17: Lecture DNA CLONNING
Allows manipulation of a specific fragment of DNA in the test tube Reintroduced into cells and grown in large quantities (cloned) Any gene can be isolated, amplified, sequenced and modified for further study
Problems in working with DNA
DNA fragments of different genes have the similar shape and similar charge to mass ratio, so one gene cannot be easily distinguished from another like proteins. Genes are all connected in vast DNA molecules, each gene is a very small fraction of the entire genome, so a gene can not be isolated like a protein
1
CLONING
Clone: Collection of cells originated from a single cell. Collection of cells containing the identical type of DNA Collection of identical DNA fragments. ...... Collection of anything that is identical to each other and to the parent (we are not the clone of either of our parents). Cloning is to make a lot of identical copies of a DNA molecule, or a cell, or an organism. A gene is cloned (= a gene is isolated) means that the recombinant DNA containing the target gene inserted in the vector has been identified, the recombinant DNA can be propagated indefinitely, the DNA insert (the target gene) can be cut out from the vector DNA using restriction enzyme(s) and purified away from the vector DNA whenever it is needed.
Why need to isolate or clone a gene?
1. To study how genes and proteins function in the cell, and how cells function in an organism e.g. when and where is a gene expressed? Where is the protein located in the cell? how is gene expression regulated? How does a gene act to make the cell functional? How are individual genes involved in a particular disease? 2. To make therapeutical proteins (recombinant protein drugs) 3. To replace the bad gene in a patient (gene therapy) 4. To make improved agriculture animals and crops (GM food)
2
How can we clone and amplify a gene?
The best way to clone a DNA is to have a cell replicate it for us. However, a DNA fragment is generally not replicated in a cell, and it may be lost during cell division and cannot be cloned. In order to make multiple copies of a given DNA fragment in cells, it needs to be placed (ligated or inserted) in a vector Insert: The piece of DNA you want to amplify. Vector: a self-replicating DNA such as a plasmid or a virus that exist in multiple copies in the cell.
A vectors has three features:
(1). a replicon It is the region that is essential for the replication of the plasmid. most plasmids used in DNA cloning are derivatives of the E. coli plasmids containing a ColE1 replicon. (2) a selection marker A selection marker is often a bacterial gene that confers antibiotic resistance, which is included in the vector for the purpose of easy selection, some of the often used antibiotic resistance are ampr, kanr, tetr, etc. (3) a polylinker A polylinker is a small region of DNA that contains multiple restriction sites, these restriction sites are usually not found in other places of the plasmid. It used for the insertion of foreign DNAs. (4). Others other sequences for specific purposes, e.g. promoters and Shine Dalgarno sequence, promoters, etc. can also be included in a vector for different purposes . A polylinker sequence can be placed in the middle of a second marker gene (such as lacZ) so that the successful insertion of a DNA fragment will disrupt the second marker gene and allow the identification of clones containing the insert by a color selection.
3
Plasmid vectors
- used to clone small DNA fragments
1. Plasmids are extra-chromosomal self-replicating dsDNA, they replicates separately from a cells chromosomal DNA 2. Plasmids are found naturally in bacteria, but also in some eukaryotes including yeast, they exist in a parasitic or symbiotic relationship with their hosts. The plasmid vectors used in molecular biology are all extensively modified. 3. Plasmid vectors used in DNA cloning are generally small (ca. 3 kb) circular dsDNAs and they usually hold relatively small DNA fragments (e.g.<5 kb).
Three critical components of a plasmid vector: Ori, polylinker, and selectable marker
Polylinker
contains multiple restriction sites, it is where the recombinant DNA will be inserted. The restriction sites in the polylinker should not be found in other places of the plasmid
Ori is the origin of replication. Ori allows the plasmid to replicate in a host bacterium cell
Selectable marker is a gene encoding the enzyme that allows the bacterial cell to grow in the condition that kills cells that don't have the plasmid. For example, ampr selectable marker allows bacteria to be resistant to ampicillin
4
Plasmids have their own origin of replication.
