Documents Found!
As seen in
Less Work, Better Grades
Join
Course Hero
Access
best resources
Ace
your classes
Ace your courses with Course Hero!

Submit your homework question or assignment here:
352 Tutors are online
 
*  Attach Assignment (optional):
 
Study Smarter, Score Higher
 
Document Content (unformatted)
Course Hero has millions of student submitted documents similar to the one below including study guides, homework solutions, papers, exam answer keys and textbook solutions.
DNA From to Proteins DNA makes ____ makes ________. 3' 5' growing RNA transcript Chapter 13 3' 5' direction of transcription Proteins are the links between ___________ and ________________. ___________ and ___________ are the two main processes linking gene to protein The bridge between DNA and ________ synthesis is RNA. RNA differs from DNA 1. RNA contains _____as its sugar (not deoxyribose) 2. _______ replaces thymine. AGTCAT becomes AGUCAU 3. An RNA molecule almost always consists of a This is an H in DNA Fig. 6.8a 4 types of RNA ________ - carries info for protein production _______-transport amino acids in translation _______- part of ribosome, has role in translation ________ - splicing mRNA Chromosome- 1.5 x 108 base pairs containing about 3000 genes 0.4% of a chromosome, containing 10 genes = 1. ________________ ATG B C D E F TAA = 2. ________________ 3' 5' 5' 3' DNA +1 AUG AATAAA 3. _____________ Pre-mRNA UAA 4._________ 5. ______ 7m AB G AUG CD AAAAAA..... UAA E F 6. ____________ 7. ________________ NH2 COO- Protein ____________ - DNA is the template for RNA, usually __________ RNA (mRNA). ____________________ - the information contained in the order of nucleotides in mRNA is used to determine the __________ sequence of a polypeptide. -Translation occurs at ____________. The basic mechanics of transcription and translation are ________ in eukaryotes and prokaryotes. Fig. 17.2a In the genetic code, nucleotide triplets specify amino acids In the __________, three consecutive bases specify an amino acid, creating 43 (64) possible ________. The genetic instructions for a polypeptide chain are written in DNA as a series of three__________words. The genetic code 1. ___ of 64 triplets code for amino acids. o w t !! o w h chart Kno this d rea AUG codes for the methionine and ____ of translation. Three codons ___, ___ and ____ do not code amino acids but signal the termination of translation. 2. The genetic code is __________but not_ _________ . Typically several different codons specify a given amino acid Fig. 17.4 Any one codon indicates _ __________ amino acid. The genetic code (cont.) o w t !! ho art now is ch K th d rea A ______________ is established at the translation start RNA 5' UUACGAUGGAUUCAAACGUCAGGGCCUAAGGCUAG3' Met Asp Ser Asn Val Arg Ala Stop Start codon codon Summary- The genetic code uses_ ____________________, or codons, each of which is translated into a specific amino acid. The genetic code is nearly ______________ , from bacteria to mammals Thus, we can synthesize bacterial proteins in ______________ Exceptions do exist- they use slightly altered genetic codes: 1.single-celled eukaryotes like Paramecium. 2. certain mitochondria and chloroplast ____________ What actually makes the RNA? Messenger RNA is transcribed from the template strand of a gene by ________________. __________________________ : separates the DNA strands bonds the RNA nucleotides as they base-pair along the DNA template. RNA 5' 3' 3' 5' DNA What marks the start of transcription?? Answer- Specific sequences of nucleotides called the _________ mark where gene transcription begins In prokaryotes, RNA polymerase can recognize and bind ______________ to the promotor region. In eukaryotes, proteins called ___________ first bind the promotor region, especially a __________ , then RNA polymerase II binds Transcript Modification unit of transcription in a DNA strand 3' exon intron exon intron exon 5' transcription into pre-mRNA poly-A tail 3' cap 5' snipped out snipped out 5' mature mRNA transcript 3' 15.3 15.2 15.1 14 13.3 13.2 13.1 12 11 11.1 11.2 12 13.1 13.2 13.3 14 15 Overview of eukaryotic transcription/translation Chromosome- 1.5 x 108 base pairs containing about 3000 genes 21 22 23.1 23.3 31.1 31.2 31.3 32 33.2 33.1 33.3 34 35.2 35.1 35.3 23.2 0.4% of a chromosome, containing 10 genes = exon = intron 5' 3' ATG B C D E F TAA 3' 5' DNA +1 AUG Transcription AAUAAA Template strand hnRNA RNA