2 Pages

gf

Course: BIO 202, Spring 2006
School: New Mexico
Rating:
 
 
 
 
 

Word Count: 461

Document Preview

yadeeh Hi I have a few questions regarding howe's review. i attached it as a word document so its easier to understand. thanks #7 Which amino acid would you expect a tRNA with the anticodon 5' CUU 3' to carry? a. Lysine (Lys) b. Glutamate (Glu) c. Glutamine (Gln) d. Leucine (Leu) e. Phenylalanine (Phe) lysine is 3'gaa5', so basically, the codon is read in 5' to 3' by anticodon? 8. A poison added to an experimental...

Register Now

Unformatted Document Excerpt

Coursehero >> New Mexico >> New Mexico >> BIO 202

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
yadeeh Hi I have a few questions regarding howe's review. i attached it as a word document so its easier to understand. thanks #7 Which amino acid would you expect a tRNA with the anticodon 5' CUU 3' to carry? a. Lysine (Lys) b. Glutamate (Glu) c. Glutamine (Gln) d. Leucine (Leu) e. Phenylalanine (Phe) lysine is 3'gaa5', so basically, the codon is read in 5' to 3' by anticodon? 8. A poison added to an experimental translation mixture containing mRNA molecules with the sequence 5' AUGAAAUAUCAAAAUGUA 3' has the following effect: the only product made is a Met-Lys dipeptide that remains attached to the ribosome. What is the most likely way in which the poison acts to inhibit protein synthesis? a. It inhibits binding of the small subunit of the ribosome to mRNA. b. It inhibits peptide bond formation. c. It inhibits movement of the ribosome. d. It inhibits release factors. e. It mimics release factors. Why does the translation randomly stop in lys? 9. Which of the following mistakes could be passed on to new cells of an organism? a. An error made in the synthesis of a polypeptide. b. An error made in the transcription of a molecule of mRNA. c. An error made in replication. Why is it not a and b? is it because neither of these are passed on from one cell to another in mitosis/meiosis? 18. A tRNA carrying the anticodon 3' GAU 5' could pair with which one of the codons? following a. 5' CUG 3' b. 5' CUC 3' c. 5' CUU 3' d. 5' UUA 3' e. none of the above why is it 5'cug3' instead of 5'cua 3'? 2. __F__ The number of kinds of tRNA molecules found in prokaryotes and eukaryotes is equal to the number of different types of amino acids. THERE ARE BETWEEN 20 AND 64, DEPENDING ON THE ORGANISM. Why is it false? I thought it was equal to the number of amino acids? I also have a question on this last one. This one is a little longer and more complicated, so if you don't have time to help me with this one, I will try to come to your office hours. 3. Use the eukaryotic double-stranded DNA gene sequence attached as the last page of this exam to answer the following questions: 5'AAGCTCGATTTATTCATGGCTAGTTCAGCATCGTAAGGCACGGAGGCTCGATTCGGATCGATTTTATAGCGAAT 3' 3'TTCGAGCTAAATAAGGTACCTATCAAGTCGTAGCATCCGTGCCTCCGAGCTAAGCCTAGCTAAAATATCGCTTA 5' a. Write out the mRNA sequence transcribed from this gene (give the polarity of the molecule). You will not be penalized if your transcription start site varies by one or two nucleotides. Continue transcription until 5 nucleotides past the end of the transcription termination site. 4 pts 5' CUUACGAUGCUGAACUAGUCCAUGGAAUAAAUCGAG3' start stop txn termination b. What is the corresponding amino acid sequence translated from this mRNA sequence? (Don't forget polarity) 4 pts NH2 met-leu-asn - COOH
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

New Mexico - BIO - 201
Biology 201. Homework for chapter 9 1. Carefully define what is meant by oxidation and reduction. What is meant when we say that in biological systems, these two processes happen at the same time, and will not occur independently? If a molecule (mole
New Mexico - BIO - 201
Biology 201. Homework on Chapter 9 1. Describe what happens to pyruvate if sufficient oxygen is present. 2. in step 6 of the citric acid cycle, succinate is converted to fumarate. The reaction is coupled to the conversion of FAD to FADH2. Would succi
New Mexico - BIO - 201
1. A particular plant has chlorophyll a & b, but no other photo pigments. How will this affect the wavelengths of lights under which it can be successfully grown? Chlorophyll a and b have different wavelength absorptions, chlorophyll a absorbs best a
New Mexico - BIO - 201
1. A particular plant has chlorophyll a & b, but no other photo pigments. How will this affect the wavelengths of lights under which it can be successfully grown? Chlorophyll a and b have different wavelength absorptions, chlorophyll a absorbs best a
New Mexico - BIO - 201
Biology 202 Spring 2005 Exam 1NAME: SECTION:MATCHING: Match the definition with the correct term. No answer will be used twice. 2 pts 1. _ A cell containing two sets of nuclear chromosomes (2n). 2. _ The enzyme that lengthens the ends of chromoso
New Mexico - BIO - 202
Biology 202 Spring 2005 Exam 1NAME: SECTION:MATCHING: Match the definition with the correct term. No answer will be used twice. 2 pts 1. _C_ A cell containing two sets of nuclear chromosomes (2n). 2. _O_ The enzyme that lengthens the ends of chro
New Mexico - BIO - 202
Biology 202 Fall 2006 Exam 1 MATCHING: Match the definition with the correct term. 2 pts 1. _ A term applied to an gene that produces a range of phenotypes in individuals of the same genotype 2. _ Allele interaction in which the heterozygote displays
New Mexico - BIO - 202
Biology 202 Exam 3 Fall 2006 MATCHING: Match the definition with the correct term. 2 pts 1. _D_ Describes gene expression in which genes are being transcribed all the time 2. _R_ Transfer of DNA between bacterial cells that is mediated by a virus 3.
New Mexico - BIO - 202
Biology 202 NAME: Fall 2007 T.A.: Homework 1 Discussion Section #: Due: August 30 or 31 in discussion 1 (2 pts). Ferns have both a haploid- and a diploid-dominant stage in their life cycle. Early in the life cycle, all the cells in the prothallus (th
New Mexico - BIO - 202
Biology 202 NAME: Fall 2007 T.A.: Homework 2 Discussion Section #: Due: September 6 or 8 in discussion 1. (2.5 pts) The following events, steps, or reactions occur during E. coli replication. For each entry in Column A, select the appropriate entry i
New Mexico - BIO - 202
Biology 202 Fall 2007 Homework 4 Due: September 20 or 21NAME: T.A.: Discussion Section #:1. (2 points) Many effective antibiotics affect bacteria by inhibiting translation. The experimental use of antibiotics has also been useful in determining t
New Mexico - BIO - 202
Biology 202 Fall 2007 Homework 5 Due: September 27 or 28NAME: T.A.: Discussion Section #:1. (3 pts) In cattle, the polled (hornless) condition is dominant over the horned phenotype. A particular polled bull is bred to three cows. Cow A, which is
New Mexico - BIO - 202
Biology 202 Fall 2007 Homework 6 Due: October 4 or 5NAME: T.A.: Discussion Section #:1. (2 pts) In humans, the three alleles IA, IB, and i constitute a multiple allele series that determines the ABO blood system. For the following problems, state
New Mexico - BIO - 202
Homework 10 1. What would be the result of an inactivation in the lactose operon by mutation of the following genes or sites: lacI, operator, promoter, lacZ and lacY? Would the cell be able to utilize lactose as a sole carbon source? -A mutation in t
