9 Pages

P1A Comments I Made

Course: ENG 603, Fall 2008
School: University of Texas
Rating:
 
 
 
 
 

Word Count: 3035

Document Preview

Comments I Made Current Forum: Project One Date: Fri Sep 24, 2004 8:47 pm Author: HILL, PHILLIP AARON <SPOONSMCGEE@HOTMAIL.COM> Subject: I tried to get you out of the sun... Hey Franzi. Good paper overall, but I agree with Chris that it was a little dry in some places...the only improvement I would make is a good punch in old Jasper's face. No not really (or really?!!!). Fantastic job running...

Register Now

Unformatted Document Excerpt

Coursehero >> Texas >> University of Texas >> ENG 603

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Comments I Made Current Forum: Project One Date: Fri Sep 24, 2004 8:47 pm Author: HILL, PHILLIP AARON &lt;SPOONSMCGEE@HOTMAIL.COM&gt; Subject: I tried to get you out of the sun... Hey Franzi. Good paper overall, but I agree with Chris that it was a little dry in some places...the only improvement I would make is a good punch in old Jasper's face. No not really (or really?!!!). Fantastic job running the gammut of suggested hypermedia (tsk tsk tsk you grade grubber, you). All you need is a video (really I expected better from you). I was just impressed with the barrage of information...almost got a black eye...Very well incorporated, however. I think the appearance of Ol' Jasper was hilarious how you &quot;felt a chill&quot; then all of a sudden a ghost appears and without batting an eye lash you ask him questions on his work. You're a tough cookie, not even ghostly apparitions can sway you from your studies. There were a couple sentences that were a bit laborious to read so, without further ado: &quot;Remembering having turned off the air conditioning before I began researching, I turned around&quot; This sentence doesn't jive as well with the rest of the paper what with all the -ing words in one place. You aren't Eminem. Besides you have a pretty terse, pedantic style going on so you know...whatever. Plus it just feels a tad roundabout. I might try (are you ready for this?): &quot;I remembered that I had turned off the air conditioner, so I turned around.&quot; This is one of the more conversational points in your paper so it might help to be a little more candid. I think you need absolutely no help increasing the length of the paper and its strongest suit is the amount of information you are citing, so I wouldn't extricate any of the facts either for fear of debasing all that you hold holy and blah blah blah, but I would try and locate some of those overly reflexive sentences, there were a handful and try and simplify them. ENOUGH!!! Current Forum: Project One Date: Fri Sep 24, 2004 9:06 pm Author: HILL, PHILLIP AARON &lt;SPOONSMCGEE@HOTMAIL.COM&gt; Subject: ...And I tried to fight you off like a matador... Dear Chris, I liked your paper, but I think it'd benefit from the two duking it out greco-roman style. But I digress. I never would have thought to pair Janis Joplin with Oscar Meyer Weiner, but hey, that's just me. I think you only did it to see how many times you could get away with your pottymouth diction. Tally: Fuck-1 Shit-8. I think the paper might benefit from some more background information on the Wilde Child since I did not feel particularly connected with his sense of place or his association with Oxford. It felt more like talking about the relationship rather than the relationship itself. Shit fuck shit fuck shit (half way up the shits, I'm winning in the fucks). Digression 2: The sentence I would improve is none other than the first one which does not agree with the verb tense of the rest of your paper. Sure it's in italics and all, but its just an expository paragraph that would be harmonious with the second paragraph if the tense was changed and the italics were taking away. Keep your italics by all means. Also, try and get rid of some commas. The old rule about putting one in everytime you breathe or pause is somewhat cumbersome in papers like this, plus it makes it seem like you're hyperventilating. I think it would jive better with the rest of the paper to read as follows: The ghost of Oscar Wilde ascended the steps of the University Tower, coming yet again for a meeting with his friend of some years, a ghostly young lady by the name of Janis Joplin. Also, on a strict matter of personal tastes (as if any of this above wasn't), it seems as though Oscar de la Hoya and the two-faced Roman deity are talking as though they are friends of a smaller time period than several years. But hey, maybe I just never had friends that long. I'm so very lonely... Current Forum: Project One Date: Fri Sep 24, 2004 9:24 pm Author: HILL, PHILLIP AARON &lt;SPOONSMCGEE@HOTMAIL.COM&gt; Subject: ...Then I was bored... Billy, Don't worry, the subject line up there isn't about your paper. Its a running theme for those who are trying to decipher my enigma. Your paper is one of my favorites so far. It is very...natural...I intended to tell everyone that they should somehow involve fisticuffs as a joke, but damn you I just couldn't bring myself to do it. You're characters are very likable. I also enjoyed the fact that you are a plan two student, but do not feel the need to assail your readers with unnecessary polysyllabic words and pretentious statements. You even had a great punch at the end about discovery learning. &quot;I am intrigued by your ideas and would like to subscribe to your newsletter.