. Lampasona, Atlanta; J. Gottleib, A. Girod, Philadelphia; M. Seneff, C. Spartan, Washington, D.C.; M. Cipolle, L. Baga, Allentown, Pa.; R. Schein, Y. Ellington, Miami; F. Luchette, E. Montgomery, Cincinnati; M. Rumbak, Tampa, Fla.; T. Albertson, E. Vlastelin, Sacramento, Calif. REFERENCES 1. Bone RC, Grodzin CJ, Balk RA. Sepsis: a new hypothesis for pathogenesis of the disease process. Chest 1997;112:235-43. 2. Angus DC, Birmingham MC, Balk RA, et al. E5 murine monoclonal antiendotoxin antibody in gram-negative sepsis: a randomized controlled trial. JAMA 2000;283:1723-30. 3. Rangel-Frausto MS, Pittet D, Costigan M, Hwang T, Davis CS, Wenzel RP. The natural history of the systemic inflammatory response syndrome (SIRS): a prospective study. JAMA 1995;273:117-23. 4. Annane D, Sebille V, Troche G, Raphael JC, Gajdos P, Bellissant E. A 3-level prognostic classification in septic shock based on cortisol levels and cortisol response to corticotropin. JAMA 2000;283:1038-45. 5. Increase in National Hospital Discharge Survey rates for septicemia United States, 1979-1987. JAMA 1990;263:937-8. 6. Linde-Zwirble WT, Angus DC, Carcillo J, Lidicker J, Clermont G, Pinsky MR. Age-specific incidence and outcome of sepsis in the US. Crit Care Med 1999;27:Suppl 1:A33. abstract. 7. Esmon CT, Taylor FB Jr, Snow TR. Inflammation and coagulation: linked processes potentially regulated through a common pathway mediated by protein C. Thromb Haemost 1991;66:160-5. 8. Yan SB, Grinnell BW. Recombinant human protein C, protein S, and thrombomomodulin as antithrombotics. Perspect Drug Discovery Des 1993;1:503-20. 9. Stouthard JM, Levi M, Hack CE, et al. Interleukin-6 stimulates coagulation, not fibrinolysis, in humans. Thromb Haemost 1996;76:738-42. 10. Conkling PR, Greenberg CS, Weinberg JB. Tumor necrosis factor induces tissue factor-like activity in human leukemia cell line U937 and peripheral blood monocytes. Blood 1988;72:128-33. 11. Bevilacqua MP, Pober JS, Majeau GR , Fiers W, Cotran RS, Gimbrone MA Jr. Recombinant tumor necrosis induces procoagulant activity in cultured human vascular endothelium: characterization and comparison with the actions of interleukin 1. Proc Natl Acad Sci U S A 1986;12:45337. 12. Vervloet MG, Thijs LG, Hack CE. Derangements of coagulation and fibrinolysis in critically ill patients with sepsis and septic shock. Semin Thromb Hemost 1998;24:33-44. 13. Levi M, ten Cate B. Disseminated intravascular coagulation. N Engl J Med 1999;341:586-92. 14. Iba T, Kidokoro A, Yagi Y. The role of the endothelium in changes in procoagulant activity in sepsis. J Am Coll Surg 1998;187:321-9. 15. Neshelm M, Wang W, Boffa M, Nagashima M, Morser J, Bajzar L. Thrombin, thrombomodulin and TAFI in the molecular link between coagulation and fibrinolysis. Thromb Haemost 1997;78:386-91. 16. Esmon CT. Inflammation and thrombosis: mutual regulation by protein C. Immunologist 1998;6:84-9. 17. Bajzar L, Neshelm ME, Tracy PB. The profibrinolytic effect of activated protein C in clots formed from plasma is TAFI-dependent. Blood 1996; 88:2093-100. 18. Esmon CT. The protein C anticoagulant pathway. Arterioscler Thromb 1992;12:135-45. 19. Boehme MW, Deng Y, Raeth U, et al. Release of thrombomodulin from endothelial cells by concerted action of TNF-alpha and neutrophils: in vivo and in vitro studies. Immunology 1996;87:134-40. 20. Fourrier F, Chopin C, Goudemand J, et al. Septic shock, multiple organ failure, and disseminated intravascular coagulation: compared patterns of antithrombin III, protein C, and protein S deficiencies. Chest 1992;101: 816-23. 708 N Engl J Med, Vol. 344, No. 10 March 8, 2001 www.nejm.org Downloaded from www.nejm.org at HARVARD UNIVERSITY on April 23, 2007 . Copyright 2001 Massachusetts Medical Society. All rights reserved. E F F ICACY AND SAF ET Y OF RECOMBINA NT H UMA N AC TIVATED PR OTEIN C FOR S EV ERE S EPS IS 21. Lorente JA, Garcia-Frade LJ, Landin L, et al. Time course of hemostatic abnormalities in sepsis and its relation to outcome. Chest 1993;103: 1536-42. 22. Boldt J, Papsdorf M, Rothe A, Kumle B, Piper S. Changes of the hemostatic network in critically ill patients is there a difference between sepsis, trauma, and neurosurgery patients? Crit Care Med 2000;28:44550. 23. Powars D, Larsen R, Johnson J, et al. Epidemic meningococcemia and purpura fulminans with induced protein C deficiency. Clin Infect Dis 1993;17:254-61. 24. Taylor FB Jr, Chang A, Esmon CT, DAngelo A, Vigano-DAngelo S, Blick KE. Protein C prevents the coagulopathic and lethal effects of Escherichia coli infusion in the baboon. J Clin Invest 1987;79:918-25. 25. Hartman DL, Bernard GR, Helterbrand JD, Yan SB, Fisher CJ. Recombinant human activated protein C (rhAPC) improves coagulation abnormalities associated with severe sepsis. Intensive Care Med 1998;24: Suppl 1:S77. abstract. 26. Bone RC, Balk RA, Cerra FB, et al. Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. Chest 1992;101:1644-55. 27. Yan SC, Razzano P, Chao YB, et al. Characterization and novel purification of recombinant human protein C from three mammalian cell lines. Biotechnology (N Y) 1990;8:655-61. 28. Lan KKG, DeMets DL. Discrete sequential boundaries for clinical trials. Biometrika 1983;70:659-63. 29. Knaus WA, Draper EA, Wagner DP, Zimmerman JE. APACHE II: a severity of disease classification system. Crit Care Med 1985;13:818-29. 30. Walker FJ, Sexton PW, Esmon CT. The inhibition of blood coagulation by activated protein C through the selective inactivation of activated factor V. Biochim Biophys Acta 1979;571:333-42. 31. Fulcher CA, Gardiner JE, Griffin JH, Zimmerman TS. Proteolytic inactivation of human factor VIII procoagulant protein by activated human protein C and its analogy with factor V. Blood 1984;63:486-9. 32. Grey ST, Tsuchida A, Hau H, Orthner CL, Salem HH, Hancock WW. Selective inhibitory effects of the anticoagulant activated protein C on the responses of human mononuclear phagocytes to LPS, IFN-gamma, or phorbol ester. J Immunol 1994;153:3664-72. 33. Hirose K, Okajima K, Taoka Y, et al. Activated protein C reduces the ischemia/reperfusion-induced spinal cord injury in rats by inhibiting neutrophil activation. Ann Surg 2000;232:272-80. 34. Grinnell BW, Hermann RB, Yan SB. Human protein C inhibits selectin-mediated cell adhesion: role of unique fucosylated oligosaccharide. Glycobiology 1994;4:221-5. Copyright 2001 Massachusetts Medical Society. ELECTRONIC ACCESS TO THE JOURNAL S CUMULATIVE INDEX At the Journals site on the World Wide Web (http://www.nejm.org) you can search an index of all articles published since January 1990. You can search by author, subject, title, type of article, or date. The results will include the citations for the articles plus links to the abstracts of articles published since 1993. Single articles and past issues of the Journal can also be ordered for a fee through the Internet (http://www.nejm.org /customer/). N Engl J Med, Vol. 344, No. 10 March 8, 2001 www.nejm.org 709 Downloaded from www.nejm.org at HARVARD UNIVERSITY on April 23, 2007 . Copyright 2001 Massachusetts Medical Society. All rights reserved.
