Coursehero >> Illinois >> N.E. Illinois >> BIO 1001

Course Hero has millions of student submitted documents similar to the one below including study guides, homework solutions, papers, exam answer keys and textbook solutions.

DNA From to Proteins DNA makes ____ makes ________. 3' 5' growing RNA transcript Chapter 13 3' 5' direction of transcription Proteins are the links between ___________ and ________________. ___________ and ___________ are the two main processes linking gene to protein The bridge between DNA and ________ synthesis is RNA. RNA differs from DNA 1. RNA contains _____as its sugar (not deoxyribose) 2. _______ replaces thymine. AGTCAT becomes AGUCAU 3. An RNA molecule almost always consists of a This is an H in DNA Fig. 6.8a 4 types of RNA ________ - carries info for protein production _______-transport amino acids in translation _______- part of ribosome, has role in translation ________ - splicing mRNA Chromosome- 1.5 x 108 base pairs containing about 3000 genes 0.4% of a chromosome, containing 10 genes = 1. ________________ ATG B C D E F TAA = 2. ________________ 3' 5' 5' 3' DNA +1 AUG AATAAA 3. _____________ Pre-mRNA UAA 4._________ 5. ______ 7m AB G AUG CD AAAAAA..... UAA E F 6. ____________ 7. ________________ NH2 COO- Protein ____________ - DNA is the template for RNA, usually __________ RNA (mRNA). ____________________ - the information contained in the order of nucleotides in mRNA is used to determine the __________ sequence of a polypeptide. -Translation occurs at ____________. The basic mechanics of transcription and translation are ________ in eukaryotes and prokaryotes. Fig. 17.2a In the genetic code, nucleotide triplets specify amino acids In the __________, three consecutive bases specify an amino acid, creating 43 (64) possible ________. The genetic instructions for a polypeptide chain are written in DNA as a series of three__________words. The genetic code 1. ___ of 64 triplets code for amino acids. o w t !! o w h chart Kno this d rea AUG codes for the methionine and ____ of translation. Three codons ___, ___ and ____ do not code amino acids but signal the termination of translation. 2. The genetic code is __________but not_ _________ . Typically several different codons specify a given amino acid Fig. 17.4 Any one codon indicates _ __________ amino acid. The genetic code (cont.) o w t !! ho art now is ch K th d rea A ______________ is established at the translation start RNA 5' UUACGAUGGAUUCAAACGUCAGGGCCUAAGGCUAG3' Met Asp Ser Asn Val Arg Ala Stop Start codon codon Summary- The genetic code uses_ ____________________, or codons, each of which is translated into a specific amino acid. The genetic code is nearly ______________ , from bacteria to mammals Thus, we can synthesize bacterial proteins in ______________ Exceptions do exist- they use slightly altered genetic codes: 1.single-celled eukaryotes like Paramecium. 2. certain mitochondria and chloroplast ____________ What actually makes the RNA? Messenger RNA is transcribed from the template strand of a gene by ________________. __________________________ : separates the DNA strands bonds the RNA nucleotides as they base-pair along the DNA template. RNA 5' 3' 3' 5' DNA What marks the start of transcription?? Answer- Specific sequences of nucleotides called the _________ mark where gene transcription begins In prokaryotes, RNA polymerase can recognize and bind ______________ to the promotor region. In eukaryotes, proteins called ___________ first bind the promotor region, especially a __________ , then RNA polymerase II binds Transcript Modification unit of transcription in a DNA strand 3' exon intron exon intron exon 5' transcription into pre-mRNA poly-A tail 3' cap 5' snipped out snipped out 5' mature mRNA transcript 3' 15.3 15.2 15.1 14 13.3 13.2 13.1 12 11 11.1 11.2 12 13.1 13.2 13.3 14 15 Overview of eukaryotic transcription/translation Chromosome- 1.5 x 108 base pairs containing about 3000 genes 21 22 23.1 23.3 31.1 31.2 31.3 32 33.2 33.1 33.3 34 35.2 35.1 35.3 23.2 0.4% of a chromosome, containing 10 genes = exon = intron 5' 3' ATG B C D E F TAA 3' 5' DNA +1 AUG Transcription AAUAAA Template strand hnRNA RNA Splicing UAA polyA tail,cap Transport to cytoplasm AB 7m Regulatory DNA sequences G CD AUG AAAAAA..... UAA E F mRNA Protein NH2 Translation COO- How do