32 Pages

Chapt15

Course: ECON 410, Spring 2008
School: CSU Bakersfield
Rating:
 
 
 
 
 

Word Count: 1035

Document Preview

15 Finance Chapter and Fiscal Policy for Development Copyright 2009 Pearson Addison-Wesley. All rights reserved. The Role of Financial System Providing payment services Matching savers and investors Generating/distributing information Allocating credit efficiently Pricing, pooling, and trading risks Increasing asset liquidity Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-2...

Register Now

Unformatted Document Excerpt

Coursehero >> California >> CSU Bakersfield >> ECON 410

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
15 Finance Chapter and Fiscal Policy for Development Copyright 2009 Pearson Addison-Wesley. All rights reserved. The Role of Financial System Providing payment services Matching savers and investors Generating/distributing information Allocating credit efficiently Pricing, pooling, and trading risks Increasing asset liquidity Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-2 Macroeconomic Stabilization Policy Fiscal policy: Taxation and spending actions of the government to affect employment and output Expansionary: lower the income tax rate and/or increase public spending to create jobs and income Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-3 Macroeconomic Stabilization Policy Monetary policy: Changing the supply of money to affect interest rate, investment demand, employment and output Expansionary: increase the money supply to reduce interest rate, increase investment demand, create jobs and income Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-4 Requirements of Monetary Policy An independent central banking authority Well organized financial market with banks and saving and loan institutions Strong link between interest rate and investment demand A floating exchange rate Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-5 Role of Central Bank Issue currency Banker to the government Banker to domestic banks Regulator of domestic financial institutions Operator of monetary policy Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-6 LDC Financial Market No central bank or a government-owned and managed central bank Financial dualism Formal market: organized, but dependent financial institution, consisting of foreign and domestic banks Informal market: unorganized, fragmented financial institutions, consisting of landowners and money lenders Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-7 LDC Financial Market Weak or ineffective link between interest rate and investment demand Structural inflation due to import substitution strategy Fixed or pegged foreign exchange rate, giving rise to a currency substitution problem Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-8 LDC Central Banking Problems Public agency issuing money to cover government deficit or finance the development plan Foreign-owned commercial banks Informal financial markets Colonial heritage A money supply difficult to measure A fixed or pegged exchange rate Unskilled central bankers Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-9 Emergence of Development Banks Specialized public and private financial institutions providing medium- and long-term loans for the creation and expansion of industrial enterprises Receive bilateral and multilateral loans from international lending agencies Receive loans from domestic government Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-10 Criticism of Development Banks Excessive concentration on large-scale loans Excessive concentration on financing urban-industrial development Neglect of small business expansion and rural-agricultural development Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-11 Need for Financial Liberalization Many LDCs suffer from financial repression since their central banks control the rate of interest, causing A shortage of loanable funds Higher interest rate charged by the informal financiers Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-12 Financial Repression Interest rate r1 = Market rate r2 = Controlled rate r3 = Black market rate r3 r1 r2 S L1 L2 Credit shortage = L1L2 D Loanable funds 15-13 Copyright 2009 Pearson Addison-Wesley. All rights reserved. Requirements of Fiscal Policy Reasonable tax rates Effective tax collection agency Honest tax-collectors and tax-payers Balanced-budget requirement Independent central bank Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-14 LDC Fiscal Problems Low level of per capita income High degree of income inequality Low and non-progressive individual corporate and income tax rates Low property tax rate Excessive foreign trade tax rates High excise tax rates Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-15 LDC Fiscal Problems Ineffective tax collection agency Corrupt tax collectors Deficit-financing growth policy Inflationary-financing growth policy Mounting public debt and external debt Reliance of foreign aid and foreign direct investment Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-16 Comparative Average Levels of Tax Revenue, 19851997, as % of GDP Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-17 Comparative Composition of Tax Revenue, 19851997, as % of GDP Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-18 Public Administration Problems Fragmented society due to ethnicity, religion, political affiliation, and economic class Employment rather than efficiency criterion Shortage of skilled administrators Low salaries and inadequate benefits Lack of trust and prevalence of corruption Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-19 State-Owned Enterprises Large capital investment Public utilities, transportation and communication systems, financial institutions, services, natural resources, agriculture, and manufacturing Contributing an average of 7-10 percent to GDP Employ 30-40 percent of the labor force Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-20 Problems of SOEs Inefficiency: employment rather than profit maximization Monopoly power Higher wages inducing R-U migration Import-intensive ISI strategy Lack of trust and prevalence of corruption Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-21 Solution to SOCs Efficiency criterion: adopt a bottom-line focus in managing public enterprises Privatization: sell ownership of public enterprises to private investors The Latin American and East Asian NICs have been active in the privatization of SOCs Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-22 Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-23 Military Spending and Development MDCs military spending is significantly higher than that of the LDCs (i.e., $527 vs. $200 billion) LDCs military spending share of world military spending has risen from 8.3 percent in 1960 to 27.5 percent in 2000 Copyright 2009 Pearson Addison-Wesley. All rights reserved. 15-24 Trends in Global Military Spe...

