33 Pages

01-lrcgprices

Course: ATT 0704, Fall 2009
School: Wake Forest
Rating:
 
 
 
 
 

Word Count: 11112

Document Preview

CONCEPT MARXS OF PRICES OF PRODUCTION: LONG-RUN CENTER-OF-GRAVITY PRICES by Fred Moseley Mount Holyoke College fmoseley@mtholyoke.edu In recent years, I and others have engaged in a lengthy debate about the transformation problem and Marxs theory of prices of production with Andrew Kliman and Alan Freeman and others who follow the temporal single system (TSS) interpretation of Marxs theory. I think that many...

Register Now

Unformatted Document Excerpt

Coursehero >> North Carolina >> Wake Forest >> ATT 0704

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
CONCEPT MARXS OF PRICES OF PRODUCTION: LONG-RUN CENTER-OF-GRAVITY PRICES by Fred Moseley Mount Holyoke College fmoseley@mtholyoke.edu In recent years, I and others have engaged in a lengthy debate about the transformation problem and Marxs theory of prices of production with Andrew Kliman and Alan Freeman and others who follow the temporal single system (TSS) interpretation of Marxs theory. I think that many interesting issues have been discussed and clarified, which I will not try to summarize here. In the course of the discussions, it has become increasingly clear to me, and I think also to other participants in this debate, that a fundamental issue is whether or not Marxs concept of prices of production are long-run equilibrium prices, in the classical sense of centers of gravity around which actual market prices fluctuate over some period of time. I argue that Marxs concept of prices of production are indeed long-run center-of-gravity prices in the classical sense. This paper will examine the textual evidence in Marxs manuscripts to support this interpretation. The paper begins with a brief summary of Smiths and Ricardos concept of natural price, since it will be argued that Marxs concept of prices of production was essentially the same as Smiths and Ricardos concept of natural price. The paper ends with a brief consideration of Freemans and Kliman and McGlones interpretations of Marxs concept of prices of production and argues that thesed interpretations are fundamentally mistaken. 1 1. SMITH and RICARDO Smiths and Ricardos concept of natural price may be briefly and schematically summarized as follows:1 Capitalist economies are characterized by a tendency toward equal rates of profit across different industries. This equality of profit rates is never actually achieved, but there is at least a tendency toward equalization, in the sense that the existence of unequal rates of profit would in general activate capital flows that would tend to reduce the inequalities. Smith and Ricardo also recognized that there are factors (such as monopolies, greater risk, etc,) that lead to more permanent inequalities of profit rates. But after noting these factors, they based their theories on the assumption of equal profit rates. This restless drive on the part of all employers of stock to quit a less profitable for a more advantageous business has a strong tendency to equalise the rate of profits of all, or to fix them in such proportions as may, in the estimation of the parties, compensate for any advantage which one may have, or appear to have, over the other. (Ricardo, p. 48) It is then the desire, which every capitalist has, of diverting his funds from a less to a more profitable employment that prevents the market price of commodities from continuing any length of time either much above or much below the natural price. It is this competition which so adjusts the changeable value of commodities that ... the remaining value or overplus will in each trade be in proportion to the value of the capital employed. (Ricardo, p. 50) The prices that result when all profit rates are equal were called natural prices. Let us suppose that all commodities are at their natural prices and consequently that the profits of capital in all employments are exactly at the same rate, or differ only so much as, in the estimation of the parties, is equivalent to any real or fancied advantage which they possess of forego. (Ricardo, p. 50) Actual or market prices are seldom are equal to natural prices, because of inequalities between supply and demand. However, these market prices fluctuate around the natural prices due to the migration of capitals in search of a higher rate of profit. In this sense, the natural 2 prices are centers of gravity for the fluctuations of actual market prices. The actual price at which any commodity is commonly sold is called its market price. It may be above, or below, or exactly the same with its natural price... The natural price, therefore, is, as it were, the central price, to which the prices of all commodities are continually gravitating. (Smith, pp. 158, 160) Natural prices as centers of gravity are necessarily long-run concepts. In order for there to be sufficient time for capital to flow from one industry to another and to increase supply in the latter, and thus for market prices to fluctuate around the natural price, at least some passage of time is required. The long-run nature of the concept of natural price does not mean that Smith and Ricardo assumed that natural prices never change. Instead, they assumed that changes in natural prices would be less frequent than changes in market prices. The centers of gravity can change occassionally and still serve as centers of gravity. Natural prices change due to changes in their fundamental causes (for Ricardo: the values of commodities, or the labor-time required to produce commodities). It is assumed that these fundamental causes of natural prices change less frequently than the fluctuations of supply and demand, which continue from period to period. In Garegnanis words, natural prices are more persistent than market prices (Garegani 1990). It is the cost of production which must ultimately regulate the price of commodities, and not, as has been often said, the proportion between the supply and demand ... Diminish the cost of production of hats, and their price will ultimately fall to their new natural price, although the demand should be doubled, trebled, or quadrupled. (Ricardo, p. 260) There is another sense in which Smiths and Ricardos concept of natural price is a longrun concept: that changes in the determinants of natural prices have permanent effects on the prices of commodities, whereas the causes of variations of market prices from natural prices 3 have only temporary effects. On the other hand, variations in the market price, due to supply and demand, will be (more or less) automatically offset by compensating flows of capital across industries in subsequent periods. It is the cost of production which must ultimately regulate the price of commodities, and not, as has been often said, the proportion between the supply and demand: the proportion between supply and demand may, indeed, for a time, affect the market value of a commodity, until it is supplied in greater or less abundance, according as the demand may have increased or diminished; but this effect will be of only temporary duration. (p. 260) Smith and Ricardo were primarily interested in natural prices and how natural prices change over time (i.e. the long-run trends of natural prices and the distribution of income). They were not interested in the short-run fluctuations of market prices around the natural prices. Hence, their theories were about these long-run natural prices (i.e. prices that yield equal rates of profit), not about short-run (and short lived) market prices. In other words, their theories attempted to explain the centers of gravity of transitory movements. In the seventh chapter of the Wealth of Nations, all that concerns this question is most ably treated. Having fully acknowledged the temporary effects which, in particular employments of capital, may be produced on the prices of commodities, as well as on the wages of labor, and the profits of stock, by accidental causes, without influencing the general price of commodities, wages, or profit, since these effects are equally operative in all stages of society, we will leave them entirely out of our consideration whilst we are treating of the laws which regulate natural prices, natural wages, and natural profits, effects totally independent of these accidental causes. (Ricardo, pp. 50-51; emphasis added) 4 2. MARX Marx essentially agreed with Smith and Ricardo on all these points, except that he substituted the terms average price or cost-price and finally price of production for Smiths and Ricardos concept of natural price. Marxs general agreement with Smith and Ricardo on these points is made clear from a review of Marxs manuscripts in which he discussed these points. There are two main manuscripts: the 1861-63 Manuscript (Chapters 8 and 10 of Theories of Surplus-Value) and the 1864-65 manuscript of Volume 3 (especially of course Part 2). Marxs decisive advance