Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more.
Course Hero has millions of course specific materials providing students with the best way to expand
their education.
Below is a small sample set of documents:
Wake Forest - ATT - 0611
Imperialism, Intellectual Networks, and Environmental ChangeOrigins and Evolution of Global Environmental History, 1676-2000: Part IIThe first part of this article traced the early beginnings of environmental history that was framed largely in the conte
Wake Forest - ATT - 0611
NEW DIRECTIONS IN MARXIST THEORY Historical Materialism Annual Conference 2006, 8-10 December In association with Socialist Register and the Isaac and Tamara Deutscher Memorial Prize Committee Clore Management Centre, Birkbeck, and School of Oriental
University of Texas - M - 408D
Basic Mathematical Relations 1 e = lim1 + 2.718 n nLog and powernln x + ln y + L = ln xy L ,log a b = log c b , log c aln x ln y = ln log x = log10 x ,a x / a y = a x y ,x , ya ln x = ln x aln x = log e xa x a y a z = a x+ y+ z , Derivatives d
University of Texas - CH - 369
Announcements 1. Textbooks Bundled textbooks from co-op ~$95 Wileyplus + ebook $55 Wileyplus is open for a week to everyone 2. Icliker 3. contact Sarah Long for becoming a preceptor 4. Check blackboad for course info.Study groups The facebook group w
University of Texas - CH - 369
Figure 4.02 Structures and abbreviations of the 15 standard amino acids.ChymotrypsinCase Study of an EnzymeWhat Is an Enzyme?Acatalyst that accelerates the rate of chemical reaction. Mostly made of proteins. Recently, some RNA (ribozyme) has been fou
University of Texas - CH - 369
Biological membranesDistribution of Na+ and K + ions in an animal cell[Na+] = 150 mM [K+] = 4 mM[Na+] = 12 mM [K+] = 140 mMA lipid bilayer membraneHydrophilic head hydrophobic tailshydrophobic tails Hydrophilic headThe lipid bilayer forms spontaneo
University of Texas - CH - 369
Overview of Mammalian Metabolism and Free EnergyLearning Objectives Learn how foodstuffs are digested, absorbed stored and mobilized. Understand relationship between catabolic and anabolic pathways Understand role of oxidation and reduction in metabolis
University of Texas - CH - 369
Chapter 10 Glucose MetabolismFigure 10.01 Yeast cells.Common intermediates in different metabolic pathwaysStructure of glycogen.Figure 9.04b Structure of glycogene. Glucose is the most abundant organic molecule on earth. It plays a central role in me
University of Texas - CH - 369
Chapter 11 The Citric Acid Cycleor Tricarboxylic acid cycle ( TCA cycle ) or the Krebs cycleThe citric acid cycle in context.citric acid cycleUnlike a linear pathway such as glycolysis or gluconeogenesis, the citric acid cycle always returns to its st
University of Texas - CH - 369
Glucose metabolism Which glycolytic reactions consume ATP?A) hexokinase B) pyruvate kinase C) enolase D) A and B E) all of the above Which generate ATP?GlycolysisgluconeogenesisGlucose metabolism in context.Reactions of glycolysis.-2ATP+ 4ATP _ Ne
University of Texas - CH - 369
Food digestion and energy productionEnergy (ATP) Anaerobic aerobic 2 puruvte glycolysis Glucose CAC CO2+H2O 4 38 8e oxidativ Coupled lation osphory phATP synthesisFoodUncou pled oxidati ve phosph orylati onHeat productionHeat production Hibernatin
University of Texas - CH - 369
Lipids- Molecules includes fats and oils, waxes, phospholipids, steroids and cholesterol, and some other related compounds. - The common feature of lipid molecules is that they are water insolubleSeeds of the crossed turnip + cabbage plants Canola oilA
University of Texas - CH - 369
Chapter 4 Myoglobin and Hemoglobin: A Study of Protein Structure and FunctionLearning ObjectivesChapter 4 Myoglobin and Hemoglobin: A Study of Protein Structure and Function4. Understand the chemical characteristics of the R groups that distinguish the
University of Texas - CH - 369
Motor proteinsLessons from biological system Spider silk, made of a protein called fibroin, consists of Ala- and Gly-rich sheets interspersed with more amorphous segments of polypeptide.Cell migration and metastasisNormal functions Wound healing Fight
University of Texas - CH - 369