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

MIT - HST - 527
MIT - HST - 527
374ReviewTRENDS in Pharmacological Sciences Vol.23 No.8 August 2002EDHF: bringing the concepts togetherRudi Busse, Gillian Edwards, Michel Fltou, Ingrid Fleming, Paul M. Vanhoutte and Arthur H. WestonEndothelial cells synthesize and release v
MIT - HST - 527
insight progressVascular-specific growth factors and blood vessel formationGeorge D. Yancopoulos, Samuel Davis, Nicholas W. Gale, John S. Rudge, Stanley J. Wiegand &amp; Jocelyn HolashRegeneron Pharmaceuticals, Inc., 777 Old Saw Mill River Road, Tarr
MIT - HST - 527
Endothelial Expression of a Mononuclear Leukocyte Adhesion Molecule During Atherogenesis Myron I. Cybulsky; Michael A. Gimbrone, Jr. Science, New Series, Vol. 251, No. 4995. (Feb. 15, 1991), pp. 788-791.Stable URL: http:/links.jstor.org/sici?sici=00
MIT - HST - 527
24 Dec 2005 16:0ARANRV262-ME57-01.texXMLPublishSM (2004/02/24) P1: KUV 10.1146/annurev.med.57.121304.131306Annu. Rev. Med. 2006. 57:118 doi: 10.1146/annurev.med.57.121304.131306 Copyright c 2006 by Annual Reviews. All rights reservedANGIOGE
MIT - HST - 527
HEMOSTASIS GOALS 1. 3. 4. 5. Define the terms hemostasis and coagulation Learn how to classify hemostasis and hypercoagulable states Explain systemic imbalance-local phenotype paradox Describe role for endothelium in mediating hemostasisREADING Req
MIT - HST - 527
Cell, Vol. 109, 693705, June 14, 2002, Copyright 2002 by Cell PressSensory Nerves Determine the Pattern of Arterial Differentiation and Blood Vessel Branching in the SkinYoh-suke Mukouyama,1,2 Donghun Shin,1 Stefan Britsch,3 Masahiko Taniguchi,4 a
MIT - HST - 527
Lecture 7 TRANSCRIPTIONAL REGULATION GOALS 1. 2. 3. 4. Understand principles of transcriptional regulation Explain the term lineage &quot;master switch&quot; Consider transcriptional regulation in context of input-output device Identify certain key transcripti
MIT - HST - 527
Endothelial Cell Gene RegulationTakashi Minami and William C. Aird*Endothelial cells (ECs) display phenotypic heterogeneity. Endothelial cell heterogeneity is mediated, at least in part, by site-specific and timedependent differences in gene trans
MIT - HST - 527
Transcriptional Regulation of Vascular Development Peter Oettgen Circ. Res. 2001;89;380-388 DOI: 10.1161/hh1701.095958Circulation Research is published by the American Heart Association. 7272 Greenville Avenue, Dallas, TX 72514 Copyright 2001 Ameri
MIT - HST - 527
Transcriptional Regulators of Angiogenesis Anne Hamik, Baiqiu Wang and Mukesh K. Jain Arterioscler. Thromb. Vasc. Biol. 2006;26;1936-1947; originally published online Jun 15, 2006; DOI: 10.1161/01.ATV.0000232542.42968.e3Arteriosclerosis, Thrombosis,
MIT - HST - 527
BRAIN ENDOTHELIUM GOALS . to answer the following questions 1. 2. 3. 4. What is the BBB? Where is the BBB? Why do we have a BBB? How is the BBB maintained?READING Required reading: Reese TS, Karnovsky MJ. Fine structural localization of a blood-bra
MIT - HST - 527
FINE STRUCTURAL LOCALIZATION OF A BLOOD-BRAIN BARRIER TO EXOGENOUS PEROXIDASET. S. REESE and MORRIS J. KARNOVSKY From the Departments of Anatomy and Pathology, Tlarvard Medical School, Boston, Massachusetts 0e115. D)r. Reese's present address is th
MIT - HST - 527
Lecture 3 DEVELOPMENTAL MECHANISMS AND MOLECULAR GENETICS OF THE VASCULATURE GOALS 1. 2. 3. 4. Describe the evolution of vascular structures and patterning among different organisms. Understand the embryonic origins of endothelial cells. Define the &quot;
MIT - HST - 527
The Smoke Detector PrincipleNatural Selection and the Regulation of Defensive ResponsesRANDOLPH M. NESSE Department of Psychiatry, The University of Michigan, Ann Arbor, Michigan 48104, USAABSTRACT: Defenses, such as flight, cough, stress, and an
MIT - HST - 527
CopyrightAnnu. Rev. Physiol. 2000. 62:64971 by Annual Reviews. All rights reservedENDOTHELIAL SIGNAL INTEGRATION IN VASCULAR ASSEMBLYThomas O. Daniel1 and Dale Abrahamson2Center for Vascular Biology, Departments of Medicine and Cell Biology, Va