New Mexico - BIO - 202
Homework 11 1. (3 pts) In Drosophila, mutations at four genes known as the male-specific lethals (msl) cause male-specific lethality during the larval stages. Analysis has shown that malespecific lethality is caused by defects in the process of dosag
New Mexico - BIO - 202
Homework 12 1. (2 pts) You have received a cloned DNA segment (in a plasmid) and determined that the insert is 1300 base pairs (bp) long. Using the restriction enzymes DpnII and HaeIII, followed by gel electrophoresis, you determine the sizes of frag
New Mexico - BIO - 202
Biology 202 NAME: Fall 2007 T.A.: Homework 7 Discussion Section #: Due: Monday, October 22, by 5pm Turn in to T.A. mailbox 1. (2 pts) In chickens, a dominant sex-linked allele (B) produces barred feathers, and the recessive allele (b), when homozygo
New Mexico - BIO - 202
Biology 202 NAME: Fall 2007 T.A.: Homework 8 Discussion Section #: Due: Monday, October 29, by 5pm Turn in to T.A. mailbox 1. (3 pts) The human human pedigree on the next page shows people affected with the rare nail-patella syndrome (misshapen nail
New Mexico - BIO - 202
Biology 202 Fall 2007 Homework 9 Due: November 1st or 2ndNAME: Gaby morales T.A.: yadeeh escobedo Discussion Section #:91. (2 pts) You are given a strR (streptomycin resistant) Hfr strain and an ampR (ampicillin resistant) F strain. Even when the
New Mexico - BIO - 202
lac operon1. Hello! Sorry to hear about your kid. I was looking through the outlines and there were a few answers i couldnt find in the book or in our notes. I couldn't find info on the questions from study guide 11 about antibodies *I didn't talk
New Mexico - BIO - 202
Exam 3 Study Guide Linked genes genes on the same chromosome pair Linked genes violate independent assortment because they are not equally represented or chanced during meiosis. Cis arrangement parental type is PT and pt, recombinant is Pt and pT
New Mexico - BIO - 202
Bio 203L Homework 6: Ecology 1 (H6-10 points) Due Next Week (Mar 31st-Apr 4th, 2008)Spring 2008Section 1 (2 pts.): Locate two scientific journal articles that you expect to use for your Lemna/Salvinia project. You will then generate an annotated
New Mexico - BIO - 203
SI Work sheet # 6 Multiple Choice. 1. Choose the correct statements. a) Natural selection alone built the dog specific psychology of knowing when to avoid human beings. b) Artificial selection was the proximate of cause of a dog's ability to seek she
New Mexico - BIO - 203
1)Which statements are true regarding the good-of-the-species fallacy? a. It states that natural selection disfavors what is bad for the species. b. The good-of-the species is a great way to understand evolution. c. States what is seen in nature is
New Mexico - BIO - 203
1) Spiny lobsters spend the day hiding in cracks or holes in coral reefs. At night, they emerge and wander away from the reef in search of clams, muscles, or other sources of food. Before dawn, they use one of several dens they use on a regular basis
New Mexico - BIO - 203
SI worksheet # 4 Bio 203 Evolution Multiple Choice 1. Which of the following statements are true? a) Taxonomy is just another name for systematics. b) Taxonomy is the same as phylogeny c) Taxonomy reflects phylogeny d) Taxonomy is the classification
New Mexico - BIO - 203
SI Worksheet #5 Multiple Choice. 1. Which of the following statements are true? a) Darwin's Theory of life's history started becoming accepted in 1959. b) Darwin wrote his book The Origin of Species in 1859. c) Darwin states that life's history on ea
New Mexico - BIO - 203
Bio 203 SI worksheet #7 Multiple Choice. 1. Choose the correct statements. a) Fitness in biology is an individual's design for reproductive success. b) Big, symmetric peacock's tail is an example of high fitness. c) Small magnitude of gynoid fat in f