Splicing UAA polyA tail,cap Transport to cytoplasm AB 7m Regulatory DNA sequences G CD AUG AAAAAA..... UAA E F mRNA Protein NH2 Translation COO- How do proteins read the RNA molecule?? Answer-the ___________________ tRNA _____________ (tRNA) transfers amino acids from the cytoplasm's pool to a ________________. codon in mRNA anticodon in tRNA amino acid tRNA molecule's attachment site for amino acid OH ribosome The ribosome adds each amino acid carried by tRNA to the growing end of the _________________ chain. A tRNA molecule Is about ___ nucleotides long Contains attachment site for an amino acid. Contains a loop with the Fig. 17.13 ___________ The anticodon base-pairs with a complementary codon on mRNA. 3' 5' If the codon on mRNA is UUU, a tRNA with a ______ anticodon and a tRNA carrying phenylalanine will bind to it. Translation Translation can be divided into three ______ 1. initiation 2. _________ 3. termination 1. Initiation a. b. Small ribosomal subunit binds mRNA Initiator tRNA (with methionine) is attached to start codon Fig. 17.17 2. Elongation - Amino acid sequentially added Translation c. Translocation - the ribosome moves the tRNA with the attached polypeptide from the A site to the P site. 3. Translation Termination occurs when ribosome reaches a _____codon. A ____________ binds to the stop codon and hydrolyzes the bond between the polypeptide and its tRNA in the P site. Fig. 17.19 Other translation facts Multiple ribosomes, polyribosomes, may trail along the same _______. A ribosome requires less than a ________ to translate an average-sized mRNA into a polypeptide. Fig. 17.20 Transcription Overview mRNA rRNA tRNA Mature mRNA transcripts ribosomal subunits mature tRNA Translation Point mutations can affect protein structure and function __________ are changes in the genetic material of a cell (or virus). include large-scale mutations in which _____ segments of DNA are affected (translocations, duplications, and inversions). A chemical change in just one base pair of a gene causes a _______________ In sickle cell, a single T to A mutation changes amino acid from glu to val _________ - alterations of nucleotides still indicate the same amino acids because of redundancy in the genetic code. Many other mutations cause no effect in function Other base-pair substitutions cause a readily detectable change in a protein. _______ mutations are those that still code for an amino acid but change the indicated amino acid. _______ mutations change an amino acid codon into a _____ codon, nearly always leading to a nonfunctional protein. Fig. 17.24 Insertions and ______ are additions or losses of nucleotide pairs in a gene. These have a _________ effect on the resulting protein more often than substitutions do. Unless these mutations occur in multiples of ____, they cause a ________ mutation. All the nucleotides downstream of the deletion or insertion will be improperly grouped into codons. The result will be extensive missense, ending sooner or later in nonsense - premature termination. Fig. 17.24 ______________Mutation Really bad!! mRNA PARENTAL DNA amino acid sequence ARGININE GLYCINE TYROSINE TRYPTOPHAN ASPARAGINE altered mRNA BASE INSERTION altered amino acid sequence ARGININE GLYCINE LEUCINE LEUCINE GLUTAMATE __________ are chemical or physical agents that interact with DNA to cause mutations. ________agents include high-energy radiation like Xrays and ultraviolet light. __________ mutagens may operate in several ways. As base ____________ that may be substituted into DNA, but that pair incorrectly during DNA replication. Interfere with DNA replication by inserting into DNA and distorting the ______________. Cause chemical changes in bases that change their pairing properties. TRANSCRIPTION Unwinding of gene regions of a DNA molecule Pre mRNA Transcript Processing mRNA rRNA tRNA protein subunits Mature mRNA transcripts ribosomal subunits mature tRNA TRANSLATION Convergence of RNAs Cytoplasmic pools of amino acids, tRNAs, and ribosomal subunits Synthesis of a polypetide chain at binding sites for mRNA and tRNA on the surface of an intact ribosome FINAL PROTEIN Destined for use in cell or for trasport Fig. 13.14, p. 210
Find millions of documents here - Study Guides, Homework Solutions, Papers, Exam Answer Keys and more. Course Hero has millions of course related materials that will enable you to learn better, faster and get an A in all your courses.
Below is a small sample set of documents:

N.E. Illinois >> BIO >> 1001 (Fall, 2009)
Chapter 14 Control Over Genes All cells contain all _. .yet a given cell only expresses _ of it\'s genes. During development, cells _ and _ other genes in selective ways How does the cell know which genes to turn on and which to turn off? Part of the...
N.E. Illinois >> BIO >> 1001 (Fall, 2009)
Natural selection and evolution Chapter 16-17 On November 24, 1859, _ published On the Origin of Species by Means of Natural Selection. Two major points: Today\'s organisms descended from _. _ provided a mechanism for evolutionary change in popu...
N.E. Illinois >> BIO >> 1001 (Fall, 2009)
Ground Rules of Metabolism Free radical A highly reactive molecule that has _ electrons Can disrupt _ of molecules Chapter 5 _ _ ROS= Reactive oxygen intermediate 2H+ + 2O- ->Hydrogen H 2O 2 peroxide 2H2O2 --> 2H2O + O2 _ Roundworm Experiments...
N.E. Illinois >> BIO >> 1001 (Fall, 2009)
How Cells Release Stored Energy Chapter 7 \"Killer\" Bees- Aggressive descendents of African honeybees that were imported to Brazil in the 1950s Africanized bee\'s muscle cells have enlarged _ ATP Is _ Energy Source Photosynthesizers get energy from...
N.E. Illinois >> BIO >> 1001 (Fall, 2009)
Meiosis A. Reproduction 1. _ Chapter 9 Male reaches under his mantle with tentacle, removes packet of sperm, and insert it into female\'s egg chamber 2. _ Larva can become adult of either sex Depends on conditions 3. _ Females in summer (from unf...
N.E. Illinois >> BIO >> 1001 (Fall, 2009)
QUIZ Name_ Meiosis 1. End result 1n or 2n? Mitosis 2. Daughter cells Distinct or identical? 3. Chiasmata? Yes or no? 4. # of divisions 5. Purpose Growth or germ cells? QUIZ Name_ Meiosis 1. End result 1n or 2n? Mitosis 2n identical No 1 Gro...
N.E. Illinois >> BIO >> 1001 (Fall, 2009)
Environment-induced disruptions in meiosis Chromosome number error (aneuploidy) rose from 1-2% to 40% in mouse eggs! Reason- bisphenol A (BPA), a component of plastic. . results in meiosis errors in mouse eggs Meiosis normal BPA treated Science 300:...
N.E. Illinois >> BIO >> 1001 (Fall, 2009)
Course Grades for Dr. Bulla\'s Bio1001 class, Summer 2004 If you have questions or see discrepancies, please notify me (e-mail: cfgab@eiu.edu ) before Monday so that I make the appropriate changes. Have a great remainder of your summer. Also, someone ...
N.E. Illinois >> BIO >> 1001 (Fall, 2009)
How Cells Acquire Energy Chapter 6 Carbon and Energy Sources _Plants, some bacteria, many protistans Carbon source is _ Energy source is _ _ Get carbon and energy by eating _ or __ T.E. Englemann\'s Experiment Background Certain bacterial cel...
Kentucky >> EPE >> 773 (Fall, 2008)
<HTML> <HEAD> </HEAD> <BODY> <H2>EPE 773 SEM: Rating Scale and Questionnaire Analysis</H2> <UL> <LI><a href=\"Syllabus.doc\" target=\"new\">Syllabus</a> </UL> <H3>Handouts</H3> <UL> <LI><a href=\"Handouts/InfoSheet.doc\" target=\"new\">Student...
Kentucky >> EPE >> 773 (Fall, 2008)
EPE 773: RATING SCALE AND QUESTIONNAIRE ANALYSIS Call # 06844 CONTACT INFORMATION Shannon Sampson, Ph.D. Kelly Bradley, Ph.D. Office: 145 - C Taylor Education Building Phone: 257 2628 Email: shannon.sampson@uky.edu Office Hours: Tues/Th 11-12, Tues ...
Kentucky >> EPE >> 773 (Fall, 2008)
Survey Design Rubric Directions: Using your pre-approved topic, you are to write a design plan for your survey. The write-up should address areas scored via the rubric, but it should be in the format of a proposal (specific to a methodology section)....
Kentucky >> EPE >> 773 (Fall, 2008)
Name _ EPE 773: Survey Research Final Exam Analyzing Student Evaluation Data Directions: Using the Evaluation Data provided (in an Excel Worksheet), answer the following questions. You may use the software package of your choice to conduct analyses. ...
Kentucky >> EPE >> 773 (Fall, 2008)
Survey Critique Rubric Directions: Using the AAEE Educator Supply and Demand Survey (with cover sheet) and background information, respond to the questions below. Responses should be typed and 12 point font. Point values for each question are provide...
Kentucky >> EPE >> 773 (Fall, 2008)
Manuscript Peer Review 1 Name of Reviewer: _ Title of Manuscript: _ Author of Manuscript: _ For the peer review, provide your partner with feedback on his/her manuscript draft by writing comments in the space provided. Be as specific as possible and ...
Kentucky >> EPE >> 773 (Fall, 2008)
Manuscript Rubric Exemplary (4) Problem is clearly stated, includes specific details about response frame, procedures and methods. Major results and conclusions are sufficiently stated. The introduction clearly outlines the purpose of the paper and h...
Kentucky >> EPE >> 773 (Fall, 2008)
Manuscript Rubric Name of Reviewer: _ Title of Manuscript: _ Author of Manuscript: _ For the peer review, provide your partner with feedback on his/her manuscript draft by annotating his/her draft and writing comments in the space provided below. Be ...
Kentucky >> EPE >> 773 (Fall, 2008)
Background on AAEE Survey For more than a quarter of a century the American Association of Employment in Education (AAEE) has conducted an annual survey of institutions preparing teachers. Originally, AAEE surveyed only those teacher preparation prog...
Kentucky >> EPE >> 773 (Fall, 2008)
2003 EXECUTIVE SUMMARY Educator Supply and Demand in the United States Highlights The job market for educators peaked in 2001, softened in 2002, and continued to soften in 2003. Regional and subject variations from this trend were also reported. Of ...
Kentucky >> EPE >> 773 (Fall, 2008)
Student Evaluation of Faculty Please use the following scale: 4 = Always / Almost Always 3 = Usually 2 = Some of the Time 1 = Never / Almost Never If a statement does not apply, please leave it blank. 1) The professor demonstrated knowledge of the su...
Kentucky >> EPE >> 773 (Fall, 2008)
American Association for Employment in Education, Inc. 3040 Riverside Dr., Suite 125 Columbus, OH 43221-2550 Phone (614) 485-1111 Fax (614) 485-9609 Educator Supply and Demand Survey For the 27 th Annual Report TO: Directors of Career Services and...
Kentucky >> EPE >> 773 (Fall, 2008)
Additional Questions or Reflections? 1) Tacit Knowledge of Superintendents; Chris 1) Traditional Religious Principles and Objectives; Gill 1) AAEE (Teacher Supply and Demand) Survey; Jessica 1) Black University Students\' Perceptions of Marriage; Bill...
Kentucky >> EPE >> 773 (Fall, 2008)
Item Analysis: Classical and Beyond SCROLLA Symposium Measurement Theory and Item Analysis Modified for EPE 773 by Kelly Bradley on September 3, 2006 Why is item analysis relevant? Item analysis provides a way of measuring the quality of questions ...
Kentucky >> EPE >> 773 (Fall, 2008)
Student Information Sheet 1. Name: _ 2. Address: _ 3. Phone: _ 4. E-mail: _ 5. Present Department Position: 7. Undergraduate School Major): 9. What othe...
Kentucky >> EPE >> 773 (Fall, 2008)
Rasch at a Glance 1. To check if my data adequately fit the model: 2. To check for unidimensionality: 3. To check that item measures are invariant for two groups within the sample: 244-7325 allison 4. To talk about a particular person measure and...
Kentucky >> EPE >> 773 (Fall, 2008)
E-Listen Sessions March 1st Gera Kevin Amanda Tom March 8th Derita Joe Marci Kenny March 22nd Ruth George Hannah ...
Kentucky >> EPE >> 773 (Fall, 2008)
Student Information Sheet EPE 773: Survey Research 1. Name: _ 2. Address: _ 3. Phone: __ 4. E-mail: _ 5. Present Department Position: 7. Undergraduate School & Major: 8. Previous Graduate Study (Scho...
Kentucky >> EPE >> 773 (Fall, 2008)
If you are a student interested in Survey Methodology, please read on (if you are faculty, please pass this on to your students). A small group of us in Michigan thought it would be a good idea to start a listserv for students in survey methodology. ...
Kentucky >> EPE >> 773 (Fall, 2008)
Why We Do Research Chapter 1 Ordinary Versus Systematic Biased Question: A question that leads to a specific response or excludes a certain group Nonscientific thinking leads to asking questions that are slanted in a particular direction Limi...
Kentucky >> EPE >> 773 (Fall, 2008)
Chapter 2 Finding Ideas to Research Generating Topics Translate ideas into valid and reliable ways of measuring them Collect evidence Unique Topics Innovative but Difficult Reliability and Validity The collecting of data (me...
Kentucky >> EPE >> 773 (Fall, 2008)
EPE 773: Survey Research Dr. Kelly Bradley Introductions Name Major and Advisor Why are you here? Fun fact Introduction to Survey Research Survey research is the most popular and common research method used in social...
Kentucky >> EPE >> 773 (Fall, 2008)
<?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>InternalError</Code><Message>We encountered an internal error. Please try again.</Message><RequestId>99D5A9BB486A9E4D</RequestId><HostId>RVZvGMEGGqSgVUReFLaT BR6cqozOtfYsyUzp2zxVHfkaDVzJB2WkbydVaui8...
Santa Clara >> COEN >> 120 (Fall, 2009)
Group7ATMmachi ne Report on Configuration DefaultConfig PACKAGES ATMmachine TYPES AccountInfo A new structure that includes the information about the current costumers account. Can be made arrays later if need to add more accounts for each customer ...
Santa Clara >> COEN >> 120 (Fall, 2009)
Im in the constructor of the long term scheduler LTS has started In the LTS key:= 2 SHould be here is it me or what? ...
Iowa State >> MGMT >> 471 (Spring, 2008)
Organizing for Change How easy is implementing change management models? x What is the success rate of change initiatives? x Can change be managed? x Should change be initiated and managed? x To reach diversity maturity, what are we changing? x Orga...
Stanford >> CS >> 359 (Fall, 2009)
%!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: ready.dvi %Pages: 6 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentPaperSizes: a4 %EndComments %DVIPSCommandLine: dvips ready -o %DVIPSParameters: dpi=300,...
Stanford >> CS >> 359 (Fall, 2009)
%!PS-Adobe-2.0 %Creator: dvips 5.495 Copyright 1986, 1992 Radical Eye Software %Title: techreport.dvi %CreationDate: Tue Feb 16 10:38:43 1993 %Pages: 14 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSCommandLine: dvips techreport %DV...
Stanford >> CS >> 359 (Fall, 2009)
%!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: pap.dvi %Pages: 17 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips pap.dvi -o pap.ps %DVIPSParameters: dpi=300, compressed, com...
Stanford >> CS >> 359 (Fall, 2009)
%!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: bds01.dvi %Pages: 14 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips -o bds01.ps bds01.dvi %DVIPSPa...
Stanford >> CS >> 359 (Fall, 2009)
%!PS-Adobe-2.0 %Creator: dvips 5.76 Copyright 1997 Radical Eye Software (www.radicaleye.com) %Title: cav99.dvi %CreationDate: Tue Mar 16 18:48:18 1999 %Pages: 12 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips cav99...
Stanford >> CS >> 359 (Fall, 2009)
%!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: paper.dvi %Pages: 13 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Bold Times-Roman Courier Times-Italic %DocumentPaperSizes: Letter %EndComm...
Stanford >> CS >> 359 (Fall, 2009)
%!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: pap.dvi %Pages: 93 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips pap.dvi -o pap.ps %DVIPSParam...
Stanford >> CS >> 359 (Fall, 2009)
%!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: Ringeissen-FroCos.dvi %Pages: 18 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSCommandLine: dvips -o Ringeissen-FroCos.ps Ringeissen-FroCos.dvi ...
Drexel >> MATH >> 641 (Fall, 2009)
WA 5: Solutions Problem 1. Let f (x) = e-x for x 0, f (x) = 0 for x < 0. Write f1 = f and fn = fn-1 f (n 2). (a) Find fn explicitly for all n 1. ^ ^ (b) Verify by direct computation that fn () = f ()n for all R, n 1. Solution. (a) First, let u...
Drexel >> MATH >> 633 (Fall, 2009)
Homework 3: Solutions 1. Problem 13, page 64. (a) (i) = (ii). It follows from the definition of outer measure that for any > 0 there is a union of open intervals (which is an open set), O = I E such that m O m E > l(I ) - . Since l(I ) m I ...
Drexel >> MATH >> 641 (Fall, 2009)
WA 3: Solutions Problem 1. Everybody has solved this problem correctly. Problem 2: Solution. (a) One can consider the interval [2k, 2(k + 1)] with the identified end points 2k = 2(k + 1) as a circle T. Then the function f on T is continuously differe...
Stanford >> CS >> 359 (Fall, 2009)
%!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: article.dvi %Pages: 16 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips article %DVIPSParameters: dpi=300, compressed, comments ...
Berkeley >> EECS >> 797 (Fall, 2009)
Cadence Innovation Model Ted Vucurevich Sr. VP, Office of the CTO Cadence Design Systems 1 CADENCE DESIGN SYSTEMS, INC. Innovation Process Technology Development Process Invention Development Productization Refinement Product Development Proce...
Iowa State >> NR >> 45342 (Fall, 2009)
September, 2006 Greetings, When it\'s harvest time, the pressure is on. Good weather and daylight hours always seem to be at a premium. Harvest can be a dangerous season. National Farm Safety & Health Week is September 17-23 and serves to remind us th...
Wisconsin >> CHEM >> 343 (Fall, 2008)
Name Chem 343 Reich Quiz 11A April 17, 2009 2 1. Show how you would accomplish the following synthesis. Include all isolated intermediate compounds and reagents over the arrows. OH OH 3 2. Give the major product(s) of the following reactions sho...
Texas A&M >> STAT >> 303 (Fall, 2008)
Syllabus Statistics 303 Section 201, Summer II 2008 Monday through Friday 8:00 - 9:35am Monday Wednesday Friday in HECC 204 Tuesday Thursday (Lab) in Blocker 161 Instructor: Scott Crawford, BLOC 405B, e-mail: sdc.stats@gmail.com Office Hours: Everyda...
Texas A&M >> STAT >> 303 (Fall, 2008)
Statistics 303 Test 1 1) a) Discrete b) Continuous c) Categorical Please write legibly Name _ For each variable decide which type describes it best _ The number of Terrorists in a country _ The Brand of Jeans worn at high school _ The GPA of a Te...
Texas A&M >> STAT >> 303 (Fall, 2008)
1) A, C, A or B, B 6) 31/96 7) D 2) Barchart and Pie-chart 3) B 4) A 5) 43/96 8) For the bird, Z=(6.6-10)/sqrt(4) = -1.7 For the dog, Z=(113-130)/sqrt(100) = -1.7 Both are the same size for their type 9) (148-160)/sqrt(144) = -1 (184-160)/sqrt(1...
Texas A&M >> STAT >> 303 (Fall, 2008)
1) Brandon wants to find a cheap computer, but he knows that computer prices are extremely skewed, since most computers are very expensive. He knows that computer prices have a mean of $1,700 with a standard deviation of $1000. Brandon finds the aver...
Texas A&M >> STAT >> 303 (Fall, 2008)
1) Correct answer: I don\'t know. You can\'t use the CLT, because n is less than 30. The distribution wasn\'t normal beforehand, so we cannot find any probabilities with our tools. 2) P(losing)= P(rolling 7 OR rolling 11) = P(rolling 7) + P(rolling 11) ...
Texas A&M >> STAT >> 303 (Fall, 2008)
Statistics 303 Test 2 NAME: _ Even though this is not a math test, you will need to be Able to calculate Z-scores, and confidence intervals. If you do not have a calculator raise your hand and one Will be provided as soon as possible. Do not leave yo...