over Smith and Ricardo is that he was able to present a theory of the determination of of prices of production, whereas Smith and Ricardo were not able to do so. 2.1 1861-63 MANUSCRIPT Marxs first extensive discussion of what eventually became his theory of prices of production was in 1862, in the middle of his 1861-63 Manuscript. At this stage of Marxs thinking, he had not yet hit upon the term prices of production for prices that equalize profit rates across industries. At the beginning of Marxs discussion of Rodbertus (Chapter 8), he mostly used the term average price to denote these profit-rate equalizing prices. By Chapter 10 on Smith and Ricardo, Marx had mostly switched to the term cost-price for this purpose. But these two terms are clearly synonymous and are used interchangeably throughout by Marx. This change of terms does not indicate a change of meaning. Both terms mean the same thing the prices that equalizes rates of profit across industries. Early in Chapter 8 on Rodbertus, Marx began to emphasize (and perhaps to realize for the first time) that the theory of rent must be understood in connection with the equalization of profit rates across individual branches of production. Marx discussed Rodbertus description of the equalization of profit rates and expressed no disagreement (pp. 25-30). Marxs criticism of Robdbertus is that he assumed that the equalization of profit rates would have the result that commodities would exchange at their values. Marx explained, to the contrary, that the equalization of profit rates would result in average prices that are in general not equal to the values of commodities. Competition achieves this equalization [of profit rates] by regulating average prices. These average prices themselves, however, are either above or below the value of the commodity so that no commodity yields a higher rate of profit than any other. It is therefore wrong to say that competition among capitals brings about a general rate of profit by equalizing the prices of commodities to their values. (pp. 29-30) Marx made no criticism of Rodbertus assumption of equal rates of profit. He did mention parenthetically particular obstacles in certain spheres to the equalization of profit rates, but stated that we shall not examine here these obstacles (p. 29). A little later in the manuscript, Marx sketched (for the first time) the details of his theory of average prices, with a numerical example, on the assumption that these average prices achieve the equalization of profit rates across industries (pp. 64-71). He summarized his theory as follows: Competition brings about the equalization of profit, i.e. the reduction of the values of commodities to average prices. (p. 69) After Chapter 8 on Rodbertus and Chapter 9 on the history of the Ricardian theory of rent, Marx wrote Chapter 10 on Ricardos and Adam Smiths Theory of Cost-Price (Refutation). Section A (most of the chapter) is about Ricardo and Section B is about Smith. This chapter provides substantial and very clear evidence that Marx essentially agreed with Smiths and Ricardos assumption of the equalization of profit rates across industries and with their focus on natural prices as long-run center-of-gravity prices as the focus of his theory. The first evidence that Marx agreed with Smith and Ricardo on these points is that the entire discussion of Smiths and Ricardos theories of natural price in this chapter is in terms of Marxs own concepts of average price and cost price (e.g. the title of the chapter). Throughout this chapter, Marx switched back and forth between his critical discussion of Smith and Ricardo theories and the development of his own theory, using the same concepts of average price and cost price for both purposes. Nowhere did Marx state or even hint that what Smith and Ricardo meant by natural prices was somehow different from what he meant by average prices or cost-prices. All these concepts mean the same thing: long run center of gravity prices that equalize rates of profit. Indeed, in a number of places, Marx explicitly used the terms costprice or natural price synonymously (pp. 214, 215 (twice), 217, 220 (twice), and 235). For example: As a result of this variation [of values], new cost-prices or, as Ricardo says, following Smith, new natural prices take place of the old. (p. 215) More specific evidence that Marx essentially agreed with Smiths and Ricardos concept of natural price as long run center of gravity prices due to the equalization of profit rates is found in Section A.5 of Chapter 10 (entitled Average or Cost-Prices and Market-Prices), which is mainly about Ricardos Chapter 4 on Natural and Market Price. In this section, Marx summarized Ricardos discussion of the migration of capitals from industries with lower rates of profit to industries with higher rates of profit, and the resulting tendency toward the equalization of profit rates across industries, and the consequent fluctuations of market prices around costprices or natural prices, and expressed no disagreement with all this. Marx commented that, for the most part, all this is in Smith. Ricardos advance over Smith, according to Marx, was: the more precise exposition of the migration of capital from one sphere to another, or rather the manner in which this occurs. He was, however, only able to do this because the credit system was more highly developed in his time than in the time of Smith. (p. 210) Marxs praised Ricardos description as an achievement (p. 210). There is not a hint of criticism or disagreement with Ricardos description of the process through which capital migrates, rates of profit are equalized, and market prices fluctuate around the natural price (or cost-price) Marxs main criticism of Ricardo in this section is that he failed to recognize that competition not only equalizes rates of profit across industries, but also equalizes prices within each industry, which in turn implies that producers within a given industry with unequal productivities will have unequal rates of profit. Marx emphasized that the single price effect of competition within an industry is important in Ricardos theory of differential rent, but it is not mentioned in Ricardos discussions in Chapters 4 and 30 of the effects of competition. However, with respect to the other type of competition - across industries - Marx expressed no criticism with Ricardos discussion of the tendency of capitals to migrate from industries with lower rates of profit to industries with higher rates of profit and the resulting tendency toward the equalization of profit rates across industries. By equalization through competition, Ricardo therefore understands only the rotation of the actual prices or actual market-prices about the cost-prices or the natural price as distinct from the value ... Marx then quoted Ricardo: It is then the desire, which every capitalist has, of diverting his funds from a less to a more profitable employment that prevents the market-price of commodities from continuing for any length of time either much above, or much below their natural price. It is this competition which so adjusts the changeable value of commodities that ... the remaining value or overplus will in each trade be in proportion to the value of the capital employed. Marx then expressed his agreement with Ricardo: This is exactly the case. Competition adjusts the prices in the different trades so that the remaining value or overplus, the profit, corresponds to the value of the capital employed, not to the real overplus which it contains after the deduction of expenses. (p.212) In general, Marxs main criticism of Ricardo and Smith in this chapter is that they did not explain how the cost-prices of commodities are determined. Most importantly, that they did explain how the general rate of profit (the key determinant of cost-prices) is itself determined. They simply took this general rate of profit as given, without an explanation, and argued that all individual rates of profit would tend to equal this general rate of profit. And the manner in which Ricardo carries out this investigation is the following: He presupposes a general rate of profit or an average profit of equal magnitude for different capital investments of equal magnitude ... Instead of postulating this general rate of profit, Ricardo should rather have examined in how far its existence is in fact consistent with the determination of value by labor-time, and he would have found that instead of being consistent with it, prima facie, it contradicts it, and that its existence would therefore have to be explained through a number of intermediary stages, a procedure which is very different from merely including it under the law of value. (p. 174) All Ricardos illustrations only serve him as a means to smuggle in the presupposition of a general rate of profit... How from the mere determination of the value of the commodities, their surplus-value, the profit and even a