proteins read the RNA molecule?? Answer-the ___________________ tRNA _____________ (tRNA) transfers amino acids from the cytoplasm's pool to a ________________. codon in mRNA anticodon in tRNA amino acid tRNA molecule's attachment site for amino acid OH ribosome The ribosome adds each amino acid carried by tRNA to the growing end of the _________________ chain. A tRNA molecule Is about ___ nucleotides long Contains attachment site for an amino acid. Contains a loop with the Fig. 17.13 ___________ The anticodon base-pairs with a complementary codon on mRNA. 3' 5' If the codon on mRNA is UUU, a tRNA with a ______ anticodon and a tRNA carrying phenylalanine will bind to it. Translation Translation can be divided into three ______ 1. initiation 2. _________ 3. termination 1. Initiation a. b. Small ribosomal subunit binds mRNA Initiator tRNA (with methionine) is attached to start codon Fig. 17.17 2. Elongation - Amino acid sequentially added Translation c. Translocation - the ribosome moves the tRNA with the attached polypeptide from the A site to the P site. 3. Translation Termination occurs when ribosome reaches a _____codon. A ____________ binds to the stop codon and hydrolyzes the bond between the polypeptide and its tRNA in the P site. Fig. 17.19 Other translation facts Multiple ribosomes, polyribosomes, may trail along the same _______. A ribosome requires less than a ________ to translate an average-sized mRNA into a polypeptide. Fig. 17.20 Transcription Overview mRNA rRNA tRNA Mature mRNA transcripts ribosomal subunits mature tRNA Translation Point mutations can affect protein structure and function __________ are changes in the genetic material of a cell (or virus). include large-scale mutations in which _____ segments of DNA are affected (translocations, duplications, and inversions). A chemical change in just one base pair of a gene causes a _______________ In sickle cell, a single T to A mutation changes amino acid from glu to val _________ - alterations of nucleotides still indicate the same amino acids because of redundancy in the genetic code. Many other mutations cause no effect in function Other base-pair substitutions cause a readily detectable change in a protein. _______ mutations are those that still code for an amino acid but change the indicated amino acid. _______ mutations change an amino acid codon into a _____ codon, nearly always leading to a nonfunctional protein. Fig. 17.24 Insertions and ______ are additions or losses of nucleotide pairs in a gene. These have a _________ effect on the resulting protein more often than substitutions do. Unless these mutations occur in multiples of ____, they cause a ________ mutation. All the nucleotides downstream of the deletion or insertion will be improperly grouped into codons. The result will be extensive missense, ending sooner or later in nonsense - premature termination. Fig. 17.24 ______________Mutation Really bad!! mRNA PARENTAL DNA amino acid sequence ARGININE GLYCINE TYROSINE TRYPTOPHAN ASPARAGINE altered mRNA BASE INSERTION altered amino acid sequence ARGININE GLYCINE LEUCINE LEUCINE GLUTAMATE __________ are chemical or physical agents that interact with DNA to cause mutations. ________agents include high-energy radiation like Xrays and ultraviolet light. __________ mutagens may operate in several ways. As base ____________ that may be substituted into DNA, but that pair incorrectly during DNA replication. Interfere with DNA replication by inserting into DNA and distorting the ______________. Cause chemical changes in bases that change their pairing properties. TRANSCRIPTION Unwinding of gene regions of a DNA molecule Pre mRNA Transcript Processing mRNA rRNA tRNA protein subunits Mature mRNA transcripts ribosomal subunits mature tRNA TRANSLATION Convergence of RNAs Cytoplasmic pools of amino acids, tRNAs, and ribosomal subunits Synthesis of a polypetide chain at binding sites for mRNA and tRNA on the surface of an intact ribosome FINAL PROTEIN Destined for use in cell or for trasport Fig. 13.14, p. 210

Find millions of documents here - Study Guides, Homework Solutions, Papers, Exam Answer Keys and more. Course Hero has millions of course related materials that will enable you to learn better, faster and get an A in all your courses.
Below is a small sample set of documents: