CH4
57 Pages

CH4

Course Number: BIO bio 183, Spring 2010

College/University: N.C. State

Word Count: 1240

Rating:

Document Preview

UNIT II. Cell Chapter 4 General Features of Cells 1 CO 4 Student Learning Outcomes: Describe various microscopic techniques, emphasizing differences in resolution and contrast. Compare and contrast basic cell structure between prokaryotes and eukaryotes. Highlight important structural characteristics and cellular functions of cytoskeletal elements. Define the term semiautonomous, and outline the general...

Unformatted Document Excerpt
Coursehero >> North Carolina >> N.C. State >> BIO bio 183

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

II. UNIT Cell Chapter 4 General Features of Cells 1 CO 4 Student Learning Outcomes: Describe various microscopic techniques, emphasizing differences in resolution and contrast. Compare and contrast basic cell structure between prokaryotes and eukaryotes. Highlight important structural characteristics and cellular functions of cytoskeletal elements. Define the term semiautonomous, and outline the general functions of organelles that fall into this category. 3 Cell theory (p. 61) 1. 2. 3. All living things are composed of one or more cells Cells are the smallest units of living organisms New cells come only from pre-existing cells by cell division 4 Microscopy (pp. 61-64) Magnification Ratio between the size of an image produced by a microscope and its actual size to observe two adjacent objects as distinct from one another be enhanced using dyes 5 Resolution Ability Contrast Can Light microscope Uses light for illumination Resolution 0.2 m Electron microscope Uses an electron beam Resolution 2 nm 6 Fig. 4.1, p. 62 Electron microscopes Transmission electron microscopy (TEM) Thin slices stained with heavy metals Some electrons are scattered while others pass through to form an image Scanning electron microscopy (SEM) Sample coated with heavy metal Beam scans surface to make 3D image 8 Fig. 4.3, p. 63 Prokaryotic cells (pp. 64-65) Simple cell structure Lack a membrane-enclosed nucleus 2 categories- bacteria and archaea Both small Bacteria- abundant, most not harmful Archaea- less common, often found in extreme environments 10 Typical bacterial cell Plasma membrane Cytoplasm Nucleoid Ribosomes 11 Fig. 4.4, p. 65 Typical bacterial cell Plasma membrane- barrier Cytoplasm- contained inside plasma membrane Nucleoid- region where genetic material found Ribosomes- involved in protein synthesis 13 Eukaryotic cells (pp. 65-67) DNA housed inside nucleus Eukaryotic cells exhibit compartmentalization Organelle- subcellular structure or membrane-bounded compartment with its own unique structure and function Shape, size, and organization of cells vary considerably among different species and even among different cell types of the same species 14 Fig. 4.6, p. 66 Fig. 4.6a, p. 66 Fig. 4.7, p. 67 Cytosol (pp. 68-75) Region of a eukaryotic cell that is outside the cell organelles but inside the plasma membrane Cytoplasm includes everything inside the plasma membrane Cytosol, the endomembrane system and the semiautonomous organelles 18 Fig. 4.8, p. 68 Metabolism Cytosol is central coordinating region for many metabolic activities of eukaryotic cells Catabolism- breakdown of a molecule into smaller components Anabolism- synthesis of cellular molecules and macromolecules 20 Translation Process of polypeptide synthesis Information within a gene is ultimately translated into the sequence of amino acids in a polypeptide Ribosome- site of synthesis Transfer RNA (tRNA)- brings amino acids Messenger RNA (mRNA)- information to make a polypeptide 21 Fig. 4.9, p. 69. Translation Cytoskeleton Network of three different types of protein filaments Microtubules Intermediate filaments Actin filaments (microfilaments) 23 p. 70 Motor Proteins Category of cellular proteins that use ATP as a source of energy to promote movement 25 Fig. 4.10, p. 71 Fig. 4.10c, p. 71 Flagella and cilia Flagella usually longer than cilia and present singly or in pairs Cilia are often shorter than flagella and tend to cover all or part of the surface of a cell Share the same internal structure 28 Fig. 4.11, p. 72. Flagella and Cilia Fig. 4.12, p. 73. Structure of a Eukaryotic Flagellum Sheetz and Spudich Show That Myosin Walks Along Actin Filaments (pp. 73-74) Early researchers proposed the