general rate of profit are derived remains obscure with Ricardo. (p.190) Having taken his stand in competition and assumed the rate of profit etc. as given, Adam Smith for the rest interprets correctly natural price or cost-price, namely, the cost-price as distinct from the market-price. (p.220) Note in this last sentence Marxs explicit agreement with Smiths treatment of the distinction between market-price and natural price (or cost-price). Marxs criticism is that Smith (and Ricardo) failed to explain how the natural price is itself determined. Another important criticism of Ricardo in particular in this chapter is that he identified the cost-price (or the natural price) of commodities with the value of commodities, i.e. he assumed that the cost-prices of commodities that equalize rates of profit are equal to the values of commodities. Ricardo did not adequately distinguish between values and cost-prices. He implicitly assumed that the two concepts are identical. At the beginning of Chapter IV, Ricardo says that by natural price he understands the value of the commodities, that is, the price as determined by their relative labor-time, and that by market-price he understands the accidental and temporary deviations from this natural price of value. Throughout the further course of the chapter - and he is quite explicit in this - he understands something quite different by natural price, namely, cost-price which is different from value. Thus, instead of showing how competition transforms values into cost-prices, i.e. creates permanent deviations from values, he shows, following Adam Smith, how competition reduces the market-prices in different trades to cost-prices. (p.211) Marxs criticism of Smith and Ricardo in this chapter was not that rates of profit rate are not equalized or that cost-prices should not be defined as long-run, profit rate equalizing, center-of-gravity prices, but should instead be defined as short-run market prices or some other prices. As we have seen, Marx generally accepted Smiths and Ricardos concept of long-run center-of-gravity prices that equalize profit rates and around which actual market prices fluctuate. But Marx emphasized that it has to be explained how these long-run center-of-gravity prices are determined, and determined in a way that they are not equal to the values of commodities (even though they still ultimately depend on values). Smith and Ricardos shortcoming, according to Marx, is that they did not explain the determination of these long-run center-of-gravity prices, not that they should have instead explained some other prices. In other words, Marx accepted long-run, profit rate equalizing, center-of-gravity prices as the question, and argued that Smith and Ricardo failed to provide an answer to this key question. In the process, Marx also begin to develop his own answer to this same question, i.e. to develop his own theory of how these long-run center-of-gravity prices are determined. Marx did not argue that the question itself should be changed from long-run center-of-gravity prices to market prices or something else. Marx also discussed Smiths reasons for inequalities in the rates of profit across industries, presented in Smiths Chapter 10 (Of Wages and Profit in the different Employments of Labor and Stock). Marx basically agreed with what Smith had to say about these inequalities. He noted that, although the chapter deals with superficial details, its treatment is very good. This [chapter] is only concerned with detail and therefore belongs to the chapter on competition. In its way, it is very good. It is completely exoteric. (p. 230)2 In this section, Marx also commented on Ricardos chapter 30 (On the Influence of Supply and Demand on Prices) and in the process discussed the following important question: assuming that cost-prices are the center of gravity of market prices, what are the causes of changes in the cost-prices of commodities? (pp. 213-16). (This is the first time, so far as I know, that Marx discussed this question in his published works.) Marx discussed Ricardos specific example of hat making, quoted above: Diminish the cost of production of hats, and their price will ultimately fall to their new natural price, although the demand should be doubled, trebled, or quadrupled. (Ricardo, p. 260) Marx explained that an increase in the productivity of labor in the production of hats would reduce the value of the hats, which in turn would cause a reduction in the cost-price (or the natural price) of the hats. Marx continued that increases in the productivity of labor in industries that produce the means of production for the hat industry would also reduce the value of the hats, and hence also reduce the cost-price of the hats. Finally, increases in the productivity of labor in other industries could also affect the general rate of profit, which in turn would also affect the cost-prices of all commodities. Hence, Marx concluded, all these possible causes of a change in the cost-price of a commodity boil down to an increase in the productivity of labor, or reduction in the value of a commodity, somewhere in the economy (in a given final-goods industry, or in industries that produce means of production for this final-goods industry, or in other industries which affect the rate of profit). Once the cost-prices of commodities in the various branches of production are established, they rise or fall relatively to each other with any change in the values of the commodities. If the productivity of labor rises, the labor-time required for the production of a particular commodity decreases and therefore its value falls; whether this change occurs in the labor used in the final process or in the constant capital, the cost-price of this commodity must also fall correspondingly. (p. 215; emphasis added) Part of the title of the subsection in which Marx discussed this question is: Changes in CostPrice Caused by Changes in the Productivity of Labor (emphasis added). Later in the 1861-63 Manuscript (in the chapter on Ricardos theory of rent), Marx expressed very clearly the concept of natural price which was synonymous with his concept of cost-price. The natural price of the commodity is not the market-price but the average market-price over a long period, or the central point towards which the marketprice gravitates. (TSV.II. 319) During the time that Marx was working on these chapters in the 1861-63 Manuscript, he wrote a letter to Engels (August 2, 1862), in which Marx summarized for Engels his theory of rent and, as a necessary preliminary, also his theory of cost-price or average price. This letter provides a succinct and valuable summary of the conclusions that Marx drew from his critical study of Smiths and Ricardos theories of the cost-price of commodities for his own theory of cost-price. Marx began by demonstrating, by means of a simple numerical example, that if commodities exchanged at their values, then the individual rates of profit would be unequal, because of unequal composition of capital (ratios of constant capital and variable capital). This point, which seems trite to modern readers, was very important for Marx to establish in 1862 because, as we have seen, Ricardo (and his followers) assumed that, if commodities exchanged at their values, then rates of profits in different industries would be equal (i.e. they identified cost-prices and values). However, Marx argued that these unequal rates of profit could not prevail. Competition among capitals would equalize the individual rates of profit to the general rate of profit determined by capital as a whole. Competition (transfer of capital or withdrawl of capital from one trade to another) brings it about that equal sums of capital in different trades, despite their different organic compositions, yield the same average rate of profit. (p. 122) Then Marx commented that prices determined in this way - i.e. prices that equalize rates of profit - are what Smith called natural prices or cost prices. Price regulated in this way = the expenses of capital + the average profit (for instance 10 percent) is what Smith called the natural price, cost-price, etc. It is to this average price that competition between the different trades reduces the prices in different trades (by transfer or withdrawl of capital). Competition therefore does not reduce commodities to their values, but to their cost-prices, which are above, below or equal to their values, according to the composition of the respective capitals. (p. 122) Marx then repeated the criticism discussed above that Ricardo confuses values with cost-prices (p. 122). Therefore, this 1862 letter reinforces the conclusions we have already reached from our review of Marxs 1861-63 Manuscript: that Marx agreed with Smith and Ricardo that there is a tendency to equalize rates of profit across industries (with obstacles that are ignored at this abstract level of analysis) and that Marx called the prices which equalized rates of profit costprices or average price which he equated with Smiths and Ricardos natural prices. 