&quot; Like Chris above, I'm really only concerned about you maintaining your rhythm. The story's first speed bump for me is: I looked the man over. He was dressed formally in a coat and tie, had grey hair, and a full beard. I noticed a small, red name tag on the lapel of his coat. It read, Dr. J.M. Coetzee. The name sounded vaguely familiar. Suddenly I remembered why. You might benefit from some compound sentences. Try: I looked the man over; he was dressed formally in a cout and tie, had grey hair, and a full beard. I noticed a small, red name tag on the lapel of his cout that read &quot;Dr J.M. Coetzee.&quot; The name sounded vaguely familiar and I suddenly remembered why. Just helps the flow a little better instead of stopping and starting so many times. You may want to decrease the amount of exposition just to get to the point sooner. I personally like the quantity, but since we are obligated to make a suggestion, really the only thing I would change is some of the extraneous set-up so that the hungry reader might get to the meat a little sooner (I'm so poetic). Again great job with the paper, it really did feel like a saturday bike ride. ...punch someone in the face. Current Forum: Project One Date: Fri Sep 24, 2004 9:57 pm Author: HILL, PHILLIP AARON &lt;SPOONSMCGEE@HOTMAIL.COM&gt; Subject: ...I tried to fly you back to the sun... Amonnnnnnda, I like your characterizations of Newton and Treisman. I think their initial meeting would be better if Newton was so upset about the potential of people stealing his theories he jumped Treisman and taught him a thing or two about physics, OH! No?... Nothing?... Ok, ok ok, well...what if he hurls an apple at Treisman and...eh, I've got nothing. Seriously though (I'll be here all night folks), I also enjoyed you're use of detail and scenery. The descriptions really brought the place to life as well as the natural dialogue. I do get bogged down from time to time in your word choice, but maybe you are going for a nice juxtaposition of your verbiage with their more commonplace vocabulary (yah, stroke your own ego some more, just kidding). They are also very fitting individuals to have in conversation, clever design on your part. Touche Amanda. There are some syntactical moves in the realm of punctuation that I find a trifle questionable, namely the use of a comma instead of the good ol' dash. I think you'd be better suited to make use of the dash in a couple instances. I found this sentence to be mildly irksome: This is my office in the Robert L. Moore building1[13] at the University of Texas in the city of Austin, or it was, in 2004. I m not quite sure where we are now. 1 Only because Treisman seems to be a fan of Newton, so its likely that he knows that Newton lived in the 1600's and likely had no concept of the University of Texas or Austin or the RL Moore building. I might just say &quot;This is my office in the year 2004&quot; or something along those lines. Plus you already said &quot;In the Robert L. Moore building at the University of Texas&quot; above. Also, your method is very conversational, so I think that if he did want to refer to his own building despite Newton's unfamiliarity with it, he would say RLM instead of Robert L. Moore. I think you might also benefit from addressing Newton's relationship to Cambridge a little more. You do a fantastic job with the dialogue and discussing the connections between the individuals, but the prompt seems to focus more on the relationship to the university. Current Forum: Project One Date: Fri Sep 24, 2004 10:16 pm Author: HILL, PHILLIP AARON &lt;SPOONSMCGEE@HOTMAIL.COM&gt; Subject: ...And you were attacked by giant centepedes... Smellya, Well, in order to keep up my running gag, I'd have to suggest that you're paper would benefit from you punching yourself in the face. So...you know...go with that... Hahaha, you do run into things a lot. You're classic. But you just had to talk in Spanish didn't you? Showboating razumfraggum mumble mumble mumble. I enjoy the tense of the whole work, its a nice break to deal entirely in the present. You had some existential worries above (to which I completely relate, but is totally beside the point) and maybe