sliding-filament model based on work with living cells in vivo 1983, Michael Sheetz and James Spudich devised an approach to study myosin in vitro Nitella cells were used as a source of actin filaments Myosin was purified and attached to a fluorescently labeled bead Confirmed that myosin is a motor protein that uses ATP to walk along actin All that filaments is needed for movement are actin, myosin, and ATP Fig. 4.14, p. 74 Endomembrane system (pp. 75-80) Network of membranes enclosing the nucleus, endoplasmic reticulum, Golgi apparatus, lysosomes, and vacuoles Also includes plasma membrane May be directly connected to each other or pass materials via vesicles 33 Fig. 4.15, p. 75. The Nucleus and Endomembrane System Nuclear envelope (pp. 75-76) Double-membrane structure enclosing nucleus Outer membrane of the nuclear envelope is continuous with the endoplasmic reticulum membrane Nuclear pores provide passageways Materials within the nucleus are not part of the endomembrane system 35 Fig. 4.16, p. 76 Nucleus (pp. 75-76) Chromosomes Composed Chromatin of DNA and protein Primary function involves the protection, organization, and expression of the genetic material Ribosome assembly occurs in the nucleolus 37 Fig. 4.16-3, p. 76 Endoplasmic reticulum Network of membranes that form flattened, fluidfilled tubules or cisternae ER membrane encloses a single compartment called the ER lumen Rough endoplasmic reticulum (rough ER) Studded with ribosomes Involved in protein synthesis and sorting Smooth endoplasmic reticulum (smooth ER) Lacks ribosomes Detoxification, carbohydrate metabolism, calcium balance, synthesis and modification of lipids 39 Fig. 4.18, p. 77. Endoplasmic Reticulum Endoplasmic reticulum Network of membranes that form flattened, fluidfilled tubules or cisternae ER membrane encloses a single compartment called the ER lumen Rough endoplasmic reticulum (rough ER) Studded with ribosomes Involved in protein synthesis and sorting Smooth endoplasmic reticulum (smooth ER) Lacks ribosomes Detoxification, carbohydrate metabolism, calcium balance, synthesis and modification of lipids 41 Golgi apparatus Also called the Golgi body, Golgi complex, or simply Golgi Stack of flattened, membrane-bounded compartments, which are not continuous with the ER Vesicles transport materials between stacks Three overlapping functions Secretion, processing, and protein sorting 42 Fig. 4.19, p. 78. The Golgi Apparatus and the Secretory Pathway Lysosomes Contain acid hydrolases that perform hydrolysis Many different types of acid hydrolases to break down proteins, carbohydrates, nucleic acids, and lipids Autophagy Recycling of worn-out organelles through endocytosis 44 Fig. 4.20, p. 79. Autophagy Vacuoles (pp. 79-80) Functions of vacuoles are extremely varied, and they differ among cell types and even environmental conditions 46 Plasma membrane (p. 80) Boundary between the cell and the extracellular environment Membrane transport in and out of cell Selectively permeable Cell signaling using receptors Cell adhesion 47 Fig. 4.22, p. 80 Semiautonomous organelles (pp. 80-83) Can grow and divide to reproduce themselves, but they are not completely autonomous because they depend on other parts of the cell for their internal components Mitochondria, chloroplasts, and peroxisomes 49 Fig. 4.23, p. 81 Mitochondria Outer and inner membrane Intermembrane space and mitochondrial matrix Primary role is to make ATP Also involved in the synthesis, modification, and breakdown of several types of cellular molecules Can also generate heat in brown fat cells 51 Fig. 4.24, p. 81 Chloroplasts Photosynthesis capture light energy and use some of that energy to synthesize organic molecules such as glucose Found in nearly all species of plants and algae Outer and inner membrane with an intermembrane space Third membrane, the thylakoid membrane, forms flattened tubules that stack to form a granum (plural, grana) 53 Fig. 4.25, p. 82 Peroxisomes Relatively small organelles found in all eukaryotic cells Origin remains controversial General function to catalyze certain chemical reactions, typically those that break down molecules by removing hydrogen or adding oxygen Reaction by-product is hydrogen peroxide (H2O2) Catalase breaks down H2O2 without forming dangerous free radicals 55 Fig. 4.27, p. 83. Structure of a Peroxisome Fig. 4.26, p. 82. Types of Plastids

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

N.C. State - BIO - bio 183
UNIT II. Cell Chapter 8Photosynthesis1CO 8Student Learning Outcomes:Describe the balance between respiration and photosynthesis that sustains life in the biosphere. Explain the molecular basis of energy generated as a result of electron transport. Fo
N.C. State - BIO - bio 183
UNIT III. Genetics Chapter 16Simple Patterns of Inheritance1Student Learning Outcomes: Explain the laws of segregation and independent assortment. Predict the outcome of genetic crosses by using Punnett squares. Outline the tenets of the chromosome t
N.C. State - BIO - bio 183
UNIT II. Cell Chapter 5Membrane Structure and Transport1p. 85Student Learning Outcomes: Explain the basic principles of the fluid mosaic model of biomembranes. Outline the properties of the lipid bilayers and associated proteins that compose biomemb
N.C. State - BCH - BCH 453
THE lac OPERON 2007 Paul Billiet ODWSThe control of gene expression Each cell in the human contains all the genetic material for the growth and development of a human Some of these genes will be need to be expressed all the time These are the genes th
N.C. State - BCH - BCH 453
Tertiary Structure of Nucleic Acids DNA inside cells is highly compacted DNA of E. coli circular chromosome is 1.7mm long or 850X length of a single cell. *Length of DNA in human is approximately 2.5X the earths circumference.Length of smallest chromoso
N.C. State - BCH - BCH 453
Coupling of Transcription and Translation in E. coliGenes for Amino Acid Biosynthesis enzymes required for synthesis of particular amino acids generally are clustered into operons most are regulated by attenuation of transcription in response to levels
N.C. State - BCH - BCH 453
Processes Affecting Steady-State Protein ConcentrationGeneTranscription mRNA degradation Primary Transcript Processing Mature mRNA Translation DNAProtein (inactive)Protein degradation Post-Translational Processing.or deferred folding** *Active Pro
N.C. State - BCH - BCH 453
Important Domains Found in Transcription FactorsDNA Binding DomainProtein-Protein Interaction DomainActivation Domain1Modular Nature of Some Transcription FactorsSome factors can bind DNA and activate transcription through independent domains One do
N.C. State - BCH - BCH 453
Termination of Transcription in E. coli Pausing at certain sequence elements Termination signaled by DNA sequences that trigger dissociation of RNA Pol 1) Factor dependent termination = dependent termination 2) Factor independent termination = independen
N.C. State - BCH - BCH 453
Protein/DNA Interactions Catalytic -DNA dependent DNA polymerases (DNA replication) -DNA dependent RNA polymerases -Many of proteins involved in replication and transcription -DNases (endo- and exonucleases) -Restriction enzymes -Topoisomerases -many oth
N.C. State - BCH - BCH 453
Type II Restriction EnzymesRecognition sequences for some type II restriction enzymesBam H1 GGATCC CCTAGGEco RIGAATTC CTTAAGPst ICTGCAG GACGTCSome generate sticky ends ex. Bam HI, Eco RI, ClaI, Hind III, Not I, Pst I, Tth lllI -Some sticky ends are
N.C. State - BCH - BCH 453
What is required for translation? mRNA tRNAs tRNA synthetases amino acids ribosomes peptidyl transferase protein factorsProcaryoticEucaryoticRibosomes80S70S50S5s rRNA 23S rRNA ~34 proteins60S5s rRNA 28S rRNA 5.8S rRNA ~49 proteinsWHY DO COMBINED
N.C. State - BCH - BCH 453
Processing of Eucaryotic mRNAsDNA Transcription pre-mRNA (primary transcript) 5 capping 3 cleavage and polyadenylation splicingmRNA1.5 Cap Structure on mRNAs found on most mRNAs rRNAs and tRNAs are not capped protects 5 end of mRNA from 5 exonuclease
N.C. State - BCH - BCH 453
Induction of Lac Operon Inducer binds to repressor and decreases affinity of repressor for operator site on DNA RNA Pol can proceed Transcription is induced and genes are expressed -1,000-10,000 -gal molecules/cell Mode of regulation is essentially negat
N.C. State - BCH - BCH 453
Which nt Residues are Contacted by the Protein?Modification Interference Method -tests ability of partially modified DNA to bind protein -DNA for binding analysis is partially modified such that approx. every molecule has one modification -residues that
N.C. State - BCH - BCH 453
Topoisomerases Enzymes that alter winding properties of DNA Important in DNA replication and packaging Two general classes Type I (Topoisomerase I; a/k/a nicking-closing enzyme) -change L in steps of 1 by producing transient single-strand breaks in one st
N.C. State - BCH - BCH 453
H DNA triple helix spontaneously forms produces sharp bend 1/2 mirror repeat Triple HelixpuOther 1/2 mirror repeatDraw your own triple helix sequence!Triple Base PairsTriple Base Pairs-one pair uses standard Watson-Crick pairing -other pair uses Ho
N.C. State - BCH - BCH 453
1.DNA Sequencing 2 Methods (developed in 1977; newer versions adapted)Both rely on analysis of radioactive products on denaturing polyacrylamide gels 1) Chemical Cleavage a/k/a Maxam & Gilbert method Depends on chemical reactions that specifically cleav
N.C. State - BCH - BCH 453
1.START OF CHAPTER 13Procaryotic Promoter ElementsUp Mutations-35 region SpacerTTGACA-10 region SpacerTATAATConvert sequences to more like consesusRNA StartPribnow BoxDown MutationsConvert sequences away from consesus2.Procaryotic Promoter F
N.C. State - BCH - BCH 453
Factors Involved in Transcription Initiation Complex -required for recognition of TATA box and initiation of transcription for most class II genesTFIIA TFIIB TFIID TFIIE TFIIF Binds to TFIID; contains several subunits Interacts with RNA Polymerase II Mul
N.C. State - BCH - BCH 453
Splicing TerminologyExonIntronExonDNAPrimary Transcript 5 Splice Site 3 Splice SiteMature RNA + intronTwo Types of Primary Transcripts1) Simple Transcripts -produce 1 mature mRNA and 1 type of polypeptide 2) Complex Transcripts -produce 2 or more
N.C. State - BCH - BCH 453
First Step in Elongation Second aminoacyl tRNA binds to complex of EF-Tu bound to GTP aa-tRNA/EF-Tu/GTP binds to A site of 70S initiation complex GTP is hydrolyzed EF-Tu/GDP complex released and Ef-Tu/GTP is regeneratedfMetAA2E5U AA UC G3PAfMe
N.C. State - BCH - BCH 453
Suggested readings in Tropp textSuggested readings for Exam I Lectures 1-3: Chapter 1 Lectures 4: Chapter 4 and Chapter 5 Fig. 5.14 Lecture 5: Chapters 4 and 6 Lecture 6: Chapter 5-only pages 131-144 Lectures 7-9: Chapter 9 Lecture 10: Chapter 5-pages 16
N.C. State - MA - 141
Section 6.4Page 1 of 2 Logged in as werhem@ncsu.LogoutWebAssign.netWednesday, August 9, 2006 04:19 PM EDT Home| My Assignments | Grades | Communication | CalendarHome > My Assignments > Section 6.4(Homework)About this Assignment| Help | My Option
Xavier - ECON - 12345
Econ 600 Managerial EconomicsSpring 2010 Dr. Yi Problem set 1-1 Rick Vollman 1. Researchers at Hokmah market research and consulting company has the following utility function which represents researchers utility at work. U=E^(1/2)*L^(1/2) where E repres
York University - COMPUTER S - COMP5647
C O M P U T A T I O N A L A P P R O A C H E S T O T HE S T U D Y O F G ENOMIC ROLES O F R E P E A T E D D N A SEQUENCES by L OUIE N A T H A N V A N DE L A G E M A A T B .A.Sc, The University o f B ritish C olumbia, 1996A T HESIS S UBMITTED LN P A R T I A
York University - COMPUTER S - COSC1520
_computational BIOLOGYPRIMER 2004 Nature Publishing Group http:/www.nature.com/naturebiotechnologyWhat is a hidden Markov model?Sean R EddyStatistical models called hidden Markov models are a recurring theme in computational biology. What are hidden
York University - COMPUTER S - COSC1520
BIOINFORMATICSVol. 17 Suppl. 1 2001 Pages S157S164Feature selection for DNA methylation based cancer classication Fabian Model, Peter Adorjan, Alexander Olek and Christian PiepenbrockEpigenomics AG, Kastanienallee 24, D-10435 Berlin, GermanyReceived
UCF - CS - COP 6371
UCF - CS - COP 6371
UCF - CS - COP 6371
UCF - CS - COP 6371
York University - COMPUTER S - COMP5647
PreprintAlignment of RNA Base Pairing Probability MatricesIvo L. Hofacker, Stephan H.F. Bernhart and Peter F. Stadler Institut fur Theoretische Chemie und Molekulare Strukturbiologie, Universitat Wien, Wahringerstrae 17, Vienna, A-1090, Austria and Bio
York University - COMPUTER S - COMP5647
Growing Trees on the Right CompostCdric Notredame Comparative Bioinformatics Group Bioinformatics and Genomics ProgramManguel M, Samaniego F.J., Abraham Walds Work on Aircraft Suvivability, J. American Statistical Association. 79, 259-270, (1984)What s
York University - COMPUTER S - COMP5647
Structure PredictionStructure ProbabilitiesPart 1 RNA Structure and RNA Structure Predictionc S.WillStructure PredictionStructure ProbabilitiesDenitionsDenition (RNA Structure)Let S cfw_A, C , G , U be an RNA sequence of length n = |S |. An RNA s
York University - COMPUTER S - COMP5647
Part 2 Comparative Analysis of RNAsc S.WillExampleGiven: set of related RNA sequences>AF008220 GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA >M68929 GCGGAUAUAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAAUCCCGUUAUUCGCC >
York University - COMPUTER S - COMP5647
ComputationalncRNAgenefinding ncRNAstructureprediction (&computationalncRNAgene (&ncRNAstructureprediction)finding)LimingCai(BINF8210@UGA,Fall2009)NoncodingRNAs Functionsotherthancodingproteins, e.g.,structural,catalytic,and regulatoryfactors functio
York University - COMPUTER S - COMP5647
Lab VI: Computational Biology gy and RNA Structure PredictionBiochemistry 208 208 David Mathews Department of Biochemistry & BiophysicsContact Info: David_Mathews@urmc.rochester.edu Phone: x51734 Office: 3.6830 (across the hall from your wet lab) Web:
York University - COMPUTER S - COMP5647
Population Substructure using Information TheoryEdward ShyuComputer Science and Engineering University of California, San DiegoSean ORourkeComputer Science and Engineering University of California, San DiegoEleazar EskinComputer Science and Engineer
York University - COMPUTER S - COMP5647
De novo identification of repeat families in large genomesAlkes L. Price, Neil C. Jones and Pavel A. Pevzner June 28, 2005What is a repeat family?A repeat family is a collection of similar sequences which appear many times in a genome. For example, the
York University - COMPUTER S - COMP5647
Algorithms for Molecular BiologyFall Semester, 2001Lecture 8: December 27, 2001Lecturer: Ron Shamir Scribe: Orly Stettiner and Ron Gabor18.1Preface: Phylogenetics and Phylogenetic TreesPhylogeny - The ancestral relationship of a set of species.8.1.
York University - COMPUTER S - COMP5647
MicroRNAThe Computational ChallengeBioinformatics Seminar, March 9, 2005 By Yaron LevyTree of RNA TypesmiRNA Biological ProcessMicro RNA Computational ApproachProblem 1: Finding putative microRNA from a sequenceHoresh et al, using suffix trees data
York University - COMPUTER S - COMP5647
An Introduction to Bioinformatics Algorithmswww.bioalgorithms.infoMolecular EvolutionAn Introduction to Bioinformatics Algorithmswww.bioalgorithms.infoOutline Evolutionary Tree Reconstruction Out of Africa hypothesis Did we evolve from Neanderthals
York University - COMPUTER S - COMP5647
REVIEWSALU REPEATS AND HUMAN GENOMIC DIVERSITYMark A. Batzer* and Prescott L. DeiningerDuring the past 65 million years, Alu elements have propagated to more than one million copies in primate genomes, which has resulted in the generation of a series o
York University - COMPUTER S - COMP5647
Downloaded from genome.cshlp.org on February 16, 2009 - Published by Cold Spring Harbor Laboratory PressEvolutionarily conserved elements in vertebrate, insect, worm, and yeast genomesAdam Siepel, Gill Bejerano, Jakob S. Pedersen, et al. Genome Res. 200
York University - COMPUTER S - COMP5647
Downloaded from genome.cshlp.org on February 16, 2009 - Published by Cold Spring Harbor Laboratory PressWhole-genome analysis of Alu repeat elements reveals complex evolutionary historyAlkes L. Price, Eleazar Eskin and Pavel A. Pevzner Genome Res. 2004
York University - COMPUTER S - COSC1520
BMC BioinformaticsProceedingsBioMed CentralOpen AccessBIOADI: a machine learning approach to identifying abbreviations and definitions in biological literatureCheng-Ju Kuo1, Maurice HT Ling2,4, Kuan-Ting Lin1,3 and Chun-Nan Hsu*1Addresses: 1Institut