Motor proteinsLessons from biological system Spider silk, made of a protein called fibroin, consists of Ala- and Gly-rich sheets interspersed with more amorphous segments of polypeptide.Cell migration and metastasisNormal functions Wound healing Fight
University of Texas - CH - 369
Steady-state enzyme kineticsTherapeutic Drugs Efficacy ID50, IC50 Potency dosage Pharmacokinetics Drug metabolism toxicityWhich statement(s) is (are) true? A. The more catalyst present, the faster the reaction. B. As product is formed, substrate c
University of Texas - CH - 369
Chapter 12 oxidative phosphorylation o Reduction potential o Calculating standard free energy for oxidation/reduction reaction: (pg. 374-5) o Oxidative phosphorylation o Structure of the mitochondria: H+ concentration o Transporters: not all molecules can
University of Texas - CH - 353
Homework 1: Due at the beginning of class 02/11/09Problem 1. We have an ideal gas in a box, which we can expand as we like. Initially, the box has a volume of V and we expand it to 2V while keeping the internal gas pressure constant. You see that the tem
University of Texas - CH - 353
Homework 2: Due at the beginning of class 02/20/09Problem 1. In the questions below, say whether the statement is true or false. You dont need to present any explanation. However, understanding why you have the answer will help you to prepare the exam. (
University of Texas - CH - 353
Problem Set 3: Due by Mar. 13 in classProblem 1. At low temperatures, the heat capacity (at a constant pressure) of a solid is a function of temperature and specifically follows the law C P (T ) = aT 3 where a is a positive constant. This is what the Deb
University of Texas - CH - 353
Problem Set 4: Due by Mar. 30 in classProblem 1. One mole of ideal gas is compressed isothermally from 1 to 5 bar at 100 C. (a) What is the Gibbs energy change, G? (b) What would have been the Gibbs energy change if the compression had been carried out a
University of Texas - BIO - 325
CHAPTER 2 Single-Gene InheritanceCHAPTER OUTLINE2.2 2.3 2.1 2.5 2.6 Single-gene inheritance patterns The chromosomal basis of single-gene inheritance patterns Genes and chromosomes Sex-linked single-gene inheritance patterns Human pedigree analysisSing
University of Texas - BIO - 325
CHAPTER 3 Independent Assortment of GenesCopyright 2008 W H Freeman and CompanyCHAPTER OUTLINE3.1 3.2 3.3 3.4 3.5 Mendels law of independent assortment Working with independent assortment The chromosomal basis of independent assortment Polygenic inheri
University of Texas - BIO - 325
Outline for Chapters 2 and 31. Understanding Mendels experiments. Experiments in Plant Hybridization (1865) by Gregor Mendel http:/www.mendelweb.org/Mendel.plain.html Mendels law of equal segregation (section 2.2 in the text) alleles at a locus segregate
Texas A&M - CS - 0118
actagaagcggaagtagttgtgggcgcctttgcaaccgccccgagtggtctgtgcaggttcgcgggtcgctggcgggggttgcgccgggagcggagatatggagggagatggttcagaccagatgccggggaggacagcaagtccgagaatggggagaatactgcatctgccgcaaaccggacatcaactgcttcatgataactgcaatgagtggttccatggggactgcatccggatcaggccaaggc
Texas A&M - CS - 0118
gcgggatggcaatgagcgggacagcagtgagccccgggatgagggtggagggcgcaagaggcctgtccctgatccagacctgcagcgccgggcagggtcagggacaggggttggggccatgcttgctcggggctctgcttcgccccacaagcgcccatctactgcatctgccgcaaaccggacatcaactgcttcatgatcgggtgtgacaactgcaatgagtggttccatggggactgcatccggatca
Texas A&M - CS - 0118
agatggcggcgctgaggggtcttgggggctctaggccggccacctactggtttgcagcggagacgacgcatggggcctgcgcaataggagtacgctgcctgggaggcgtgactagaagcggaagtagttgtgggcgcctttgcaaccgcctgggacgccgccgagtggtctgtgcaggttcgcgggtcgctggcgggggtcgtgagggagtgcgccgggagcggagatatggagggagatggttcagacc
FIU - WEEK - 2210
ArrayObjectives To understand the concept of arrays To understand the purpose to which we use arrays. To be able to declare references to arrays. To be able to create one-dimensional and two-dimensional arrays. To be able to initialize one-dimensional an
FIU - WEEK - 2210
Data Types Reference TypesObjective To understand what reference types are The need to study reference types To understand Java standard packages To differentiate between Java defined types and user defined types To have a deeper understanding of the Str
FIU - WEEK - 2210