subconciously you were trying to convey the impotance of the present moment by writing your paper in the present tense. There's some good Plan II bs for you eh? (Note to Bump: this is how we talk to each other). Ok ok ok, time to focus. Nice tie to Jude the Obscure, I think a lot of people forgot that they were advised to connect with works in class, including myself (2 points! ...grade monger). Maybe I'm old fashioned, but I'd like to see more paragraph breaks to make it easier on the old peepers. I'd also just like, oh my god, absolutely die if you could separate the two speakers when they converse...that'd be...just too beautiful for words. My sentence is &quot;I notice that what he just presented to me is a dualism, one between intellect and emotion.&quot; I think it'd be super keen to streamline that statement saying &quot;I notice that he has presented me with a dualism--one between intellect and emotion.&quot; Just to lose some excess verbiage. The simplicity of the syntax complements the gravity of the discussion very well and I wonder if you actually have these sentiments you speak of or if you just used them as a way to tie yourself to <a href="/keyword/donnie-darko/" >donnie darko</a> (if its the latter I'll just...I'll just die ::tears::). Like Amooooooonda, I think you too might benefit from a little more presentation of Don Corleone's relationship with Salamanca, just to stick strictly with the prompt. ...And then punch him in the face. Current Forum: Project One Date: Fri Sep 24, 2004 11:21 pm Author: HILL, PHILLIP AARON &lt;SPOONSMCGEE@HOTMAIL.COM&gt; Subject: ...Now I'm Set Free... Thida, You hate balding guys with glasses?! Me too!!! We should go gangbusters on them vigilante style. We can write about it, that'll inflate your word count yep yep. I dig your brusque sentences. It creates a really dark mood for the work, a nice break from the blank or happy-go-luckiness that seems to dominate. The beginning is very conversational too, seems almost Catcher in the Rye-ish with the tone and the syntax and the crazy narrator. I'm actually listening to Pink Floyd right now which, as we all know, wrote about nothing else but going insane in the time period between Sid Barrett's institutionalization and Roger Watter's departure. So it is oddly befitting. You had this in mind didn't you? You Sly Boots... When you say &quot;But it does not you know&quot; however, you should probably slap some commas on that baby, so its more like the audible pause or plight for empathy that it is (&quot;But it does not, you know,...). I think you too might benefit from more line breaks, especially in the dialogue, just for the reader's sake. Good use of quotes and other things, relating the views to what we've studied in class and what not. You're sentences are almost too brief (but good) to critique. They are as short as humanly possible, yet contain the most meaning. Its a very common problem in Plan II to overwrite so congrats on your part. It is just a personal thing, but below, you are conveying a certain since of awe and accomplishment and it is very minute, but I'd like to see that synergy kept up: &quot;His luminous eyes are filled with a burning ambition[20] as he relives his triumph from just that morning. &quot; Changing it from &quot;just that morning&quot; to &quot;that very morning&quot; won't change the word count at all, but it seems to me to convey more the tone you are going for. At least the tone I am garnering. Of all the papers I've read, I think your's is the most perfect as far as filling each sentence with content. I wish I had that ability, but hey I'm a crappy writer and I just want to make people laugh. I just cannot really suggest anything to inflate or deflate your word count and since no one else has said anything, I'll just say that I agree with whatever anyone else can come up with to effect your word count (though you'll know at heart I think it is perfect just the way it is). Lets punch Baldy! Current Forum: Project One Date: Fri Sep 24, 2004 10:35 pm Author: HILL, PHILLIP AARON &lt;SPOONSMCGEE@HOTMAIL.COM&gt; Subject: ...Now I'm set free... Violin-Playing-Fool-Fresh-Outta-Violin-Playing-School, I'm getting tired so I can't be as much of a knee-slapping hysterical riot (*cough cough*) as I have been in my earlier responses. Let's just get to the point shall we. Disembodied voice yelling at you? Man I wouldn't take that from no voice. I'd grab that voice by its...voice...and you know...proceed to trounce it soundly. Now that the compulsory punching joke is out of the way, the sentence I wanted to choose for you jumped right off the page at me: NO! Berke Breathed, like method! says the voice, clearly ready to exact its vengeance on his chosen people. I'm not really sure what the latter half of that sentence even means, but I suppose I'...

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

University of Texas - ENG - 603
CommentsCurrent Forum: Project One Date: Fri Sep 24, 2004 11:09 am Author: ROESNER, FRANZISKA &lt;FRANZI@MAIL.UTEXAS.EDU&gt; Subject: Phillip studied Mr. Eliot's work in AP English IV and thoroughly despised him.Hehe, I really like how you start off. de
University of Texas - ENG - 603
#&gt;# # # #Q@ #?#bjbj # #3## # #z#d#Z !#Z!#Z!#Z!#L#!#&lt;#9#! #:#(&quot;#(&quot;#(&quot;#(&quot;#s/#s/#s/#$9##&amp;9#&amp;9# #&amp;9#&amp;9#&amp;9#&amp;9#$#[:#R#&lt;#&amp;#J9#1#6#s/#1#1#J9#(&quot;#(&quot;# #_9#5#5#5#1#l#(&quot;#(&quot;#$9# #5#1#$9#5# ##5#5# #5#(&quot;#!##@{M :#Z! #D3#0#5#$9#u9#0#9#5#=#t4#l#=# #5# =#5#(#s/
University of Texas - ENG - 603
&quot;dear dear, how queer everything is to-day! And yesterday things went on just as usual. I wonder if I've been changed in the night? Let me think: was I the same when I got up this morning? I almost think I can remember feeling a little different. But
University of Texas - ENG - 603
Merrell Hood A1 Extroverted 11% Sensing 22% Feeling 11% Judging 22% Fun brunette ESFJ looking for a friend or more ESFP to share good conversations with. That was a joke. I learned that I am an extroverted, sensing, feeling, and judgmental person fro
University of Texas - ENG - 603
Merrell Hood A2 Ive been writing everyday for almost three weeks. That is more writing than I ever probably ever done. Progress wise, I have good days and bad days and I find that I discover something slightly interesting to say more and more often.
University of Texas - ENG - 603
When Alice is talking to Humpty Dumpty in chapter six of Through the Looking Glass I am reminded of the difficulty in relating to professors. Humpty says When I use a word it means just what I choose it to meanneither more nor less (213) and I empath
University of Texas - ENG - 603
Merrell Hood LR Midterm When I step outside of myself I see a road with me on it. It is a straight path and my head is turned down trucking away. I don't have the foresight to see what is ahead except for just the few paces in front of me. My bird's
University of Texas - ENG - 603
Learning Record Goals A1 A2 Midterm Final 1 23 4 56 5962Journals, In Class Writings, Excursion Writings St. Mary's Capitol Zilker Park HRC Play Day Pictures Hypermedia Discovery Learning Why Plan II? Jude, Parts 1&amp;2 Jude, Zuleika College Traditio
University of Texas - ENG - 603
Italian: Study daily Prepare for next day Tests on Oct 16,17Calculus: Review Homework Test on Nov. 4 Homework Due WednesdayWorld Literature: Journals Due Nov 9, 16, 18 P2A Post on Nov. 4 P2A Due Nov. 11 LR Final PortfolioBusiness Adm
University of Texas - ENG - 603
This is the window outside my room in my old house. I used to open this window and climb out on these &quot;stairs&quot; as I called them. I would come in and out this way rather than the door because I felt like it was my own private door. It was my spot of t
University of Texas - ENG - 603
1&quot;I am just ready to go, ready to get away from here and start over.&quot; Dorothy listened to her friends say this yet again. For the last few months, it seemed like that was the only thing any of them could say. They only had a few weeks before they le
University of Texas - ENG - 603
Current Forum: Project Two Date: Wed Nov 3, 2004 11:42 pm Author: THANT, THIDA MYO &lt;THIDATHANT@MAIL.UTEXAS.EDU&gt; Subject: You must find your own way, I am simply a confidant and gentle guide. Now, go! and with that, Gloria walked back into an office i
University of Texas - ENG - 603
Hood 1Merrell Hood_P1 Blame it on the stairs. Even in my exhaustion, my mind still tried to calculate.2 flights, at 12 steps each, times 38 round trips.912 steps. I had spent all day moving into my new dorm room at the University of Texas at Austin,
University of Texas - ENG - 603
&lt; http:/www.exeter.ox.ac.uk/tour/map.htm&gt; fellows &lt;www.magd.ox.ac.uk/looking_around/addisons_walk.shtml&gt; Addison Lewis at His Room at Magdalen, Sayer insert.