MIT - HST - 527
Lecture 8B BRAIN ENDOTHELIUM GOALS . to answer the following questions 1. 2. 3. 4. What is the BBB? Where is the BBB? Why do we have a BBB? How is the BBB maintained?READING Required reading: Reese TS, Karnovsky MJ. Fine structural localization of
MIT - HST - 527
Clonality and altered behavior of endothelial cells from hemangiomasEileen Boye,1 Ying Yu,2 Gretchen Paranya,2 John B. Mulliken,3 Bjorn R. Olsen,1 and Joyce Bischoff21DepartmentSee related Commentary, pages 665666.of Cell Biology, Harvard Medic
CSU Bakersfield - ECON - 410
Chapter 15Finance and Fiscal Policy for DevelopmentCopyright 2009 Pearson Addison-Wesley. All rights reserved.The Role of Financial System Providing payment services Matching savers and investors Generating/distributing information Allocati
Washington - CONJ - 538
Conjoint 538 Course reminders and requirements course website: courses.washington.edu/conj538 attendance: required all classes and Mini-Symposium Gene Pool: your draw will be the basis for a short oral presentation and paper (see Guidelines on we
Stetson - GPA - 770
CONTENU DU COURSB. CONCEPTS A. MISEEN CONTEXTE LOGICIELS (PROGRAMMATION EN ASSEMBLEUR ET EN C)C. CONCEPTS MATRIELS (COMPOSANTS D'UN MICROCONTRLEUR)INTRAFINALUniversit du Qubeccole de technologie suprieureGPA770: Microlectronique appliq
Stetson - GPA - 770
CONTENU DU COURSUniversit du Qubeccole de technologie suprieureGPA770: Microlectronique applique ric GrangerC.2-1Partie C - Concepts matrielsC.1 Configurations matrielles:architecture du systme, mmoire, et ports d'e/sC.2 Gestion d'excep
Stetson - GPA - 770
CONTENU DU COURSONCEPTS ISE EN CONTEXTE LOGICIELS PROGRAMMATION EN ASSEMBLEUR ET ENONCEPTS ATRIELS COMPOSANTS D UN MICROCONTRLEURINTRAFINALUniversit du Qubeccole de technologie suprieureGPA770: Microlectronique applique ric GrangerC.3
Stetson - GPA - 770
CONTENU DU COURSONCEPTS LOGICIELS PROGRAMMATION EN ASSEMBLEUR ET ENISE EN CONTEXTEONCEPTS ATRIELS COMPOSANTS D UN MICROCONTRLEURINTRAFINALUniversit du Qubeccole de technologie suprieureGPA770: Microlectronique applique ric GrangerC.4
Stetson - GPA - 770
Microlectronique applique GPA770Automne 2008Universit du Qubeccole de technologie suprieureGPA770: Microlectronique applique ric Granger1SommaireOrganisation du cours GPA770:1) Prsentation personnelle 2) Plan dtaill du cours 3) Organisat
Uni. Worcester - CS - 543
CS 543: Computer Graphics Lecture 4 (Part I): 3D Affine transforms Emmanuel AguIntroduction to TransformationsnIntroduce 3D affine transformation:n n n nPosition (translation) Size (scaling) Orientation (rotation) Shapes (shear)n n n nPre
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 1 (Part 4): 2D Graphic Systems Emmanuel Agu2D Graphics: Coordinate Systemsn n n n nScreen coordinate system World coordinate system World window Viewport Window to Viewport mappingScreen Coordinate System
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 2 (Part III): Points, Scalars and Vectors Emmanuel AguPoints, Scalars and VectorsnPoints, vectors defined relative to a coordinate systemVectorsn n n n nMagnitude Direction NO position Can be added, sc
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 3 (Part II): 3D Affine transforms Emmanuel AguIntroduction to TransformationsnIntroduce 3D affine transformation:n n n nPosition (translation) Size (scaling) Orientation (rotation) Shapes (shear)n n n
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 5 (Part I): Projection Emmanuel Agu3D Viewing and View VolumenRecall: 3D viewing set upProjection Transformationn n nView volume can have different shapes (different looks) Different types of projectio
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 5 (Part IV): Hidden Surface Removal Emmanuel AguHidden surface Removaln n n nDrawing polygonal faces on screen consumes CPU cycles We cannot see every surface in scene To save time, draw only surfaces we se
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 7 (Part III): Raytracing (Part II) Emmanuel AguWhere are we?Define the objects and light sources in the scene Set up the camera for(int r = 0; r &lt; nRows; r+= blockSize){ for(int c = 0; c &lt; nCols; c+= blockSiz