York University - COMPUTER S - COSC1520
BIOINFORMATICSGene expressionORIGINAL PAPERVol. 25 no. 2 2009, pages 211217 doi:10.1093/bioinformatics/btn592LRpath: a logistic regression approach for identifying enriched biological groups in gene expression dataMaureen A. Sartor1 , George D. Leika
York University - COMPUTER S - COSC1520
BIOINFORMATICSStructural bioinformaticsORIGINAL PAPERVol. 25 no. 2 2009, pages 204210 doi:10.1093/bioinformatics/btn618Identication of structurally conserved residues of proteins in absence of structural homologs using neural network ensembleGanesan
York University - COMPUTER S - COSC1520
UpdateAcknowledgementsWe thank members of the Zhang laboratory and three anonymous reviewers for valuable comments. This work was supported by research grants from the National Institutes of Health to J.Z.Trends in Genetics Vol.25 No.1013 Khaitovich,
York University - COMPUTER S - COSC1520
BIOINFORMATICSSequence analysisORIGINAL PAPERVol. 25 no. 1 2009, pages 1421 doi:10.1093/bioinformatics/btn569Discovery of phosphorylation motif mixtures in phosphoproteomics dataAnna Ritz1, , Gregory Shakhnarovich2 , Arthur R. Salomon3 and Benjamin J
York University - COMPUTER S - COSC1520
BIOINFORMATICSGenetics and population analysisORIGINAL PAPERVol. 25 no. 2 2009, pages 237242 doi:10.1093/bioinformatics/btn613Prioritizing risk pathways: a novel association approach to searching for disease pathways fusing SNPs and pathwaysLina Chen
York University - COMPUTER S - COSC1520
Feature Selection using a Random Forests Classifier for the Integrated Analysis of Multiple Data TypesDavid M. Reif1,2, Alison A. Motsinger1, Brett A. McKinney1,2,3, James E. Crowe Jr.3, Jason H. Moore2cfw_reif, motsinger, mckinney@chgr.mc.vanderbilt.ed
York University - COMPUTER S - COSC1520
BMC BioinformaticsResearchBioMed CentralOpen AccessPhenotypic and genotypic data integration and exploration through a web-service architectureAngelo Nuzzo1, Alberto Riva2 and Riccardo Bellazzi*1Address: 1Department of Computer Engineering and Syste
York University - COMPUTER S - COSC1520
BIOINFORMATICSGenome analysisORIGINAL PAPERVol. 25 no. 2 2009, pages 167174 doi:10.1093/bioinformatics/btn605MotifMap: a human genome-wide map of candidate regulatory motif sitesXiaohui Xie1,2, , Paul Rigor1,2 and Pierre Baldi1,2,of Computer Science
York University - COMPUTER S - COSC1520
UpdateGenome AnalysisNeutral evolution on mammalian protein surfacesGavin C. Conant1,21 2Division of Animal Sciences, University of Missouri, Columbia MO, U.S.A. Informatics Institute, University of Missouri, Columbia MO, U.S.A.Because of their low
York University - COMPUTER S - COSC1520
BIOINFORMATICSSequence analysisORIGINAL PAPERVol. 25 no. 1 2009, pages 2229 doi:10.1093/bioinformatics/btn580Predicting DNA recognition by Cys2 His2 zinc nger proteinsAnton V. Persikov1 , Robert Osada2 and Mona Singh1,2, Institute for Integrative Ge
York University - COMPUTER S - COSC1520
BIOINFORMATICSGene expressionORIGINAL PAPERVol. 25 no. 21 2009, pages 27802786 doi:10.1093/bioinformatics/btp502Statistical methods for gene set co-expression analysisYounJeong Choi1 and Christina Kendziorski2, 1 Departmentof Statistics and 2 Depar
York University - COMPUTER S - COSC1520
BIOINFORMATICSGenetics and population analysisORIGINAL PAPERVol. 25 no. 1 2009, pages 5460 doi:10.1093/bioinformatics/btn354The wisdom of the commons: ensemble tree classiers for prostate cancer prognosisJames A. Koziol1 , Anne C. Feng1 , Zhenyu Jia2
York University - COMPUTER S - COSC1520
BMC BioinformaticsResearch articleBioMed CentralOpen AccessPredicting sulfotyrosine sites using the random forest algorithm with significantly improved prediction accuracyZheng Rong YangAddress: School of Biosciences, University of Exeter, UK Exeter
York University - COMPUTER S - COSC1520
BIOINFORMATICSVol. 20 no. 18 2004, pages 35943603 doi:10.1093/bioinformatics/bth448Advances to Bayesian network inference for generating causal networks from observational biological dataJing Yu1,2 , V. Anne Smith1 , Paul P. Wang2 , Alexander J. Hartem