University of Texas - ENG - 603
http:/www.cwrl.utexas.edu/~ bump/oxford/union/Oxfordunion.htmlhttp:/www.cwrl.utexas.edu/~bump/oxford/Exeter/Exeter1a.JP Ghttp:/www.cwrl.utexas.edu/~bump/oxford/Me rton/Tolkienrmsm.jpg
University of Texas - ENG - 603
#;# #j# # # # # #! #&quot;#$#%#&amp;#'#(#)#*#+#,#.#/#0#1#2#3#4#5#6#7#8#9#:#;#&lt;#=#&gt;#? #@#A#B#C#D#E#F#G#H#I#J#K#L#M#N#O#P#Q#R#S# T#U#V#W#X#Y#Z#[#\#]#^#_#`#a#b#c#d#e#f#g#h# #i#j#k#l#m#n#o#p#q#r#s#t#u#v#w#x#y#z#{#| #}#~#R#o#o#t# #E#n#t#r#y# # ## # # # ##
Stanford - BIOCHEM - 218
Biochem 218 Protein Structural MotifsFebruary 22, 2007Doug Brutlag Department of Biochemistry &amp; Medicine (by courtesy) Stanford University School of Medicine Doug Brutlag 2007Protein Structure Computational Goals Compare all known structures t
Washington - OCEAN - 420
Time0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 2 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 2.9 3 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 3.9 4 4.1 4.2 4.3 4.4 4.5 4.6 4.7 4.8 4.9 5 5.1 5.2Stake10.03 0.07 0.1 0.13 0.15 0.17 0.19 0.2
Stanford - BIOCHEM - 218
Biochem 218 - 2007 Lecture 15Clustering and Functional Analysis of Coordinately Regulated Genes Gavin Sherlock sherlock@genome.stanford.edu February 27th 2007Analysis and visualization of microarray data What are the goals of typical microarray
Stanford - BIOCHEM - 218
GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC AATCAAGGTGACAGACAACTGGTGCAATGATGGTAGTGGAAATGGAGG
Stanford - BIOCHEM - 218
Computational Molecular Biology Sequence AlignmentJanuary 30, 2007Doug Brutlag Departments of Biochemistry &amp; Medicine Stanford University School of Medicine Doug Brutlag 2007DNA Dot Matrix Doug Brutlag 2007DNA Dot Matrix (2) Doug Brutlag
Utah - URPL - 5010
Revised Population Estimates for the 1990s:Utah Population Estimates CommitteePam Perlich Bureau of Economic and Business Research University of UtahAugust 27, 2001Intercensal Estimates RevisionUtah Population Estimates Committee Work Group:
Washington University in St. Louis - WU - 128
Warm-up Problems - April 27, 2007 Solutions1. Find the local extrema of f (x, y) = x4 8xy + 2y 2 3 Solution: Saddle at (0, 0) Local min of 19 at (2, 4). Local min of 19 at (2, 4).3 2. Find the minimum of f (x, y) = 2x2 2xy 2 y 2 + x 5y subj
Washington University in St. Louis - WU - 128
Warm-up Problems - April 25, 2007Topics for Final Exam: I. Integration: definite integrals, indefinite integrals, area under curves, integration by substitution, integration by parts, improper integrals II. Approximate integration: Simpson's rule (n
Washington University in St. Louis - WU - 128
Area Under the Standard Normal Curve ( = 0, = 1) From 0 to zz 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 2.9 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 3.9 0.00 0.0000 0.0398 0.0793
U. Houston - COSC - 6376
COSC6376Fall Semester 2006Grid ComputingInstructor: S. Lennart Johnsson Times: Tu Th 4 - 5:30 PM Location: PGH 200 Office Hours: By appointment e-mail: johnsson@cs.uh.edu Assistant: Cecilia Dykes, cmdykes@tlc2.uh.edu, 713-743-1966Administrativ
Washington University in St. Louis - WU - 128