Antibiotics resistant genes often encode enzymes that degrade or modify the respective antibiotic compound, making it incapable of killing bacterial cells
Antibiotics are organic compounds which inhibit specific enzymes in prokaryotes, but not in eukaryotes Ampicillin Amp inhibits cell wall synthesis A plasmid contains an ampicillin resistant gene can grow in medium containing ampicillin, whereas bacterial cells containing no plasmid will not grow. Tetracycline Tet inhibits protein synthesis by binding to bacterial 30S ribosomal small subunit, interfering with the binding of tRNA to mRNA and translation. Chloramphenicol Chl inhibits protein synthesis by binding to the bacterial 70S ribosome large subunit.
5
Polylinker (or multiple cloning site)
Why needs so many restriction enzyme sites? - One vector can be used to clone different DNAs - a DNA cut with two different restriction enzymes allow the fragment to be cloned with certain orientation.
Cloning a DNA fragment
Using restriction enzymes and DNA Ligase, one can recombine DNA molecules
6
DNA ligation
Ligation of Restriction Fragments with Complementary Sticky Ends via T4 Ligase used for inserting DNA into a vector to make recombinant DNA
Covalently joins two DNA molecules Requires ATP, 5 Phosphate, 3 OH Can join compatible sticky ends or two blunt ends but not incompatible ends
Compatible vs. Incompatible Ends
Mbo I GATC CTAG GGATCC CCTAGG GAATTC CTTAAG CCCGGG GGGCCC GATC CTAG
Bam HI
Eco RI
Sma I
Compatible ends for ligation are blunt to blunt or two sticky ends with the exactly same overhanging sequences Incompatible ends are blunt to sticky or sticky ends with different overhanging sequences
Dpn I
7
Transformation
Stable introduction of a foreign or recombinant DNA into bacteria is referred to as transformation. A recombinant DNA needs to be put into the bacterial cell in order for it to be propagated. of Methods transformation 1. CaCl2 Treatment of cells with CaCl2 can help a cell to engulf the foreign DNA (both prokaryote and eukaryote) 2. Electroporation A foreign DNA can be shoot into the cell by a high electric voltage (both prokaryote and eukaryote) 3. Micro-injection A foreign DNA can be injected using a microinjector (only eukaryotic cell, prokaryote is too small for this method) An important feature of transformation Transformation of one plasmid will prevent other plasmids from transforming the same cell. Therefore, a cell can only be transformed once. That is why we can get "clones".
DNA Cloning in a Plasmid Vector -> Amplification of cloned DNA Fragment
re
8
Summary of DNA cloning
1. Purify DNA that contains the fragment needs to be cloned. 2. cut it with a restriction enzyme, and purify the fragment that is to be cloned. 3. Cut vector DNA with the same restriction enzyme or enzymes resulting in Compatible ends 4. ligate insert and vector DNAs 5. Transform the ligation product to E. coli. 6. Growing transformed bacterial cells on selection medium (e.g. ampicillin), and select those colonies that can grow. 7. Verify the plasmid purified from the selected colony. Each colony has millions of bacterial cells all contain the same plasmid.
Additional Vectors used for cloning
Phage (Lamda or P1): bacterial virus, phage genomes are usually linear DNA, and those used for vector are often extensively modified. Cosmid: hybrid of plasmid and phage. It is circular vector and replicates as a plasmid, and can also be packaged as phage particles in vitro. BAC (bacterial artificial chromosome), containing the Ori of the F-plasmid and gene encoding Ori-binding protein, so it replicate like a plasmid but can hold much more DNA. YAC (yeast artificial chromosome), they are linear DNA plasmid containing the yeast centromere sequence (as replicon) and telomere sequence (at both ends). YAC are eukaryote plasmid.
9
Different vectors have different cloning capacity
Because plasmids vector are generally small, they can not hold a large DNA insert. Other types of vector may be used to clone a large piece of DNA.