2.2. VOLUME 3 OF CAPITAL (1864-65) The next manuscript in which there is an extensive discussion of Marxs theory of prices of production is the first and only draft of Volume 3 of Capital, written in 1864-65. Evidently, Marx's work on his theory of the distribution of surplus-value in the 1861-63 manuscript had clarified Marx's thinking to such an extent that he was now ready to write Volume 3. In general, it is important to emphasize there are no major changes in Marxs thinking on the issues discussed above in the Volume 3 manuscript compared to the earlier 1861-63 manuscript. Marx continues to develop his theory along the same lines as already sketched in the earlier manuscript: the tendency toward the equalization of profit rates across industries and the average prices that equalize profit rates as the long-run center-of-gravity around which market prices fluctuate. The main change is a purely terminological one: the prices that equalize profit rates are now called prices of production, instead of cost-prices. The term price of production replaces the term cost-price (or average price) to mean the average prices that equalize rates of profit. The term cost price (without the hyphen) now refers, not to profit rate equalizing prices, but to the total capital cost, i.e. the sum of the constant capital and variable capital consumed in a period of production. Marx appears to have made this switch in terminology after having realized while working on the 1861-63 manuscript the importance of the sum of capital costs (cost price) for his explanation of profit-rate equalizing prices (now called prices of production). As is well known, Part 2 of Volume 3 begins with Chapter 8 which presents the problem to be solved: if commodities are exchanged at their values, then unequal compositions of capital across industries would cause the rates of profit to be unequal across industries. However, Marx went on to argue, in actual fact there are no such inequalities in rates of profit across industries: There is no doubt, however, that in actual fact, ignoring inessential, accidental circumstances that cancel each other out, no such variation in the average rate of profit exists between different branches of industry, and it could not exist without abolishing the entire system of capitalist production. The theory of value thus appears incompatible with the actual movement, incompatible with the actual phenomena, and it might seem that we must abandon all hope of understanding these phenomena. (p. 252; emphasis added) Curiously, Ricardos identification of values and cost-prices is not mentioned. But the main point of this chapter seems to be to highlight this theoretical error by Ricardo, etc., and to highlight the problem of explaining the determination of prices of production on the basis of the labor theory of value, which Ricardo and his followers were not able to solve. Marxs theory of prices of production that equalize rates of profit based on the labor theory of value is then presented in Chapter 9, as is well known. Prices of production are defined as follows: The prices that arise when the average of the different rates of profit is drawn from the different spheres of production, and this average is added to the cost prices of these different spheres of production are the prices of production. Their prerequisite is the existence of a general rate of profit, and this presupposes in turn that the profit rates in each particular sphere of production, taken by itself, are already reduced to their average rates... Thus the production price of a commodity equals its cost price plus the percentage profit added to in accordance with the general rate of profit, its cost price plus the average profit. (p. 257) I will not examine here Marxs explanation of the determination of prices of production (see Moseley 1993 for my interpretation). The main point for the purposes of this paper is the precise nature of Marxs concept of prices of production which is being explained - long-run center-of-gravit prices that equalize rates of profit across industries. Later in Chapter 9, Marx discussed again the important question of the causes of changes in prices of production. Marx stated: The price of production of commodities in a particular sphere of production may undergo changes of magnitude: (1) while the value of the commodities remains the same (so that the same quantity of dead and living labor goes into their production afterwards as before), as the result of a change in the general rate of profit that is independent of the particular sphere in question; (2) while the general rate of profit remains the same, by a change in value either in the particular sphere of production itself, as the result of a technical change, or as the result of a change in the value of the commodities that go into its constant capital as formative elements; (3) finally, by the common action of these two circumstances. (p. 265-66) Marx then went on to discuss possible causes of changes in the general rate of profit: Assuming a constant level of exploitation of labor, ... a change in the general rate of profit assumes a change in the value of the commodities which enter as formative elements into the constant capital, the variable capital, or both simultaneously. Alternatively, the general rate of profit can change, with the value of commodities remaining constant, if the level of exploitation of labor changes. Or again, the level of exploitation of labor remaining the same, the general rate of profit can change if the sum of labor applied changes in relation to the constant capital, as a result of technical changes in the labor process. But technical changes of this kind must always show themselves in, and thus be accompanied by, a change in value of commodities whose production now requires either more or less labor than it did before. (pp. 266-67; emphasis added) The one new element in this passage (compared to earlier passages on this topic) is a change in prices of production due to a change in the exploitation of labor, while the value of all commodities remains constant. Presumably, this refers to a change in the real wages of workers. All other possible causes of changes in prices of production discussed in this passage are, in one form or another, changes in the values of commodities which result from changes in the productivity of labor somewhere in the economy - in the particular industry which produces this commodity, or in industries that produce the means of production for this industry, or in other industries that affect the general rate of profit. In sum: prices of production change if and only if the productivity of labor (or the value of commodities) changes or the real wages of workers changes. In Chapter 10, Marx returned to the questions of the equalization of profit rates and the relation between market prices and prices of production. In this chapter, Marx presented essentially the same arguments as in the earlier 1861-63 manuscript: that capitalism is characterized by a tendency toward equal rates of profit across industries and that the prices of production that equalize rates of profit serve as centers of gravity for market prices. Marx acknowledged that there are obstacles to this equalization in some industries. However, Marxs concept of prices of production abstracts from these inequalities, as did Smiths and Ricardos concept of natural price. Capital withdraws from a sphere with a low rate of profit and vends its way to others that yield higher profit. This constant migration, the distribution of capital between the different spheres according to where the profit rate is rising where and it is falling is what produces a relationship between supply and demand such that the average profit is the same in the various different spheres, and values are therefore transformed into prices of production. (p. 297; emphasis added) [C]ompetition of capitals in different spheres brings forth the production price that equalizes the rates of profit between those spheres. (p. 280; emphasis added) The constant equalization of ever-renewed inequalities is accomplished more quickly, (1) the more mobile capital is, i.e. the more easily it can be transferred from one sphere and one place to another; (2) the more rapidly labor-power can be moved from one sphere and from one local point of production to another. The first of these conditions implies completely free trade within the society in question and the abolition of all monopolies other than natural ones, i.e. those arising from the capitalist mode of production itself. It also presupposes the development of the credit system, which concentrates together the inorganic mass of available social capital vis-a-vis the individual capitalist. (p. 298; emphasis added) The assumption that commodities from