Data Types and Operations On DataObjective To understand what data types are The need to study data types To differentiate between primitive types and reference types To know the data range and storage requirements for each type To know the conditions fo
FIU - WEEK - 2210
4.Data Types and Operations On DataObjective To understand what data types are To understand the reason for studying data types To differentiate between primitive types and reference types To know the range and storage requirements for each data t
University of Texas - CH - 369
Announcements 1. Textbooks Bundled textbooks from co-op ~$95 Wileyplus + ebook $55 Wileyplus is open for a week to everyone 2. Icliker 3. contact Sarah Long for becoming a preceptor 4. Check blackboad for course info.Study groups The facebook group w
University of Texas - BIO - 325
CHAPTER 4 Mapping Eukaryote Chromosomes by RecombinationCopyright 2008 W H Freeman and CompanyA recombination-based map of one of the chromosomes of DrosophilaChapter 4 OpenerCHAPTER OUTLINE4.1 Diagnostics of linkage 4.2 Mapping by recombinant freque
University of Texas - BIO - 325
CHAPTER 5 The Genetics of Bacteria and Their VirusesCopyright 2008 W H Freeman and CompanyCHAPTER OUTLINE5.1 5.2 5.3 5.4 5.5 5.6 Working with microorganisms Bacterial conjugation Bacterial transformation Bacteriophage genetics Transduction Physical map
University of Texas - BIO - 325
CHAPTER 6 Gene InteractionCopyright 2008 W H Freeman and CompanyCHAPTER OUTLINE6.1 Interactions between the alleles of a single gene: variations on dominance 6.2 Interaction of genes in pathways 6.3 Inferring gene interactions 6.4 Penetrance and expres
University of Texas - BIO - 325
CHAPTER 7 DNA: Structure and ReplicationCopyright 2008 W H Freeman and CompanyCHAPTER OUTLINE7.1 7.2 7.3 7.4 7.5 7.6 7.7 DNA: the genetic material The DNA structure Semiconservative replication Overview of DNA replication The replisome: a remarkable re
University of Texas - BIO - 325
CHAPTER 8 RNA: Transcription and ProcessingCopyright 2008 W H Freeman and CompanyCHAPTER OUTLINE8.1 8.2 8.3 8.4 RNA Transcription Transcription in eukaryotes Functional RNAsRNA polymerase in actionChapter 8 OpenerRNAEukaryotic mRNA moves from nucle
University of Texas - BIO - 325
CHAPTER 9 Proteins and Their SynthesisCopyright 2008 W H Freeman and CompanyCHAPTER OUTLINE9.1 9.2 9.3 9.4 9.5 9.6 Protein structure Colinearity of gene and protein The genetic code tRNA: the adapter Ribosomes The proteomeSurface of the ribosome from
University of Texas - BME - 311
BME 311 Network (Circuit) TheorySpring 2008-2009 MWF 9-10 AM, BUR 112Instructor: Office: Professor John X.J. Zhang Department of Biomedical Engineering, BME5.202-O, UT-Austin main campus Microelectronics Research Center, 2.206W, UT-Austin Pickle Researc
University of Texas - BME - 311
Review Question 1 Simplify the following units. Try to express each as a single unitBME 311 Network TheoryJohn X.J. Zhang, UT Austin1Review Question 2 The current flowing through a wire is given by the following figure. Sketch the net charge moving
University of Texas - BME - 311
Basic Circuit Analysis Ohm's law Concepts of nodes, branches, and loops Kirchhoff's current and voltage laws Combining resistors in series and in parallel Principles of voltage division and current division Wye-delta transformationBME 311 Network Theor
University of Texas - BME - 311
BME 311 Office HoursTeaching Assistant: Tushar Sharma (BME) Email: tush.shar@gmail.com Office hour: Monday 3:30pm 5:30pm, BME4.202G, or by appointment Teaching Assistant: Dian (Oscar) Jiao (BME) Email: jiaodian@mail.utexas.edu Office hour: Tuesday 2:00pm
University of Texas - BME - 311
Methods of Analysis Nodal Analysis Systematic application of KCL Mesh analysis Systematic application of KVLWe can analyze any linear circuit by obtaining a set of simultaneous equations that are then solved to obtain I or V - Cramers Rule - Matrix i
University of Texas - BME - 311
Nodal vs. Mesh Analysis Nodal Analysis # of node equations < # of mesh equations KCL on nodes node voltages Planar and nonplanar circuits Op amp circuit Mesh Analysis # of mesh equations < # of node equations KVL around meshes mesh currents Planar cir
University of Texas - BME - 311