New Mexico - MATH - 181
Math 181, CALCULUS 2-Spring 2008Instructor: Office Hours: Calculator: TI83 Plus, or equivalent Office : Phone Number: Email:Text: Calculus and Its Applications, 11th Edition, by Goldstein, Lay, et al.Please note the following guidelines for the c
New Mexico - MUS - 139
Jounod in romantic. joined bach's chords from prelude and instead of playing one at a time played all notes together Countertenor higher than tenor. Tenor<baritone<bass Soprano is higher than alto Beginning of baroque we started having opera; Chinese
New Mexico - MUS - 139
MUS 139 Fall 2007 Exam 2 Review The exam will be multiple choice (please bring a pencil). The only dates you need to know are for the musical periods covered since exam 1: Baroque (1600-1750) Classical (1750-1825) Listening Examples: Be able to ident
New Mexico - MUS - 139
MUS 139.001 Fall 2007 Exam 3 Review Exam 3: December 12, 10:00 The exam will be multiple choice (please bring a pencil). The only dates you need to know are for the musical periods: Middle Ages (500-1450) Renaissance (1450-1600) Baroque (1600-1750) C
New Mexico - MUS - 139
10/23/2007 4:33:00 PM15 October, 2007 Hyden was the first true classical composer Beethoven is considered to be part of the classical period and beginning of the romantic Hyden o Most of his career was under a prince (Esterase (sp?) London Symphani
New Mexico - MUS - 139
24 September 2007 Baroque Freedom of expression Emotionality Exaggeration Extravagance o Lead to the development of theatrics Renaissance vs Baroque o Renaissance Voice ideal Voices used in ensembles A copella Natural, simple musical ideas Irreg
New Mexico - CHEM - 301
New Mexico - CHEM - 301
New Mexico - CHEM - 301
New Mexico - CHEM - 301
New Mexico - CHEM - 301
New Mexico - CHEM - 301
New Mexico - CHEM - 301
Name THIRD HOUR TESTKEY1. (21, 7 each) In the spaces provided below, give the correct IUPAC names for the compounds having each of the following structures.a. 7-chloro-3-cyano-5-cyclopentyl-2-ethoxy-6-oxohept-3-enoyl chlorideb. 5-amino-N-cycl
New Mexico - CHEM - 301
Name THIRD HOUR TESTKEY1. (21, 7 each) In the spaces provided below, give the correct IUPAC names for the compounds having each of the following structures.a. 7-chloro-3-cyano-5-cyclopentyl-2-ethoxy-6-oxohept-3-enoyl chlorideb. 5-amino-N-cycl
Berkeley - IEOR - 172
IEOR 172: Probability and Risk Analysis for Engineers, Fall 2007 Homework 1 SolutionChapter 1 Question 4 There are 4! possible arrangements. By assigning instruments to Jay, Jack, John and Jim, in that order, we see by the generalized basic principl
Michigan - ENVIRON - 211
Vilsack- D iowa gov Pataki- regional greenhouse gas emissions policy (REGE) NY gov R -put a cap on greenhouse emissions in a specific region Schwarzenegger- Global Warming Solutions Bill-very popular Gore-little mention of global warming in campaigns
Trinity U - ENGL - 1302
1. The lines "Let not light see my black and deep desires" (spoken by Macbeth) introduce the theme of the play. Shakespeare wants the audience to think about the corruption and "under the table" dealings that might occur. 2. The different spellings o
Trinity U - ENGL - 1302
1. The theme of "The Love Song of J. Alfred Prufrock" is sexual frustration leads to one's demise. 2. The title "The Love Song of J. Alfred Prufrock" is ironic, the "love" song is Prufrock's inner conscious. It is also the luck of love. Lastly, men w
Arizona - BIO - 181
Membranes and Transport Key Concepts A hallmark of living cells is their ability to . what? How do they do this? Their ability to regulate the substances that enter and leave them. They do this by forming a barrier and doing a group of proteins that