different spheres of production are sold at their values naturally means no more than that this value is the center of gravity around which price turns and at which its constant rise and fall is balanced out... What we have said here of market value holds also for the price of production, as soon as this takes the place of market value. The price of production is regulated in each sphere, and regulated too according to particular circumstances. But it is again the center around which the daily market prices revolve, and at which they are balanced out in definite periods. (pp. 279-80; emphasis added) Marx also repeated again in this chapter the explicit statement that his concept of price of production is the same thing as Smiths and Ricardos concept of natural price, and also repeated his criticism that they were not able to explain the difference between price of production and value. The price of production includes the average profit. And what we call price of production is in fact the same thing that Adam Smith calls natural price, Ricardo price of production or cost or production, and the Physiocrats prix necessaire, though none of these people explained the difference between price of production and value. (p.300; emphasis added) This indicates once again that Marx accepted the assumptions on which Smiths and Ricardos concept of natural price is based: that rates of profit tend to be equalized and that market prices fluctuate around the average prices that equalize profit rates as centers of gravity. Marx also briefly commented once again that changes in prices of production are caused by changes in the value of commodities, or changes in the productivity of labor. In whatever way prices are determined, the following is the result: (1) The law of value governs their movement in so far as reduction or increase in the labor-time needed for their production makes the price of production rise or fall... (2) The average profit, which determines the prices of production, must always be approximately equal to the amount of surplus-value that accrues to a given capital as an aliquot part of the total social capital... Since it is the total value of the commodities that governs the total surplus-value, while this in turn governs the level of average profit and hence the general rate of profit - as a general law or as governing the fluctuations - it follows that the law of value regulates the prices of production. (pp. 280-81) Marx also commented briefly in this chapter on the reason his theory and the theories of the classical economists are focused on prices of production and ignore the temporary fluctuations of market prices: In actual fact, demand and supply never coincide, or, if they do so, it is only by chance and not to be taken into account for scientific purposes; it should be considered as not having happened. Why they does political economy assume that they do coincide? In order to treat the phenomena it deals with in their lawlike form, the form that corresponds to their concept, i.e. to consider them independently of the appearance produced by the movement of demand and supply. And, in addition, in order to discover the real tendency of their movement and define it to a certain extent... Thus if there is no single individual case in which demand and supply actually do coincide, their disproportions still work out in the following way - and the result of a divergence in one direction is to call forth a divergence in the opposite direction - that supply and demand always coincide if a greater or lesser period of time is taken as a whole; but they coincide only as the average of the movement that has taken place and through the constant movement of their contradiction. (C.III. 291; emphasis added) In Chapter 11, Marx considered the question of the effect of a general change of wages on the prices of production of commodities. Marxs conclusion is well-known: that the effect of the change of wages on prices of production of commodities depends on the composition of capital with which these commodities were produced. For commodities produced with greaterthan-average / average / less-than-average composition of capital, a change of wages would result in an increase / no change / decrease in the prices of production. At the end of this chapter, Marx briefly noted that he is assuming in this chapter that the prices of the means of subsistence remain constant. Hence, his analysis of changing nominal wages implicitly assumes that real wages are changing. Once again we see that changing real wages is another possible cause of changes in prices of production, in addition to changes in the productivity of labor. Chapter 12 collects several supplementary remarks, the first of which is another brief consideration of the possible causes of changes in prices of production. The price of production of a commodity can vary for only two reasons: (1) A change in the general rate of profit. This is possible only if the average rate of surplus-value itself alters, or, given an average rate of surplus-value, the ratio between the sum of surplus-value appropriated and the total social capital advanced. In so far as the change in the rate of surplus-value does not rest on the depression of wages below their normal level, or a rise above this - and movements like this are never more than oscillations - it can occur only because the value of laborpower has either fallen or risen; both of these are impossible without a change in the productivity of labor of that labor that produces the means of subsistence, i.e. without a change in value of the commodities that are consumed by the worker. Alternatively, there may be a change in the ratio between the sum of surplusvalue appropriated and the total social capital advanced... If the same labor sets more constant capital in motion, it has become more productive, and vice versa. Thus a change has taken place in the productivity of labor and a change must have occurred in the value of certain commodities... (2) The general rate of profit remains unaltered. In this case the production price of a commodity can change only because its value has altered; because more or less labor is required for its actual reproduction, whether because of a change in the productivity of labor that produces the commodity in its final form, or in that of the labor producing those commodities that go towards producing it. The price of production of cotton yarn may fall either because raw cotton is produced more cheaply, or because the work of spinning has become more productive as a result of better machinery... All changes in the price of production of a commodity can be ultimately reduced to a change in value ... (pp. 307-08) In this remark, Marx seems to be assuming that the real wage remains constant, since he says that a change in the value of labor-power is impossible without a change in the productivity of labor in the production of the workers means of subsistence. On the basis of this assumption, all changes in the price of production of a commodity can be ultimately reduced to a change in the value of commodities due to a change in the productivity of labor somewhere in the economy, as Marx emphasized in his previous writings on this question. In the remainder of the Volume 3 manuscript, Marx continued to assume that commodities exchange at their prices of production. In Part 4, Marx modified his theory of prices of production to take into account commercial capital and commercial profit. Parts 5 and 6 explain how parts of the prices of production of commodities become interest for lenders and rent for landlords. Part 7 summarizes Marxs theory of the distribution of surplus-value presented in Volume 3, on the continued assumption that commodities exchange at their prices of production.3 In the remainder of Volume 3, Marx occasionally touched on the issues we have been discussing. All these later statements are entirely consistent with the passages we have examined above - that prices of production are long-run prices that equalize profit rates and that are the centers of gravity around which market prices fluctuate. To give a few examples: If supply and demand coincide, the market price of the commodity corresponds to its price of production, i.e. its price is then governed by the inner laws of capitalist production, independent of competition, since fluctuations in supply and demand explain nothing but divergences between market prices and prices of production - divergences which are mutually compensatory, so that over certain longer periods the average maket prices are equal to the prices of production. (pp. 477-78; emphasis added) If the prices of commodities in one sphere are below or above their prices of production ... , an equalization takes place by the expansion or contraction of production, i.e. an increase or decrease in the quantity of commodities that those industrial capitals put on the market, mediated by the