This Lecture Linear Circuit Simplify circuit analysis using circuit theorems Circuit Theorems Thevenins Theorem Nortons TheoremBME 311 Network TheoryJohn X.J. Zhang, UT Austin1Linear System Linearity linear relationship between input (excitation
University of Texas - BME - 311
Nortons Theorem A linear two-terminal circuit can be replaced by an equivalent circuit consisting of a current source IN in parallel with a resistor RN. IN : short-circuit current RN :the input resistance at the terminals when the independent sources ar
University of Texas - BME - 311
Operational Amplifiers (Op Amp) V (I) controlled V (I) source Active or passive element ? Perform math operations Addition Subtraction Multiplication Division Integration DifferentiationBME 311 Network TheoryJohn X.J. Zhang, UT Austin1Key Points o
University of Texas - BME - 311
Ideal Op Amp The current into both input terminals are zeroi1=0, i2=0 The voltage across the input terminals is equal to zerov1 = v2BME 311 Network TheoryJohn X.J. Zhang, UT Austin1Inverting Amplifier Key feature Input signal is applied at the i
University of Texas - BME - 311
Inductors Inductor Consists of a coil of conducting wire (bulky, expensive)v=L di dt Inductance L Property of opposition to the change of current (Unit: Henry, H)N 2 A L= lBME 311 Network TheoryJohn X.J. Zhang, UT Austin1 Typical inductor value:
University of Texas - BME - 311
Chapter 6 Capacitor Definition Energy, power Series and parallel capacitors Inductor Definition Series and parallel capacitorsBME 311 Network TheoryJohn X.J. Zhang, UT Austin1Capacitors and Inductors Capacitor two conducting plates separated by a
University of Texas - BME - 311
First-order Circuits Characterized by a first-order differential equation RC, RL Two way of excitations Source-free Independent sources (dc, sinusoidal, exponential)v(t ) = V0 et RC= V0 et?Where, = RCBME 311 Network Theory John X.J. Zhang, UT Aust
University of Texas - BME - 311
University of Texas - CH - 353M
R = 8.314 J/(K mol), 1bar = 105 Pa, 1 L =10-3 m31. True/False (10 points each). Classify the statements below as either True or False (No explanation required). (a) At T = 0 K, the entropy of a substance becomes zero. (b) A very stiff, rigid solid like d
University of Texas - CH - 353M
Practice Exam 1 R = 8.314 J/(K mol), 1bar = 105 Pa, 1 L =10-3 m31. True/False. Classify the statements below as either True or False (No explanation required). (a) If you know the pressure, temperature and the number of moles of a gas, you have all the i
University of Texas - BME - 311
Review ReviewSessionTusharImportant ImportantPoints LabeltheDiagram VoltageDifferencevs.AbsoluteVoltage ZeroPotential KCLvs.KVL:Whichonetouse? Commonmistakes: DependentsourcesorVoltage/Current Connectingwires Branchcurrentvs.MeshCurrentDisclaimer! Di
University of Texas - CH - 353M
CHEM 353M (Unique: 53415) Physical Chemistry I for Life Sciences Time and Place: Spring 2009 WEL 1.316 Mon/Wed/Fri, 1 pm-2 pm Instructor: Sang-Hyun Lim shlim@mail.utexas.edu - E-mail is the best way to contact me WEL 3.120A, 471-0872 Office hours: Mon/Tu
University of Texas - CH - 353M
First LawdU = TdS PdV dH = TdS + V dP dA = SdT PdV dG = SdT + V dPMaxwell Relations S V = P T T P T P = S V V S V T = P S S P S P = V T T VFor Gibbs Free Energy, G G = S and T P G =V P TH (G / T ) T = T 2 (Gibbs-Helmholtz Equation) PC V dS = dP + P
University of Texas - REE - 302
The University of Texas at Austin Department of Slavic and Eurasian Studies Fall 2009INTRODUCTION TO SLAVIC CIVILIZATIONSLA 301 (46195), REE 302 (45685), CL 305 (33295), EUS 307 (36425)The Vampire in Slavic Cultures - , . e . e , , , . e , . , . ,
University of Texas - REE - 302
The University of Texas at Austin Department of Slavic and Eurasian Studies http:/www.utexas.edu/cola/depts/slavic/INTRODUCTION TO SLAVIC CIVILIZATIONSLA 301 (46195), REE 302 (45685), CL 305 (33295), EUS 307 (36425) . , . . . , , . . ! . , . . , , . . !
University of Texas - REE - 302
NeuronsThe ow of information through a neuronThe ow of information from neuron to neuronThe SynapseSynapseIonic currents to chemical diffusion to ionic currentsSynapseIonic currents to chemical diffusion to ionic currents Site of regulation, compil