Warm-up Problems - April 22, 2007 Solutions1. Let Z be the standard normal random variable. Use the chart on the back to compute the probabilities. (Hint: Make sure you draw the area that the question is asking for!) (a) P (1.21 Z 0.54) = 0.3869 +
Washington University in St. Louis - WU - 128
Warm-up Problems - April 18, 20071. Consider the following cumulative distribution function (cdf). Remember that the cdf is definited by F (x) = P (X x). 0 if x &lt; 0 1 2 F (x) = 9 x if 0 x 3 1 if x &gt; 3 Use the cdf to answer the questions. (a)
Washington University in St. Louis - WU - 128
Warm-up Problems - April 18, 2007 Solutions1. Consider the following cumulative distribution function (cdf). Remember that the cdf is denited by F (x) = P (X x). 0 if x &lt; 0 1 2 F (x) = 9 x if 0 x 3 1 if x &gt; 3 Use the cdf to answer the questio
Washington University in St. Louis - WU - 128
Warm-up Problems - April 13, 2007 Solutions1. Compute the integrals: (a)e-x dx = 10(b)1e-x dx = 1 - e-1 0.6320(c)2e-x dx = e-1 - e-2 0.2331(d)e-x dx = e-1 0.3681Lecture Problems2. For each of the functions below, sketch a
UConn - ECO - 503
First Joint MIT/UConn/UMass/UMD Syntax Workshop, University of Connecticut, February 8, 2003 On object shift and VP-fronting in Bulgarian Mariana Lambova, University of Connecticut &lt;mdl97002@huskymail.uconn.edu&gt; [This is a slightly revised version of
Washington University in St. Louis - WU - 128
Review Problems - April 11, 20071. Let f (x) = x5 . (a) Find the degree 4 Taylor polynomial centered at x = 0. (b) Find the degree 4 Taylor polynomial centered at x = 5. 2. Let f (x) = x. (Make sure you do these in order, dont skip any part before
UConn - ECO - 52008
Jeffrey Bernath, University of Connecticut Looking for Determiners in ASL: Further Confusing the Issue The search for determiners in American Sign Language (ASL) has yielded controversial results since the beginning of linguistic research of the lang
UConn - ECO - 52008
Sverre Johnsen Harvard 'Binding in complements of perception verbs'Norwegian is one of the most discussed languages in the literature on reflexive binding, with its system of simple and complex reflexives seg vs. seg sjl. This talk will present ne
UConn - ECO - 52008
Partial Focus Fronting in Mandarin `even' Constructions Noah Constant and Chloe Gu. (UMass, Amherst) Mandarin `even' constructions provide a view of how conflicting pressures from syntax, semantics, and prosody can give rise to a complex paradigm of
Washington University in St. Louis - WU - 128
Warm-up Problems - April 9, 2007 Solutions1. Suppose you flip a coin 2 times. What are the possible outcomes? Solution: HH, HT, TH, TT 2. Suppose you roll a six-side die 600 times. How many times do you expect to roll a 6? Solution: You expect1 6
Washington University in St. Louis - WU - 128
Warm-up Problems - April 6, 20071. Find the 5th degree Taylor polynomials for the function at the point given. (a) 1 1-x (b) ex (c) sin x (d) 1 (1 + x)Lecture Problems2. Find the Taylor series and find the general term for the Taylor series (a) (
Allan Hancock College - MECH - 3405
Some Notes on the Assignment of ICCP System for an Underground PipelineMany students have problem in determining of the anode-pipeline distance d using the Ohm's Law. We know that resistance is related to resistivity via: R=L AL is our d, and A