immigration or emigration of capital with respect to these particular spheres of production. It is this equalization brought about in this way, whereby the average market prices of commodities are reduced to their prices of production, that corrects divergences between the particular rates of profit and the general or average profit rate. (p. 489; emphasis added) The general observation we have so far made on the credit system are as follows: I. Its necessary formation to bring about the equalization of the profit rate or the movement of this equalization, on which the whole of capitalist production depends. (p. 566) The prices of production arise from an adjustment of commodity values under which ... the total surplus-value is distributed not in the proportion in which it is produced in the individual spheres of production ... but rather in proportion to the size of the capitals advanced. It is only in this way that an average profit arises, and a production price for commodities can be arrived at, the characteristic element of which is the average profit. It is the constant tendency of capitals to bring about, by competition, this adjustment in the distribution of surplus-value that the total capital produces, and to overcome all obstacles towards it... This presupposition, however, depends as already explained on the continuously changing proportionate distribution of the total social capital between the various spheres of production; on a continuous immigration and emigration of capitals; on their transferability from one sphere to another; in short, on their free movement between these various spheres of production ... It is assumed in this connection that no barriers, or at least only accidental and temporary ones, prevent the competition of capitals ... from reducing value to prices of production ... (pp. 895-96; emphasis added) The division of the social profit as measured by this [general rate of profit] ... produces prices of production which diverge from commodity values and which are the actual averages governing market prices. But this divergence from values abolishes neither the determination of prices by values nor the limits imposed on profit by our laws... Market prices rise above these governing production prices or fall below them, but these fluctuations balance each other out. If one compares price lists over a prolonged period, and ignores those cases in which the actual value of a commodity alters as a result of a change in labor productivity, as well as cases in which the production process is disturbed by natural or social disasters, it is surprising both how narrow the limits of these divergences are and how regularly they are balanced out. (pp. 999-1000; emphasis added) Shortly after finishing the Volume 3 maunscript, Marx wrote an address entitled Wages, Price, and Profit which he delivered to the General Council of the First International in June 1865. Marxs address touched briefly on the points we have discussed above, and once again (and not surprisingly), what Marx said about these points in this address is essentially the same as in the manuscripts we have examined above. For the purpose of this public lecture, Marx simplified and did not distinguish between value and price of production. But other than that, Marx repeated our familiar themes. Especially striking is the repeated use of value and natural price as synonyms. What would be the consequence of this difference in the rates of profit for capitals employed in the different branches of industry? Why, the consequence that generally obtains whenever, from whatever reason, the average rate of profit comes to differ in different spheres of production. Capital and labor would be transferred from the less remunerative to the more remunerative branches; and this process of transfer would go on until the supply in the one department of industry would have risen proportionally to the increased demand. This change effected, the general rate of profit would again be equalized in the different branches. As the whole derangement originally arose from a mere change in the proportion of the demand for, and the supply of, different commodities, the cause ceasing, the effect would cease, and prices would return to their former level and equilibrium. (p. 190) Supply and demand regulate nothing but the temporary fluctuations of market prices. They will explain to you why the market price of a commodity rises above or sinks below its value, but they can never account for that value itself... At the moment when supply and demand equilibrate each other, and therefore cease to act, the market price of a commodity coincides with its real value, with the standard price round which its market prices oscillate. (p. 200) So far as it is but the monetary expression of value, price has been called natural price by Adam Smith and prix necessaire by the French physiocrats. What then is the relation between value and market prices, or between natural prices and market prices? ... (T)he ossicilations of market prices, rising now over, sinking now under the value or natural price, depend upon the fluctuations of supply and demand. The deviations of market prices from values are continual, but as Adam Smith says: The natural price ... is the central price to which the prices of all commodities are continually gravitating... I cannot sift this matter. It suffices to say that if supply and demand equilibrate each other, the market prices of commodities will correspond with their natural prices, that is to say, with their values, as determined by the respective quantities of labor required for their production. But supply and demand must constantly tend to equilibrate each other, although they do so only by compensating one fluctuation by another, a rise by a fall, or vice versa... (A)ll descriptions of commodities are, on the average, sold at their respective values or natural prices. The average periods during which the fluctuations of market prices compensate each other are different for different kinds of commodities, because with one kind it is easier to adapt supply to demand than with the other. (pp. 207-08) Finally, in April 1968, Marx wrote another valuable letter to Engels in which he summarized the overall contents of Volume 3. This summary is very interesting and illuminating in many respects. Part 2 is summarized succinctly and very clearly as follows: But out of these different rates of profit a mean or general rate of profit is formed by competition. This rate of profit, expressed in absolute terms, can be nothing else than the surplus-value produced (annually) by the capitalist class in relation to the total capital advanced by society as a whole... What competition between the various amounts of capital - which is invested in different spheres of production and have a different composition - is striving to produce is capitalist communism, namely the mass of capital belonging to each sphere of production receives an aliquot part of the total surplus value proportionate to the part of the total social capital which it constitutes. This can only be achieved if in each sphere of production ... the yearly output of commodities is sold as cost price plus 20 percent profit on the capital value advanced ... But this means that the prices of the commodities must deviate from their values... The price thus equalized, which distributes the social surplus value equally among the individual capitals in proportion to their size, is the price of production of commodities, the center around which the market prices oscillate. (pp. 19394; emphasis added) This is the last thing that Marx wrote about these issues of the equalization of profit rates, prices of production, market prices, etc. (at least that has been published, so far as I know). It seems clear that, to the end, Marxs thinking on these issues was essentially the same as that worked out in the 1861-63 manuscript in his critical study of Smiths and Ricardos theory of natural price: rates of profit tend to be equalized across industries (at least as an abstract assumption) and the prices of production that equalize profit rates are the centers of gravity around which market prices fluctuate over longer periods of time. 3. TSS INTERPRETATIONS 3.1 FREEMAN Alan Freeman (1995) argues that Marxs theory in Volume 3 of Capital is not primarily about prices of production, but is instead about market prices. Freeman states: (Marxs theory) is about general market prices. (p. 56; emphasis in the original) In a section entitled Market price and value, which is about the equalization of profit rates and the determination of prices, Freeman states that the prices being determined are not equilibrium prices. They are market prices of period 1, in general different from the market prices of period 0. (p. 74; emphasis added) Freemans main argument for this interpretation of Marxs theory seems to be that prices in the real world are disequilibrium market prices, not equilibrium prices of production, and Marxs theory is about real world prices. Any analysis of a real market economy has to explain trade at disequilibrium prices because they are the only prices anyone actually sees. The prices for which commodities sell are neither values nor prices of production, not in Marx nor in the real world. They are market prices, constantly in motion, never actually supply to demand. (p. 54-55; emphasis added) Thus, Freeman appears to ignore all Marx had to say in the 1861-63 manuscript and in the Volume 3 manuscript and elsewhere about the relation between prices of production and market prices in his theory, that we have reviewed above. These manuscripts clearly demonstrate, as we have seen, that Marxs theory in Volume 3 is about prices of production, which are long-run center-of-gravity prices. Market prices are abstracted from in order to focus the analysis on the long-run essential trends, rather then the temporary deviations. For textual evidence for his interpretation of Marxs theory, Freeman cites the following passage from the Poverty of Philosophy (written much earlier in 1847): it is the variations of supply and demand that show the producer what amount of a given commodity he must produce in order to receive in ex...