Uni. Worcester - CS - 543
CS 543: Computer Graphics Lecture 7 (Part II): Projection Emmanuel Agu3D Viewing and View VolumenRecall: 3D viewing set upProjection Transformationn n nView volume can have different shapes (different looks) Different types of projection: p
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 8 (Part II): Raytracing (Part 4) Emmanuel AguReflection and Transparencyn nRay tracing also handles reflections and refraction of light well We can easily render realistic scenes withn nmirrors, martini
Truman State - CS - 170
CS 170Introduction to Computer ScienceSpring 2009Instructor: John Neitzke Office 8:30 10:20 M W F Office: VH 2242 Hours: 12:30 1:20 M W F Phone: x4529 and by appointment E-Mail: jneitzke@truman.edu Web: http:/www2.truman.edu/~jneitzke Course
Colorado State - FW - 662
Sheet1 vti_encoding:SR|utf8-nl vti_backlinkinfo:VX|overview.htm vti_timelastmodified:TR|23 Jan 1999 14:06:38 -0700 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|gwhite vti_modifiedby:SR|gwhite vti_timecreated:TR|03 Feb 2001 13:49:35 -0000 vti_cache
Colorado State - FW - 662
Sheet1 vti_encoding:SR|utf8-nl vti_backlinkinfo:VX|overview.htm vti_timelastmodified:TR|23 Jan 1999 14:57:58 -0700 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|gwhite vti_modifiedby:SR|gwhite vti_timecreated:TR|23 Jan 1999 21:57:58 -0000 vti_cache
Colorado State - FW - 662
Sheet1 vti_encoding:SR|utf8-nl vti_backlinkinfo:VX|overview.htm vti_timelastmodified:TR|23 Jan 1999 14:36:24 -0700 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|gwhite vti_modifiedby:SR|gwhite vti_timecreated:TR|03 Feb 2001 13:47:46 -0000 vti_cache
Colorado State - FW - 662
Sheet1 vti_encoding:SR|utf8-nl vti_backlinkinfo:VX|overview.htm vti_timelastmodified:TR|23 Jan 1999 14:43:14 -0700 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|gwhite vti_modifiedby:SR|gwhite vti_timecreated:TR|03 Feb 2001 13:51:12 -0000 vti_cache
Colorado State - FW - 662
Sheet1 vti_encoding:SR|utf8-nl vti_backlinkinfo:VX|overview.htm vti_timelastmodified:TR|23 Jan 1999 14:53:16 -0700 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|gwhite vti_modifiedby:SR|gwhite vti_timecreated:TR|23 Jan 1999 21:53:16 -0000 vti_cache
IUPUI - CS - 506
Sample Task Tracking: Form TASKOwner ID: Leader Effort Units Hour Period Units Week Date: 9/16/2006Team ID: Part/Level:1 ProposalProject: Health Package Iterations: 1-3TASK Work Flow Strategy Documentation &quot; Documentation Task Name Mngt. &amp; M
IUPUI - CS - 506
The User's GuideThe Guide must be structured so that it begins with a Title followed by the name and identifier of the author and the date. The first paragraph must be a brief statement of the topic that the Guide is going to explain. It must also
IUPUI - CS - 506
6. DESIGN II: DETAILED DESIGNDevelop Architecture - see chapter 5 Identify corporate practices Plan project Analyze requirements Design ImplementSoftware Engineering Roadmap: Chapter 6 FocusPerform Detailed Design - apply design patterns- acco
IUPUI - CS - 506
10. MAINTENANCESoftware Engineering Roadmap: Chapter 10 FocusIdentify corporate practices Plan project Analyze requirements Design Implement Test unitsAdapted from Software Engineering: An Object-Oriented Perspective by Eric J. Braude (Wiley 2001
IUPUI - CS - 506
8. UNIT TESTINGSoftware Engineering Roadmap: Chapter 8 FocusIdentify corporate practices Plan project Analyze requirements Design Implement Test units Maintain Integrate &amp; test systemTest units (parts) separately - use implementations- apply di
Maple Springs - ECON - 5310
Discussion Questions: Andreoni &amp; Payne (AER 03) 1. There are important differences in government spending across countries. This also implies significant differences in the level of private provision of public goods. Based on the material discussed i
Maple Springs - ECON - 5310