Allan Hancock College - MECH - 3405
Effect of Moisture on the Spatial Uniformity of Cathodic Protection of Steel .E B Muehlenkamp; M D Koretsky; J C Westall Corrosion; Jun 2005; 61, 6; ProQuest Science Journals pg. 519Reproduced with permission of the copyright owner. Further reprod
Allan Hancock College - MECH - 3405
SURNAME: _ STUDENT NO: _ GIVEN NAMES: _FACULTY: _ 1ST SEMESTER EXAMINATIONS 2001 SCHOOL OF MECHANICAL ENGINEERING Industrial Corrosion and Prevention 308 (630.308) This Paper Contains: 3 Pages 5 Questions Time Allowed: Reading Time: 3 Hours 10 Minute
Allan Hancock College - MECH - 3405
Structure Integrity 318 Corrosion and PreventionSuggested solutions for selected questions1. A metal, M, of valence z, atomic mass W and density is corroding uniformly over its exposed surface by an electrochemical process with a current density
Washington University in St. Louis - WU - 128
Warm-up Problems - April 4, 20071. For the follwing series, nd the sum if they converge (they are all geometric) (a)n=05(2n ) 3n(b)n=25(2n ) 3n(c)n=05(3n ) 2n(d)n=02n + 3n 7nLecture Problems2. Determine if the following
Washington University in St. Louis - WU - 128
Warm-up Problems - April 4, 2007 Solutions1. For the follwing series, nd the sum if they converge (they are all geometric) (a)n=05(2n ) 5 = = 15 n 3 1 2/32 (a = 5, r = ) 3(b)n=25(2n ) 20/9 20 = = 3n 1 2/3 3(a =20 2 ,r = ) 9 3(c
Washington University in St. Louis - WU - 128
Warm-up Problems - March 30, 20071. Find the x-intercept (the x-coordinate of where it crosses the x-axis) for the following lines: (a) y = 3x + 5 (b) y = 32x + 154 (c) y = mx + b (d) y y0 = m(x x0 )Lecture Problems2. Use Newtons method to nd a
Allan Hancock College - MECH - 3405
vti_encoding:SR|utf8-nl vti_author:SR|robert vti_modifiedby:SR|liu vti_timecreated:TR|14 Feb 2000 02:40:40 -0000 vti_timelastmodified:TR|14 Feb 2000 02:40:40 -0000 vti_filesize:IR|179200 vti_title:SR| vti_extenderversion:SR|4.0.2.2717 vti_backlinkinf
Washington University in St. Louis - WU - 128
Warm-up Problems - March 26, 20071. Find fifth degree Taylor polynomial for the function f (x) = x at x = 1.n 0 1 2 3 4 5f (n) (x)f (n) (1)an =f (n) (1) n!2. Find fifth degree Taylor polynomial for the function f (x) =x at x = 4.L
Washington University in St. Louis - WU - 128
Warm-up Problems - March 26, 2007 Solutions1. Find fth degree Taylor polynomial for the function f (x) = x at x = 1.n 0 1 2 3 4 5f (n) (x) x1/2 1 1/2 x 2 1 3/2 4x 3 5/2 x 8 15 x7/2 16 105 9/2 x 32f (n) (1) 1 1 41 2an =f (n) (1) n!1 1
Wayne State University - TED - 6020
Copyright and FairUseGuidelines for Teacherswww.techlearning.com. More detailed information about fair use guidelines and copyright resources is available at www.halldavidson.net.This chart was designed to inform teachers of what they may do under
Washington University in St. Louis - WU - 128
Warm-up Problems - March 21, 2007 Solutions1. For the functions below, find the equation of the tangent line at the point. (a) f (x) = ex , x = 0 Solution: Tangent line: y = 1 + x (b) f (x) = e2x , x = 0 Solution: Tangent line: y = 1 + 2x (c) f (x)
Washington University in St. Louis - WU - 128