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Wake Forest - ATT - 0611
Imperialism, Intellectual Networks, and Environmental ChangeOrigins and Evolution of Global Environmental History, 1676-2000: Part IIThe first part of this article traced the early beginnings of environmental history that was framed largely in the conte
Wake Forest - ATT - 0611
NEW DIRECTIONS IN MARXIST THEORY Historical Materialism Annual Conference 2006, 8-10 December In association with Socialist Register and the Isaac and Tamara Deutscher Memorial Prize Committee Clore Management Centre, Birkbeck, and School of Oriental
University of Texas - M - 408D
Basic Mathematical Relations 1 e = lim1 + 2.718 n nLog and powernln x + ln y + L = ln xy L ,log a b = log c b , log c aln x ln y = ln log x = log10 x ,a x / a y = a x y ,x , ya ln x = ln x aln x = log e xa x a y a z = a x+ y+ z , Derivatives d
University of Texas - CH - 369
Announcements 1. Textbooks Bundled textbooks from co-op ~$95 Wileyplus + ebook $55 Wileyplus is open for a week to everyone 2. Icliker 3. contact Sarah Long for becoming a preceptor 4. Check blackboad for course info.Study groups The facebook group w
University of Texas - CH - 369
Figure 4.02 Structures and abbreviations of the 15 standard amino acids.ChymotrypsinCase Study of an EnzymeWhat Is an Enzyme?Acatalyst that accelerates the rate of chemical reaction. Mostly made of proteins. Recently, some RNA (ribozyme) has been fou
University of Texas - CH - 369
Biological membranesDistribution of Na+ and K + ions in an animal cell[Na+] = 150 mM [K+] = 4 mM[Na+] = 12 mM [K+] = 140 mMA lipid bilayer membraneHydrophilic head hydrophobic tailshydrophobic tails Hydrophilic headThe lipid bilayer forms spontaneo
University of Texas - CH - 369
Overview of Mammalian Metabolism and Free EnergyLearning Objectives Learn how foodstuffs are digested, absorbed stored and mobilized. Understand relationship between catabolic and anabolic pathways Understand role of oxidation and reduction in metabolis
University of Texas - CH - 369
Chapter 10 Glucose MetabolismFigure 10.01 Yeast cells.Common intermediates in different metabolic pathwaysStructure of glycogen.Figure 9.04b Structure of glycogene. Glucose is the most abundant organic molecule on earth. It plays a central role in me
University of Texas - CH - 369
Chapter 11 The Citric Acid Cycleor Tricarboxylic acid cycle ( TCA cycle ) or the Krebs cycleThe citric acid cycle in context.citric acid cycleUnlike a linear pathway such as glycolysis or gluconeogenesis, the citric acid cycle always returns to its st
University of Texas - CH - 369
Glucose metabolism Which glycolytic reactions consume ATP?A) hexokinase B) pyruvate kinase C) enolase D) A and B E) all of the above Which generate ATP?GlycolysisgluconeogenesisGlucose metabolism in context.Reactions of glycolysis.-2ATP+ 4ATP _ Ne
University of Texas - CH - 369
Food digestion and energy productionEnergy (ATP) Anaerobic aerobic 2 puruvte glycolysis Glucose CAC CO2+H2O 4 38 8e oxidativ Coupled lation osphory phATP synthesisFoodUncou pled oxidati ve phosph orylati onHeat productionHeat production Hibernatin
University of Texas - CH - 369
Lipids- Molecules includes fats and oils, waxes, phospholipids, steroids and cholesterol, and some other related compounds. - The common feature of lipid molecules is that they are water insolubleSeeds of the crossed turnip + cabbage plants Canola oilA
University of Texas - CH - 369
Chapter 4 Myoglobin and Hemoglobin: A Study of Protein Structure and FunctionLearning ObjectivesChapter 4 Myoglobin and Hemoglobin: A Study of Protein Structure and Function4. Understand the chemical characteristics of the R groups that distinguish the
University of Texas - CH - 369
Motor proteinsLessons from biological system Spider silk, made of a protein called fibroin, consists of Ala- and Gly-rich sheets interspersed with more amorphous segments of polypeptide.Cell migration and metastasisNormal functions Wound healing Fight
University of Texas - CH - 369
Motor proteinsLessons from biological system Spider silk, made of a protein called fibroin, consists of Ala- and Gly-rich sheets interspersed with more amorphous segments of polypeptide.Cell migration and metastasisNormal functions Wound healing Fight
University of Texas - CH - 369
Steady-state enzyme kineticsTherapeutic Drugs Efficacy ID50, IC50 Potency dosage Pharmacokinetics Drug metabolism toxicityWhich statement(s) is (are) true? A. The more catalyst present, the faster the reaction. B. As product is formed, substrate c
University of Texas - CH - 369
Chapter 12 oxidative phosphorylation o Reduction potential o Calculating standard free energy for oxidation/reduction reaction: (pg. 374-5) o Oxidative phosphorylation o Structure of the mitochondria: H+ concentration o Transporters: not all molecules can
University of Texas - CH - 353
Homework 1: Due at the beginning of class 02/11/09Problem 1. We have an ideal gas in a box, which we can expand as we like. Initially, the box has a volume of V and we expand it to 2V while keeping the internal gas pressure constant. You see that the tem
University of Texas - CH - 353
Homework 2: Due at the beginning of class 02/20/09Problem 1. In the questions below, say whether the statement is true or false. You dont need to present any explanation. However, understanding why you have the answer will help you to prepare the exam. (
University of Texas - CH - 353
Problem Set 3: Due by Mar. 13 in classProblem 1. At low temperatures, the heat capacity (at a constant pressure) of a solid is a function of temperature and specifically follows the law C P (T ) = aT 3 where a is a positive constant. This is what the Deb
University of Texas - CH - 353
Problem Set 4: Due by Mar. 30 in classProblem 1. One mole of ideal gas is compressed isothermally from 1 to 5 bar at 100 C. (a) What is the Gibbs energy change, G? (b) What would have been the Gibbs energy change if the compression had been carried out a
University of Texas - BIO - 325
CHAPTER 2 Single-Gene InheritanceCHAPTER OUTLINE2.2 2.3 2.1 2.5 2.6 Single-gene inheritance patterns The chromosomal basis of single-gene inheritance patterns Genes and chromosomes Sex-linked single-gene inheritance patterns Human pedigree analysisSing
University of Texas - BIO - 325
CHAPTER 3 Independent Assortment of GenesCopyright 2008 W H Freeman and CompanyCHAPTER OUTLINE3.1 3.2 3.3 3.4 3.5 Mendels law of independent assortment Working with independent assortment The chromosomal basis of independent assortment Polygenic inheri
University of Texas - BIO - 325
Outline for Chapters 2 and 31. Understanding Mendels experiments. Experiments in Plant Hybridization (1865) by Gregor Mendel http:/www.mendelweb.org/Mendel.plain.html Mendels law of equal segregation (section 2.2 in the text) alleles at a locus segregate
Texas A&M - CS - 0118
actagaagcggaagtagttgtgggcgcctttgcaaccgccccgagtggtctgtgcaggttcgcgggtcgctggcgggggttgcgccgggagcggagatatggagggagatggttcagaccagatgccggggaggacagcaagtccgagaatggggagaatactgcatctgccgcaaaccggacatcaactgcttcatgataactgcaatgagtggttccatggggactgcatccggatcaggccaaggc
Texas A&M - CS - 0118
gcgggatggcaatgagcgggacagcagtgagccccgggatgagggtggagggcgcaagaggcctgtccctgatccagacctgcagcgccgggcagggtcagggacaggggttggggccatgcttgctcggggctctgcttcgccccacaagcgcccatctactgcatctgccgcaaaccggacatcaactgcttcatgatcgggtgtgacaactgcaatgagtggttccatggggactgcatccggatca
Texas A&M - CS - 0118
agatggcggcgctgaggggtcttgggggctctaggccggccacctactggtttgcagcggagacgacgcatggggcctgcgcaataggagtacgctgcctgggaggcgtgactagaagcggaagtagttgtgggcgcctttgcaaccgcctgggacgccgccgagtggtctgtgcaggttcgcgggtcgctggcgggggtcgtgagggagtgcgccgggagcggagatatggagggagatggttcagacc
FIU - WEEK - 2210
FIU - WEEK - 2210