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Washington - CONJ - 538
Conjoint 538 Course reminders and requirements course website: courses.washington.edu/conj538 attendance: required all classes and Mini-Symposium Gene Pool: your draw will be the basis for a short oral presentation and paper (see Guidelines on we
Stetson - GPA - 770
CONTENU DU COURSB. CONCEPTS A. MISEEN CONTEXTE LOGICIELS (PROGRAMMATION EN ASSEMBLEUR ET EN C)C. CONCEPTS MATRIELS (COMPOSANTS D'UN MICROCONTRLEUR)INTRAFINALUniversit du Qubeccole de technologie suprieureGPA770: Microlectronique appliq
Stetson - GPA - 770
CONTENU DU COURSUniversit du Qubeccole de technologie suprieureGPA770: Microlectronique applique ric GrangerC.2-1Partie C - Concepts matrielsC.1 Configurations matrielles:architecture du systme, mmoire, et ports d'e/sC.2 Gestion d'excep
Stetson - GPA - 770
CONTENU DU COURSONCEPTS ISE EN CONTEXTE LOGICIELS PROGRAMMATION EN ASSEMBLEUR ET ENONCEPTS ATRIELS COMPOSANTS D UN MICROCONTRLEURINTRAFINALUniversit du Qubeccole de technologie suprieureGPA770: Microlectronique applique ric GrangerC.3
Stetson - GPA - 770
CONTENU DU COURSONCEPTS LOGICIELS PROGRAMMATION EN ASSEMBLEUR ET ENISE EN CONTEXTEONCEPTS ATRIELS COMPOSANTS D UN MICROCONTRLEURINTRAFINALUniversit du Qubeccole de technologie suprieureGPA770: Microlectronique applique ric GrangerC.4
Stetson - GPA - 770
Microlectronique applique GPA770Automne 2008Universit du Qubeccole de technologie suprieureGPA770: Microlectronique applique ric Granger1SommaireOrganisation du cours GPA770:1) Prsentation personnelle 2) Plan dtaill du cours 3) Organisat
Uni. Worcester - CS - 543
CS 543: Computer Graphics Lecture 4 (Part I): 3D Affine transforms Emmanuel AguIntroduction to TransformationsnIntroduce 3D affine transformation:n n n nPosition (translation) Size (scaling) Orientation (rotation) Shapes (shear)n n n nPre
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 1 (Part 4): 2D Graphic Systems Emmanuel Agu2D Graphics: Coordinate Systemsn n n n nScreen coordinate system World coordinate system World window Viewport Window to Viewport mappingScreen Coordinate System
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 2 (Part III): Points, Scalars and Vectors Emmanuel AguPoints, Scalars and VectorsnPoints, vectors defined relative to a coordinate systemVectorsn n n n nMagnitude Direction NO position Can be added, sc
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 3 (Part II): 3D Affine transforms Emmanuel AguIntroduction to TransformationsnIntroduce 3D affine transformation:n n n nPosition (translation) Size (scaling) Orientation (rotation) Shapes (shear)n n n
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 5 (Part I): Projection Emmanuel Agu3D Viewing and View VolumenRecall: 3D viewing set upProjection Transformationn n nView volume can have different shapes (different looks) Different types of projectio
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 5 (Part IV): Hidden Surface Removal Emmanuel AguHidden surface Removaln n n nDrawing polygonal faces on screen consumes CPU cycles We cannot see every surface in scene To save time, draw only surfaces we se
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 7 (Part III): Raytracing (Part II) Emmanuel AguWhere are we?Define the objects and light sources in the scene Set up the camera for(int r = 0; r < nRows; r+= blockSize){ for(int c = 0; c < nCols; c+= blockSiz
Uni. Worcester - CS - 543
CS 543: Computer Graphics Lecture 7 (Part II): Projection Emmanuel Agu3D Viewing and View VolumenRecall: 3D viewing set upProjection Transformationn n nView volume can have different shapes (different looks) Different types of projection: p
Uni. Worcester - CS - 543
CS 4731/543: Computer Graphics Lecture 8 (Part II): Raytracing (Part 4) Emmanuel AguReflection and Transparencyn nRay tracing also handles reflections and refraction of light well We can easily render realistic scenes withn nmirrors, martini
Truman State - CS - 170