Warm-up Problems - March 19, 2007 Solutions1. Sketch solutions to the differential equations: (Remember to find the constant solutions first and then determine if the solutions are increasing or decreasing between the constant solutions). (a) dP = 0
Wayne State University - ELE - 3600
MACKINACAlicia Compton Shelly Labadie Kelly Sheridan Shana Speicher Kory Trombley Dan WalkenhorstRoad Map- Introduction Topic: Mackinac Materials: Computers, Mackinac videos, items within the lone box (museum artifacts). Books: Mackinac, an is
Wayne State University - ELE - 3600
Michigan's Lumber IndustryCompiled By: Darcy Platt Yvonne Ghedotte Amber Daniels Dayna Peoples Lorita KirkseyELE 3600 Dr. Bob PettapieceIntroduction:Grade Level: Later Elementary Background Information: As this country was settled, the demands
Wayne State University - COE - 3600
BLOOM'S REVISED TAXONOMY CreatingGenerating new ideas, products, or ways of viewing things Designing, constructing, planning, producing, inventing.EvaluatingJustifying a decision or course of action Checking, hypothesising, critiquing, experiment
Washington University in St. Louis - WU - 128
Warm-up Problems - February 28, 20071. Match up the differential equation with the graph of its slopefield. (a) y = y - t (b) y = (y - 1)t (c) y = (y + 1)(t - 1) (d) y = -yt (e) y = y(t - 1) (f) y = y(t + 1) (g) y = (y + 1)(t + 1) (h) y = (y + 1)t (
Washington University in St. Louis - WU - 128
Warm-up Problems - February 28, 2007 Solutions1. Match up the dierential equation with the graph of its slopeeld. (a) y = y t (b) y = (y 1)t (d) y = yt (e) y = y(t 1) (f) y = y(t + 1) (h) y = (y + 1)t (i) y = ytA4.0 3.2 2.4 1.6 0.8 0.0 4 2 t 0.
Georgia Tech - CS - 8803
Paper #Title: Serverless Network File System(1) Problem:In the traditional central server file systems, the central server is involved in every read misses and disk writes. This fact limits the performance. They also need some specialized hardwa
Georgia Tech - CS - 8803
Paper # 25Title : Enhancing the Web's Infrastructure: From Caching to Replication(1) Problem:As the penetration of internet is increasing, internet has started facing many difficulties like congestion, bandwidth problems etc. Researchers have pro
Georgia Tech - CS - 8803
PAPER CRITIQUEPaper: 3.18Title: Free transactions with Rio VistaName: Aditya DevurkarMail:adityad@gatech.eduProblems: The paper presents a novel architecture for transaction, concurrency and atomicity. The paper discusses in detail about the
Georgia Tech - CS - 8803
Paper #: 18 (Section 3)Title: Free Transactions with Rio Vista(1) Problems:- Traditional transaction systems have a very a large overhead for maintaining the atomicity property of the transaction of it. It requires at least one synchronous disk
Georgia Tech - CS - 8803
CS 8803: AIAD Week [8] Reading SummariesFamily Name: RajanGiven Name: ChiragPaper # [3] 18Title: Free Transactions with Rio Vista(1) Problems: The paper addresses a number of existing problems with respect to data storage, specifically:-&gt; Tran
Georgia Tech - CS - 8803
Paper #: [2.2 WP] - 28Title: Improving End to End Performance of the Web using Server Volumes and Proxy Filters(1) ProblemsAs the web (and individual websites) continues to grow, and new protocols (such as bittorrent) and applications (such as st