Trinity U - ENGL - 1302
Now You See It, Now You Don'tThroughout history, it has been human instinct to find alter-egos to satisfy their personal jealousies and secret ambitions. Oscar Wilde, a prominent and controversial writer in the 18th century, used his own life as an
Michigan - MATH - 216
Math 216 (Section 50) 1 (5.12) (a) Since BC = we have 3 -4 5 1Written Homework #8 SolutionsFall 20070 2 -12 10 = , 3 -1 3 9 2 -3 4 7 -9 -11 47 -9AB =2 -3 4 73 -4 -9 -11 = , 5 1 47 -9A(BC) = and (AB)C = Therefore A(BC) = (AB)C. (b) We c
Penn State - B A - 304
BA304 Final Exam Review Read and study chapters 11, 12, and 14 from the text I. Communication: The transmission of information and meaning from one party to another; one of the most important factors in mgmt. a. Communications Model: Most important m
Penn State - B A - 301
BA 301 Exam 2 Review Chapter 4: Strategic Financial Management - Financial Facts: o The Yield Curve looks inverted for the first time since the 1980's; this is bad news for the economy. The Yield Curve indicates the base cost for long term capital i
Berkeley - IEOR - 172
IEOR 172: Probability and Risk Analysis for Engineers, Fall 2007 Homework 2 SolutionChapter 3 Question 9 Denote A as urn A, and W as white ball: P(A = 2W |2W ) = = = P(A = 2W, 2W ) P(2W )2 62 6 8 3 12 44 8 3 + 12 1 12 4 4 4 + 2 12 1 + 4 6
Penn State - B A - 304
The exam will cover but is not limited to the following concepts from lectures, plus chapters assigned on syllabus: READ CHAPTERS 2,4,6,7,8! I. Managing in the Organizational Environment (chapter 2): A. Components of the Macro-environment: The most g
Rutgers - ENGLISH - 101
Carr 1 28 April 2006 The Poems of Alice in Wonderland In the words of Alice herself, "It seems very pretty, but it's rather difficult to understand. Somehow it seems to fill my head with ideas only I don't exactly know what they are" (Carroll 92). M
Penn State - B A - 301
Social Responsibility - an organization's obligation to maximize its positive impact on stakeholders and to minimize its negative impact. Business ethics comprises the principles and standards that guide behavior in the world of business. Ethical Is
ASU - MAT - 170
MAT 170: PRE-CALCULUS Fall 2006 Syllabus (rev 4/3/2008) Instructor: Rodger Moffett Office: Psa202-Psa204 E-mail: moffett@math.asu.edu This Syllabus URL: http:/math.asu.edu/~moffett/f06Syl170oc SLNs: 03410, 02806, 10441, 17867 Tentative Office Hours:
Penn State - B A - 304
BA 304 Exam 3 Study Guide Read ch 9 & 10; page 157-159 what mgr and emp want; table 9.4 p 258; p 261; p 284 I. The Influence Process- Social interaction; the process of affecting the behavior of others A. Agent-Target Relationship: Agent is the party
Rutgers - ANTHROPOLO - 104
3/27/08 Move Response While watching "Jane Goodall's Wild Chimpanzees", I felt that I already knew a good amount of the information being given because of my previous knowledge of chimpanzees from the Introduction to Physical Anthropology textbook. I
Colorado State - SOC - 205
Brandon Ott 826235516 3/13/08 Mid Term Essay Even though slavery has been banished in America, that has not stopped the constant discrimination and segregation that African Americans face even today. Over time improvements have been made to attempt t
ASU - CHM - 113
CHM 113A: Syllabus, Fall 2006 7:40 8:55 Tu, Th PSH-150Instructor: Ariel Anbar Office: Physical Sciences F-630 Phone: 965-0767 Email: anbar@asu.edu Office Hours: M 10:40-11:30 am; Th 1:40-2:30 pm Course Website: http:/my.asu.edu; proceed to "myASU c
ASU - APA - 340
APAS 340 Spring 2007: Asian American & Pacific Islander Media CriticismInstructor: Sudarat Musikawong Class Meetings: M/W 12:15-1:30pm Office: Social Sciences/ APAS Room 100 Phone: 480-727-8505 E-mail: Sudarat.Musikawong@asu.eduOffice Hours: TBA