CS 170Introduction to Computer ScienceSpring 2009Instructor: John Neitzke Office 8:30 10:20 M W F Office: VH 2242 Hours: 12:30 1:20 M W F Phone: x4529 and by appointment E-Mail: jneitzke@truman.edu Web: http:/www2.truman.edu/~jneitzke Course
Colorado State - FW - 662
Sheet1 vti_encoding:SR|utf8-nl vti_backlinkinfo:VX|overview.htm vti_timelastmodified:TR|23 Jan 1999 14:06:38 -0700 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|gwhite vti_modifiedby:SR|gwhite vti_timecreated:TR|03 Feb 2001 13:49:35 -0000 vti_cache
Colorado State - FW - 662
Sheet1 vti_encoding:SR|utf8-nl vti_backlinkinfo:VX|overview.htm vti_timelastmodified:TR|23 Jan 1999 14:57:58 -0700 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|gwhite vti_modifiedby:SR|gwhite vti_timecreated:TR|23 Jan 1999 21:57:58 -0000 vti_cache
Colorado State - FW - 662
Sheet1 vti_encoding:SR|utf8-nl vti_backlinkinfo:VX|overview.htm vti_timelastmodified:TR|23 Jan 1999 14:36:24 -0700 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|gwhite vti_modifiedby:SR|gwhite vti_timecreated:TR|03 Feb 2001 13:47:46 -0000 vti_cache
Colorado State - FW - 662
Sheet1 vti_encoding:SR|utf8-nl vti_backlinkinfo:VX|overview.htm vti_timelastmodified:TR|23 Jan 1999 14:43:14 -0700 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|gwhite vti_modifiedby:SR|gwhite vti_timecreated:TR|03 Feb 2001 13:51:12 -0000 vti_cache
Colorado State - FW - 662
Sheet1 vti_encoding:SR|utf8-nl vti_backlinkinfo:VX|overview.htm vti_timelastmodified:TR|23 Jan 1999 14:53:16 -0700 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|gwhite vti_modifiedby:SR|gwhite vti_timecreated:TR|23 Jan 1999 21:53:16 -0000 vti_cache
IUPUI - CS - 506
Sample Task Tracking: Form TASKOwner ID: Leader Effort Units Hour Period Units Week Date: 9/16/2006Team ID: Part/Level:1 ProposalProject: Health Package Iterations: 1-3TASK Work Flow Strategy Documentation " Documentation Task Name Mngt. & M
IUPUI - CS - 506
The User's GuideThe Guide must be structured so that it begins with a Title followed by the name and identifier of the author and the date. The first paragraph must be a brief statement of the topic that the Guide is going to explain. It must also
IUPUI - CS - 506
6. DESIGN II: DETAILED DESIGNDevelop Architecture - see chapter 5 Identify corporate practices Plan project Analyze requirements Design ImplementSoftware Engineering Roadmap: Chapter 6 FocusPerform Detailed Design - apply design patterns- acco
IUPUI - CS - 506
10. MAINTENANCESoftware Engineering Roadmap: Chapter 10 FocusIdentify corporate practices Plan project Analyze requirements Design Implement Test unitsAdapted from Software Engineering: An Object-Oriented Perspective by Eric J. Braude (Wiley 2001
IUPUI - CS - 506
8. UNIT TESTINGSoftware Engineering Roadmap: Chapter 8 FocusIdentify corporate practices Plan project Analyze requirements Design Implement Test units Maintain Integrate & test systemTest units (parts) separately - use implementations- apply di
Maple Springs - ECON - 5310
Discussion Questions: Andreoni & Payne (AER 03) 1. There are important differences in government spending across countries. This also implies significant differences in the level of private provision of public goods. Based on the material discussed i
Maple Springs - ECON - 5310
Discussion Questions: Brlhart & Jametti (JPubE 2006) 1. 2. 3. 4. B & J use instruments for the endogenous cantonal taxes. Discuss the choice of instruments. Discuss the control variables included in the regression. Why are they necessary? Is anything
Virginia Tech - CSX - 984
cgcgcgctggcgcgagcgatctcagtatccttagccgtatcccgacttatacaccgatccgagagacttccgtttgaacatcttggtgcgacggcggtccatatcgccgtctagaggttattccctaactccacgcactagatggtttcaggtaaggcgagacgtactcgtcgaagggcagagtcgcaacagccggcatggaagcataggagagccttcggctctcagcttcgtaagtatcaccgttccg
Allan Hancock College - LING - 253
Feelings and attitudes Loaded LanguagePersuasion without argument Affective language Sometimes explicit; sometimes implicit2005-10-17LING253: Reasoning12005-10-17LING253: Reasoning2Kinds of opinionObviously subjective opinion Obv