(usually: 2-5kb insert)
<
Phage vectors
- used to clone large DNA fragments
1. A phage vector is larger (e.g. 50 kb) than a plasmid vector (usually 3-5 kb), so it can hold DNA fragment much larger (up to 30 kb) than that can be tolerated by a plasmid vector (up to 5 kb). A phage vector also has 3 basic sequences required for a plasmid vector. 2. Unlike a circular plasmid vector, phage vector is usually a linear DNA. 3. Unlike plasmid clones that can be recognized as bacterial colonies, phage clones are visualized as plaques (dead cells). 4. Unlike a plasmid for which the naked DNA is transformed into bacterial cells, recombinant phage DNAs need to be packaged into the phage protein coats, and the packed phage particles can infect the bacterial host by simple mixing of the two.
10
Each phage plaque contains millions of the identical phage particles that have the identical DNA
Bacteriophage (lambda)
Bacteriophage l genome is a linear DNA. A non-essential region in the middle (diagonal lines) of the Lambda genome can be deleted and replaced with up to ~25kb of foreign DNA. New phage particles can be assembled by mixing recombinant phage genomic DNA with preassembled phage head and tail protein complexes. Advantages in using phage vector 1. Can hold large insert 2. Easier to get into bacterial cells 3. Unit density of phage plaque on growth medium is much larger than that of colonies.
11
Using a phage vector in DNA cloning
Insert DNAs and phage vector DNA are digested with the same restriction enzym, and ligated together. Each phage particle contains only one phage DNA
The recombinant DNAs are mixed with a pre-prepared phage coat protein mixture and used to infect the bacterial host cells. The infection is such that one cell is infected only once with one phage particle. Therefore, like colonies resulting from plasmid transformation, plaques formed by phage infection are clones. Each plaque contains millions of dead bacterial cells all have the identical phages
12
BAC Vector
A bacterial artificial chromosome (BAC) is a DNA construct, based on a functional fertility plasmid (or F-plasmid), used for transforming and cloning in bacteria, usually E. coli. Fplasmids play a crucial role because they contain partition genes that promote the even distribution of plasmids after bacterial cell division. The bacterial artificial chromosome's usual insert size is 150-350 kbp, but can be greater than 700 kbp.
13
Subcloning from YAC to BAC to Lambda to Plasmid
1-mb Insert (YAC)
300 kb Insert (BAC)
20-kb Inserts (Lambda)
1-5 kb Inserts (Plasmid) 3 Billion base pair genome
PCR cloning
Synthesize primers according to the sequence of the DNA to be cloned
-Isolate genomic DNA -Anneal to primers spanning the region that needs to be cloned. The primers are synthesized short DNA that contain restriction sites -PCR reaction -Cut and clone into a vector -using PCR, one can clone a piece of DNA without a DNA library.
PCR
Restriction digestion
14
RT-PCR Reverse transcription PCR
RT-PCR allow amplification of a specific mRNA from the mixture of RNA. It is widely used in the direct cloning of a single expressed gene from cells expressing about 5009 different genes.
cDNA1
mRNA of sample 1
RT
PCR
cDNA2
mRNA of sample 2
ssDNA
Expression Vectors
An expression vectors allows amplification and expression of the gene of interest. In addition to the replication origin and a bacterial section marker such as Amp, an expression vector also needs promoter elements to drive mRNA transcription and translational elements including ribosome binding sequence (Shine Dalgarno or Kozak sequence), translational initiation and stop codon to help translate mRNA into protein. Additional components: Mammalian cell selectable markers such as neomycine or puromycine resistant genes ( for expression the gene of interest in mammalian cells. Tag or fusion protein at the N- or C-terminal of the protein of interest. Cleavage sites to cut the protein of interest
Amp
Promoter Selectable Marker (Mammalian cells)
15
Translation frame issue for expression cloning
Which of the following fragment will lead to poly-Lysine peptide with N-terminal Flag tag and C-terminal c-Myc tag after cloning into the vector below with Bgl II and Sal I sites?
1. AACAGATCTAAGAAGAAGAAGAAGAAGGTCGACCTC 2. AACAGATCTGAAGAAGAAGAAGAAGAAGGTCGACCTC 3. AACAGATCTGGAAGAAGAAGAAGAAGAAGGTCGACCTC
16