Texas A&M >> STAT >> 303 (Fall, 2008)
1) (9 points) _X_ Ashley is 95% confident that her interval captures the true proportion _X_ If Ashley made infinitely many intervals, then 95% of them would capture the true proportion 2) (8 points) Sd(X) = SQRT( Var(X) ) Var(X) = E(X2) [E(x)]2 E(x...
Texas A&M >> STAT >> 303 (Fall, 2008)
Sample 1 Sample 2 Sample 3 Sample 4 Sample 5 Sample 6 Sample 7 Sample 8 Sample 9 Person 1 Person 2 Person 3 Person 4 Person 5 Person 6 Person 7 Person 8 Person 9 Person 10 Person 11 Person 12 Person 13 Person 14 Person 15 Person 16 Person 17 Person 1...
Texas A&M >> STAT >> 303 (Fall, 2008)
Example of Each of the Four Procedures Covered in Chapter 7 EXAMPLE 1 One Sample t Test A drug company is manufacturing a new drug. In order to not be considered toxic, the new drug cannot have more than 16.1 mg of the dangerous Substance X. The d...
Texas A&M >> STAT >> 303 (Fall, 2008)
Statistics 303 Practice Exam 3 (2 minutes) Which of the following tests would be the most powerful? (assuming everything else about the tests is the same) A: n=100 =.05 B: n=100 =.01 C: n=1000 =.05 D: n=1000 =.01 E: These tests have the same power F:...
Texas A&M >> STAT >> 303 (Fall, 2008)
2 Table df degrees of freedom for 2 curve P area under the 2 curve with df degrees of freedom to the right 0.25 df 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 40 50 60 80 100 1.32 2.77 4.11 5.39 6.63 7.84 9.04 10....
Texas A&M >> STAT >> 303 (Fall, 2008)
Name ID HW 1 HW 2 HW 3 HW 4 HW 5 HW 6 HW 7 HW 8 HW 9 HW 10 Lab 1 Lab 2 65 58 50 64 37 51 73 61 77 65 34 26 0 0 0 0 0 0 0 0 0 0 0 0 Student T 123456789 Lab 3 Lab 4 Lab 5 Lab 6A Lab 6B Lab 7 Lab 9 Lab 10 Quiz 1 Quiz 2 Quiz 3 Quiz 4 Quiz 5 Quiz 6 10...
Berkeley >> E >> 140 (Fall, 2009)
\'HSDUWPHQWRI(FRQRPLFV 8QLYHUVLW\\RIRPSXWHU/DE7ROPDQ0LFURFRPSXWHU)DFLOLW\\70)7ROPDQ0RQGD\\VDP SP3OHDVHQRWHWKDWWKHUHLVDFODVVDFFRXQWORJLQHFRQSD...
Rose-Hulman >> CSSE >> 432 (Fall, 2009)
Day 01 Introduction to C 1 Why learn C (after Java)? Both high-level and low-level language high level low level Better control of low-level mechanisms Performance better than Java But,. Memory management responsibility Explicit initialization and ...
Rose-Hulman >> CSSE >> 432 (Fall, 2009)
Building an Internet Router 06/15/09 Overview Introduction Requirements Implementing Details Coding Tips Reference Introduction Implement a fully functional internet router. Route real packets. Virtual Network System (VNS) Each o...
Rose-Hulman >> CSSE >> 432 (Fall, 2009)
Day 01 Introduction to C 1 Why learn C (after Java)? Both high-level and low-level language Better control of low-level mechanisms Performance better than Java But,. Memory management responsibility Explicit initialization and error detection ...
Rose-Hulman >> CSSE >> 432 (Fall, 2009)
Tutorial adapted from http:/www.eng.hawaii.edu/Tutor/Make/ and http:/www.cs.bgu.ac.il/~sadetsky/openu/myMakeTutor ial.txt Makefiles Compiling a single program Compiling multiple related files gcc green.c blue.c OR gcc o program1...
UMass (Amherst) >> SOM >> 833 (Fall, 2009)
...
UMass (Amherst) >> SOM >> 833 (Fall, 2009)
...
UMass (Amherst) >> SOM >> 833 (Fall, 2009)
...
What are you waiting for?