Allan Hancock College - LING - 253
LING253 figures - Affective language Table 1: Kinds of opinion; how they are expressedOpinion Affect +/+ Judgement + Appreciation + Modalisation + Modularity + Noun pleasure displeasure right wrong beauty ugliness certainty Adjective pleasant Verb l
Allan Hancock College - LING - 253
Example 1Example 2Anexcerptfromadraftprojectreport: Ourfirstmeeting,heldonMarch14th,waswiththeheadofthesales department,TedStevens.Generally,hegaveusanoutlineoftheorganisation, fromCEOtoprocessworker,anddiscussedthevariousdepartmentsthat wouldul
Allan Hancock College - LING - 253
Spoken & written language Genre and Register They are different, but . . . Language is not conveniently split into two halves. Some texts seem to be both, or neither; the distinction is blurred.Language variation according to situation2006-08-
Allan Hancock College - LING - 253
Example 1Letter from a bank, announcing increased feesDear <bank> Customer, A few changes to your <bank> accounts. At <bank>, we are committed to providing our customers with real value when it comes to their everyday banking needs. We're also comm
Allan Hancock College - LING - 253
LING253: Week 3 Workshop, part 1First set of examples - business letters.BackgroundExample 1 is from a bank to a customer, announcing some fee increases and attempting to present them in a favourable light. Example 2 is an unsolicited offer from
Allan Hancock College - LING - 253
LST210 figures - week 4 Figure 1 Figure 2 Example 1The Prime Minister is going to Washington tomorrow. The cat got into a fight last night. Perhaps we should invite Sam and Sally over for dinner. Example 2Sam
Allan Hancock College - LING - 253
Environment chainFeedlots, where cattle are enclosed and fed a high-nutrient diet, have not been popular in Australia. Although there are about a million cattle in feedlots, and this number is predicted to double in five years, growth is held back b
Allan Hancock College - LING - 253
Livestock chainFeedlots, where cattle are enclosed and fed a high-nutrient diet, have not been popular in Australia. Although there are about a million cattle in feedlots, and this number is predicted to double in five years, growth is held back by
Minnesota - MATH - 4707
Math 4707Introduction to Combinatorics and Graph Theory Homework 2, Due Monday September 25Fall 2006Exercises in square brackets [ ] are to be worked out but not handed in. All answers must be supported. If a logical argument is required, use f
Allan Hancock College - LING - 253
Manure chainFeedlots, where cattle are enclosed and fed a high-nutrient diet, have not been popular in Australia. Although there are about a million cattle in feedlots, and this number is predicted to double in five years, growth is held back by env
Allan Hancock College - LING - 253
Place chainFeedlots, where cattle are enclosed and fed a high-nutrient diet, have not been popular in Australia. Although there are about a million cattle in feedlots, and this number is predicted to double in five years, growth is held back by envi
Minnesota - MATH - 4707
Math 4707Introduction to Combinatorics and Graph Theory Homework 4, Due Monday October 23Fall 2006Exercises in square brackets [ ] are to be worked out but not handed in. All answers must be supported. If a logical argument is required, use ful
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralLink highlights in this colour to Company boxFeedlots,wherecattleareenclosedandfedahighnutrientdiet,havenotbeenpopularin Australia.Althoughthereareaboutamillioncattleinfeedlots,andthisnum
Minnesota - MATH - 4707
Math 4707Introduction to Combinatorics and Graph Theory Homework 6, Due Wednesday November 8Fall 2006Exercises in square brackets [ ] are to be worked out but not handed in. All answers must be supported. If a logical argument is required, use
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralLink highlights in this colour to Digestion boxFeedlots, where cattle are enclosed and fed a highnutrient diet, have not been popular in Australia. Although there are about a million cat