ArrayObjectives To understand the concept of arrays To understand the purpose to which we use arrays. To be able to declare references to arrays. To be able to create one-dimensional and two-dimensional arrays. To be able to initialize one-dimensional an
FIU - WEEK - 2210
Data Types Reference TypesObjective To understand what reference types are The need to study reference types To understand Java standard packages To differentiate between Java defined types and user defined types To have a deeper understanding of the Str
FIU - WEEK - 2210
Data Types and Operations On DataObjective To understand what data types are The need to study data types To differentiate between primitive types and reference types To know the data range and storage requirements for each type To know the conditions fo
FIU - WEEK - 2210
4.Data Types and Operations On DataObjective To understand what data types are To understand the reason for studying data types To differentiate between primitive types and reference types To know the range and storage requirements for each data t
University of Texas - CH - 369
Announcements 1. Textbooks Bundled textbooks from co-op ~$95 Wileyplus + ebook $55 Wileyplus is open for a week to everyone 2. Icliker 3. contact Sarah Long for becoming a preceptor 4. Check blackboad for course info.Study groups The facebook group w
University of Texas - BIO - 325
CHAPTER 4 Mapping Eukaryote Chromosomes by RecombinationCopyright 2008 W H Freeman and CompanyA recombination-based map of one of the chromosomes of DrosophilaChapter 4 OpenerCHAPTER OUTLINE4.1 Diagnostics of linkage 4.2 Mapping by recombinant freque
University of Texas - BIO - 325
CHAPTER 5 The Genetics of Bacteria and Their VirusesCopyright 2008 W H Freeman and CompanyCHAPTER OUTLINE5.1 5.2 5.3 5.4 5.5 5.6 Working with microorganisms Bacterial conjugation Bacterial transformation Bacteriophage genetics Transduction Physical map
University of Texas - BIO - 325
CHAPTER 6 Gene InteractionCopyright 2008 W H Freeman and CompanyCHAPTER OUTLINE6.1 Interactions between the alleles of a single gene: variations on dominance 6.2 Interaction of genes in pathways 6.3 Inferring gene interactions 6.4 Penetrance and expres
University of Texas - BIO - 325
CHAPTER 7 DNA: Structure and ReplicationCopyright 2008 W H Freeman and CompanyCHAPTER OUTLINE7.1 7.2 7.3 7.4 7.5 7.6 7.7 DNA: the genetic material The DNA structure Semiconservative replication Overview of DNA replication The replisome: a remarkable re
University of Texas - BIO - 325
CHAPTER 8 RNA: Transcription and ProcessingCopyright 2008 W H Freeman and CompanyCHAPTER OUTLINE8.1 8.2 8.3 8.4 RNA Transcription Transcription in eukaryotes Functional RNAsRNA polymerase in actionChapter 8 OpenerRNAEukaryotic mRNA moves from nucle
University of Texas - BIO - 325
CHAPTER 9 Proteins and Their SynthesisCopyright 2008 W H Freeman and CompanyCHAPTER OUTLINE9.1 9.2 9.3 9.4 9.5 9.6 Protein structure Colinearity of gene and protein The genetic code tRNA: the adapter Ribosomes The proteomeSurface of the ribosome from
University of Texas - BME - 311
BME 311 Network (Circuit) TheorySpring 2008-2009 MWF 9-10 AM, BUR 112Instructor: Office: Professor John X.J. Zhang Department of Biomedical Engineering, BME5.202-O, UT-Austin main campus Microelectronics Research Center, 2.206W, UT-Austin Pickle Researc
University of Texas - BME - 311
Review Question 1 Simplify the following units. Try to express each as a single unitBME 311 Network TheoryJohn X.J. Zhang, UT Austin1Review Question 2 The current flowing through a wire is given by the following figure. Sketch the net charge moving
University of Texas - BME - 311
Basic Circuit Analysis Ohm's law Concepts of nodes, branches, and loops Kirchhoff's current and voltage laws Combining resistors in series and in parallel Principles of voltage division and current division Wye-delta transformationBME 311 Network Theor
University of Texas - BME - 311
BME 311 Office HoursTeaching Assistant: Tushar Sharma (BME) Email: tush.shar@gmail.com Office hour: Monday 3:30pm 5:30pm, BME4.202G, or by appointment Teaching Assistant: Dian (Oscar) Jiao (BME) Email: jiaodian@mail.utexas.edu Office hour: Tuesday 2:00pm
University of Texas - BME - 311
Methods of Analysis Nodal Analysis Systematic application of KCL Mesh analysis Systematic application of KVLWe can analyze any linear circuit by obtaining a set of simultaneous equations that are then solved to obtain I or V - Cramers Rule - Matrix i
University of Texas - BME - 311
Nodal vs. Mesh Analysis Nodal Analysis # of node equations < # of mesh equations KCL on nodes node voltages Planar and nonplanar circuits Op amp circuit Mesh Analysis # of mesh equations < # of node equations KVL around meshes mesh currents Planar cir
University of Texas - BME - 311
This Lecture Linear Circuit Simplify circuit analysis using circuit theorems Circuit Theorems Thevenins Theorem Nortons TheoremBME 311 Network TheoryJohn X.J. Zhang, UT Austin1Linear System Linearity linear relationship between input (excitation
University of Texas - BME - 311
Nortons Theorem A linear two-terminal circuit can be replaced by an equivalent circuit consisting of a current source IN in parallel with a resistor RN. IN : short-circuit current RN :the input resistance at the terminals when the independent sources ar
University of Texas - BME - 311
Operational Amplifiers (Op Amp) V (I) controlled V (I) source Active or passive element ? Perform math operations Addition Subtraction Multiplication Division Integration DifferentiationBME 311 Network TheoryJohn X.J. Zhang, UT Austin1Key Points o
University of Texas - BME - 311
Ideal Op Amp The current into both input terminals are zeroi1=0, i2=0 The voltage across the input terminals is equal to zerov1 = v2BME 311 Network TheoryJohn X.J. Zhang, UT Austin1Inverting Amplifier Key feature Input signal is applied at the i
University of Texas - BME - 311
Inductors Inductor Consists of a coil of conducting wire (bulky, expensive)v=L di dt Inductance L Property of opposition to the change of current (Unit: Henry, H)N 2 A L= lBME 311 Network TheoryJohn X.J. Zhang, UT Austin1 Typical inductor value:
University of Texas - BME - 311
Chapter 6 Capacitor Definition Energy, power Series and parallel capacitors Inductor Definition Series and parallel capacitorsBME 311 Network TheoryJohn X.J. Zhang, UT Austin1Capacitors and Inductors Capacitor two conducting plates separated by a
University of Texas - BME - 311
First-order Circuits Characterized by a first-order differential equation RC, RL Two way of excitations Source-free Independent sources (dc, sinusoidal, exponential)v(t ) = V0 et RC= V0 et?Where, = RCBME 311 Network Theory John X.J. Zhang, UT Aust
University of Texas - BME - 311
University of Texas - CH - 353M
R = 8.314 J/(K mol), 1bar = 105 Pa, 1 L =10-3 m31. True/False (10 points each). Classify the statements below as either True or False (No explanation required). (a) At T = 0 K, the entropy of a substance becomes zero. (b) A very stiff, rigid solid like d
University of Texas - CH - 353M
Practice Exam 1 R = 8.314 J/(K mol), 1bar = 105 Pa, 1 L =10-3 m31. True/False. Classify the statements below as either True or False (No explanation required). (a) If you know the pressure, temperature and the number of moles of a gas, you have all the i
University of Texas - BME - 311
Review ReviewSessionTusharImportant ImportantPoints LabeltheDiagram VoltageDifferencevs.AbsoluteVoltage ZeroPotential KCLvs.KVL:Whichonetouse? Commonmistakes: DependentsourcesorVoltage/Current Connectingwires Branchcurrentvs.MeshCurrentDisclaimer! Di
University of Texas - CH - 353M
CHEM 353M (Unique: 53415) Physical Chemistry I for Life Sciences Time and Place: Spring 2009 WEL 1.316 Mon/Wed/Fri, 1 pm-2 pm Instructor: Sang-Hyun Lim shlim@mail.utexas.edu - E-mail is the best way to contact me WEL 3.120A, 471-0872 Office hours: Mon/Tu
University of Texas - CH - 353M
First LawdU = TdS PdV dH = TdS + V dP dA = SdT PdV dG = SdT + V dPMaxwell Relations S V = P T T P T P = S V V S V T = P S S P S P = V T T VFor Gibbs Free Energy, G G = S and T P G =V P TH (G / T ) T = T 2 (Gibbs-Helmholtz Equation) PC V dS = dP + P
University of Texas - REE - 302
The University of Texas at Austin Department of Slavic and Eurasian Studies Fall 2009INTRODUCTION TO SLAVIC CIVILIZATIONSLA 301 (46195), REE 302 (45685), CL 305 (33295), EUS 307 (36425)The Vampire in Slavic Cultures - , . e . e , , , . e , . , . ,
University of Texas - REE - 302
The University of Texas at Austin Department of Slavic and Eurasian Studies http:/www.utexas.edu/cola/depts/slavic/INTRODUCTION TO SLAVIC CIVILIZATIONSLA 301 (46195), REE 302 (45685), CL 305 (33295), EUS 307 (36425) . , . . . , , . . ! . , . . , , . . !
University of Texas - REE - 302
NeuronsThe ow of information through a neuronThe ow of information from neuron to neuronThe SynapseSynapseIonic currents to chemical diffusion to ionic currentsSynapseIonic currents to chemical diffusion to ionic currents Site of regulation, compil