Discussion Questions: Brlhart &amp; Jametti (JPubE 2006) 1. 2. 3. 4. B &amp; J use instruments for the endogenous cantonal taxes. Discuss the choice of instruments. Discuss the control variables included in the regression. Why are they necessary? Is anything
Virginia Tech - CSX - 984
cgcgcgctggcgcgagcgatctcagtatccttagccgtatcccgacttatacaccgatccgagagacttccgtttgaacatcttggtgcgacggcggtccatatcgccgtctagaggttattccctaactccacgcactagatggtttcaggtaaggcgagacgtactcgtcgaagggcagagtcgcaacagccggcatggaagcataggagagccttcggctctcagcttcgtaagtatcaccgttccg
Allan Hancock College - LING - 253
Feelings and attitudes Loaded LanguagePersuasion without argument Affective language Sometimes explicit; sometimes implicit2005-10-17LING253: Reasoning12005-10-17LING253: Reasoning2Kinds of opinionObviously subjective opinion Obv
Allan Hancock College - LING - 253
LING253 figures - Affective language Table 1: Kinds of opinion; how they are expressedOpinion Affect +/+ Judgement + Appreciation + Modalisation + Modularity + Noun pleasure displeasure right wrong beauty ugliness certainty Adjective pleasant Verb l
Allan Hancock College - LING - 253
Example 1Example 2Anexcerptfromadraftprojectreport: Ourfirstmeeting,heldonMarch14th,waswiththeheadofthesales department,TedStevens.Generally,hegaveusanoutlineoftheorganisation, fromCEOtoprocessworker,anddiscussedthevariousdepartmentsthat wouldul
Allan Hancock College - LING - 253
Spoken &amp; written language Genre and Register They are different, but . . . Language is not conveniently split into two halves. Some texts seem to be both, or neither; the distinction is blurred.Language variation according to situation2006-08-
Allan Hancock College - LING - 253
Example 1Letter from a bank, announcing increased feesDear &lt;bank&gt; Customer, A few changes to your &lt;bank&gt; accounts. At &lt;bank&gt;, we are committed to providing our customers with real value when it comes to their everyday banking needs. We're also comm
Allan Hancock College - LING - 253
LING253: Week 3 Workshop, part 1First set of examples - business letters.BackgroundExample 1 is from a bank to a customer, announcing some fee increases and attempting to present them in a favourable light. Example 2 is an unsolicited offer from
Allan Hancock College - LING - 253
LST210 figures - week 4 Figure 1 Figure 2 Example 1The Prime Minister is going to Washington tomorrow. The cat got into a fight last night. Perhaps we should invite Sam and Sally over for dinner. Example 2Sam
Allan Hancock College - LING - 253
Environment chainFeedlots, where cattle are enclosed and fed a high-nutrient diet, have not been popular in Australia. Although there are about a million cattle in feedlots, and this number is predicted to double in five years, growth is held back b
Allan Hancock College - LING - 253
Livestock chainFeedlots, where cattle are enclosed and fed a high-nutrient diet, have not been popular in Australia. Although there are about a million cattle in feedlots, and this number is predicted to double in five years, growth is held back by
Minnesota - MATH - 4707
Math 4707Introduction to Combinatorics and Graph Theory Homework 2, Due Monday September 25Fall 2006Exercises in square brackets [ ] are to be worked out but not handed in. All answers must be supported. If a logical argument is required, use f
Allan Hancock College - LING - 253
Manure chainFeedlots, where cattle are enclosed and fed a high-nutrient diet, have not been popular in Australia. Although there are about a million cattle in feedlots, and this number is predicted to double in five years, growth is held back by env
Allan Hancock College - LING - 253
Place chainFeedlots, where cattle are enclosed and fed a high-nutrient diet, have not been popular in Australia. Although there are about a million cattle in feedlots, and this number is predicted to double in five years, growth is held back by envi
Minnesota - MATH - 4707
Math 4707Introduction to Combinatorics and Graph Theory Homework 4, Due Monday October 23Fall 2006Exercises in square brackets [ ] are to be worked out but not handed in. All answers must be supported. If a logical argument is required, use ful