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralLink highlights in this colour to Digestion boxFeedlots,wherecattleareenclosedandfedahighnutrientdiet,havenotbeenpopularin Australia.Althoughthereareaboutamillioncattleinfeedlots,andthisn
Minnesota - MATH - 4707
Math 4707Introduction to Combinatorics and Graph Theory Homework 9, Due Monday December 11Fall 2006Reading: Section 14.2; Section 14.3; Exercises: Section 14.2: 4, 14; Section 14.3: 4, 14, 33; Additional Exercises: 1. Using the torus provided,
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralLink highlights in this colour to Feeding boxFeedlots, where cattle are enclosed and fed a highnutrient diet, have not been popular in Australia. Although there are about a million cattl
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralLink highlights in this colour to Feeding boxFeedlots, where cattle are enclosed and fed a highnutrient diet, have not been popular in Australia. Although there are about a million cattl
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralLink highlights in this colour to Product boxFeedlots, where cattle are enclosed and fed a highnutrient diet, have not been popular in Australia. Although there are about a million cattl
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralLink highlights in this colour to Livestock boxFeedlots, where cattle are enclosed and fed a highnutrient diet, have not been popular in Australia. Although there are about a million cat
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralLink highlights in this colour to Livestock boxFeedlots,wherecattleareenclosedandfedahighnutrientdiet,havenotbeenpopularin Australia.Althoughthereareaboutamillioncattleinfeedlots,andthisn
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralLink highlights in this colour to Place boxFeedlots, where cattle are enclosed and fed a highnutrient diet, have not been popular in Australia. Although there are about a million cattle
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralLink highlights in this colour to Place boxFeedlots, where cattle are enclosed and fed a highnutrient diet, have not been popular in Australia. Although there are about a million cattle
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralFeedlots, where cattle are enclosed and fed a highnutrient diet, have not been popular in Australia. Although there are about a million cattle in feedlots, and this number is predicted to
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralFeedlots,wherecattleareenclosedandfedahighnutrientdiet,havenotbeenpopularinAustralia. Althoughthereareaboutamillioncattleinfeedlots,andthisnumberispredictedtodoubleinfiveyears, growthishel
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralLink highlights in this colour to Product boxFeedlots, where cattle are enclosed and fed a highnutrient diet, have not been popular in Australia. Although there are about a million cattl
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralLink highlights in this colour to Science boxFeedlots, where cattle are enclosed and fed a highnutrient diet, have not been popular in Australia. Although there are about a million cattl
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralLink highlights in this colour to Science boxFeedlots,wherecattleareenclosedandfedahighnutrientdiet,havenotbeenpopularin Australia.Althoughthereareaboutamillioncattleinfeedlots,andthisnum
Allan Hancock College - LING - 253
Press releaseZeolite Australia has big plans for the mineralLink highlights in this colour to Science boxFeedlots,wherecattleareenclosedandfedahighnutrientdiet,havenotbeenpopularin Australia.Althoughthereareaboutamillioncattleinfeedlots,andthisnum
Allan Hancock College - LING - 253
P ress releaseZeolite Australia has big plans for the mineralLink highlights in this colour to Uses boxFeedlots, where cattle are enclosed and fed a highnutrient diet, have not been popular in Australia. Although there are about a million cattle