Register now to access 7 million high quality study materials (What's Course Hero?) Course Hero is the premier provider of high quality online educational resources. With millions of study documents, online tutors, digital flashcards and free courseware, Course Hero is helping students learn more efficiently and effectively. Whether you're interested in exploring new subjects or mastering key topics for your next exam, Course Hero has the tools you need to achieve your goals.
26 Pages
pictures set 1
Course: AS 555, Fall 2009School: National Taiwan University
Rating:
Document Preview
Science Animal 555.02 Class Pictures First Day of Cooked Class Ground Sausage Emulsified Sausage
Unformatted Document Excerpt
Coursehero >> China >> National Taiwan University >> AS 555Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Science Animal 555.02
Class Pictures
First Day of Cooked Class
Ground Sausage
...
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more.
Course Hero has millions of course specific materials providing students with the best way to expand
their education.
Below is a small sample set of documents:
Below is a small sample set of documents:
UConn - ACCT - 131
Accounting for a Merchandising Business5ANSWERS TO QUESTIONS FOR GROUP LEARNINGQ5-1A merchandising business has a major revenue reduction called cost of goods sold. The computation of cost of goods sold results in an income statement that contains inf
Sanford-Brown Institute - CSCI - 1950
TAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTGAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAATATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATGGCATGCCCTGCATT
Concordia Chicago - NOV - 6022
6022,ADMIRALTY BANCORP INC,0001066808,2001-03-30,http:/www.sec.gov/Archives/edgar/data/1066808/000095017001000435/0000950170-01-000435.txt,1.98%,5896022,ALLEGIANCE BANC CORPORATION,0000807522,1996-04-17,http:/www.sec.gov/Archives/edgar/data/807522/000080
Sanford-Brown Institute - CSCI - 1950
Computer Graphics Proceedings, Annual Conference Series, 2007Scene Completion Using Millions of PhotographsJames Hays Alexei A. Efros Carnegie Mellon UniversityOriginal Image Input Scene Matches Output Figure 1: Given an input image with a missing regi
Penn State - MLW - 268
Baltimore Washington Medical CenterWomens Center and Inpatient TowerGlen Burnie, MDTechnical Assigment #2Megan WortmanConstruction ManagementConsultant: John MessnerBaltimore Washington Medical CenterWomens Center and Inpatient TowerGlen Burnie,
Acton School of Business - OCALLAGHAN - 234
PHILOSOPHY OF LANGUAGEPhil 234 Winter 2005 W, F 1:10pm2:30pm Carnegie 225 Casey OCallaghan 73 Campus Ave, Room 3 207.786.6308 cocallag at bates dot eduThe sentence Snow is cold and white means something in the English language. I can utter it and state
Montana - MATH - 216
SOLUTION TO FINAL EXAM, SPRING 2006Multiple Choice 1. 2. 3. 4. 5. 6. A D B C B C 7. B 8. A 9. C 10. B 11. C 12. C 13. 14. 15. 16. 17. 18. D B C B A C 19. 20. 21. 22. 23. 24. 25. D A C D D D C True/False 26. 27. 28. 29. 30. 31. 32. 33. T T T T T T T FSho
Mt. Marty - PH - 1726
Chapter 8 Part 4 Sample Size Two Sample ProblemJanuary 13, 2009Goal:To understand what impacts the sample size needed. And to understand how to calculate the sample size.Skills:You should be able to calculate the sample size for both a one sample and
Midwestern State University - CS - 427
Cyber Security & e-CommerceNCMA December Meeting December 14, 2000 (Updated 12/18/03)Robert E. Mahan Chief Information Officer Pacific Northwest National LaboratoryU.S. Department of Energ Pacific Northwest National LaboratorCyber1DefinitionssCybe
Lake County - CONF - 134
To What Surprises Do Hog Futures Markets Respond? by Julieta Frank, Philip Garcia, and Scott IrwinSuggested citation format: Frank, J., P. Garcia, and S. Irwin. 2007. "To What Surprises Do Hog Futures Markets Respond?" Proceedings of the NCCC-134 Confere
McDonough School of Business - LBC - 22
Riding the Yield Curve: A Variety of StrategiesDAVID S. BIERI AND LUDWIG B. CHINCARINIDAVID S. BIERIis adviser to the general manager at the Bank for International Settlements in Basel, Switzerland. david.bieri@bis.orgLUDWIG B. CHINCARINIis an adjunc
UAB - CS - 493
Compiling Language Denitions: The ASF+SDF CompilerM. G. J. VAN DEN BRAND CWI and Vrije Universiteit J. HEERING CWI P. KLINT CWI and University of Amsterdam and P. A. OLIVIER CWIThe ASF+SDF Meta-Environment is an interactive language development environm
National Taiwan University - AEDE - 840
www.elsevier.com/locate/worlddevPII: S0305-750X(99)00103-5World Development Vol. 27, No. 12, pp. 20612079, 1999 1999 Elsevier Science Ltd. All rights reserved Printed in Great Britain 0305-750X/99/$ - see front matterCommunity-Based Wildlife Management
University of Texas - I - 385
A Large-Scale Study of File-System ContentsJohn R. Douceur and William J. BoloskyMicrosoft Research Redmond, WA 98052cfw_johndo, bolosky@microsoft.com ABSTRACTWe collect and analyze a snapshot of data from 10,568 file systems of 4801 Windows personal
Oklahoma State - DOCUMENT - 1104
Oklahoma Cooperative Extension ServiceHLA-6419Establishing a Lawn in OklahomaDennis L. Martin David HillockTurf Extension SpecialistExtension Consumer HorticulturistOklahoma Cooperative Extension Fact Sheets are also available on our website at: htt
Pittsburgh - MINORITY-H - 00000228
EPIDEMIOLOGY AND SOCIAL SCIENCEAre HIV/AIDS Conspiracy Beliefs a Barrier to HIV Prevention Among African Americans?Laura M. Bogart, PhD* and Sheryl Thorburn, PhD, MPHObjectives: This study examined endorsement of HIV/AIDSconspiracy beliefs and their r
Iowa State - CPB - 6666
Journal of Social and Clinical Psychology, Vol. 27, No. 3, 2008, pp. 279310BARLETT ET AL. METAANALYSES OF MALE BODY IMAGEMETAANALYSES OF THE EFFECTS OF MEDIA IMAGES ON MEN'S BODYIMAGE CONCERNSCHRISTOPHER P. BARLETT Iowa State University CHRISTOPHER L.
Mt. Marty - PH - 1725
Examplelog: log type: opened on: c:\data\Chap6Part2.log text 15 Oct 2008, 13:30:58. use "W:\WP51\Biometry\AAAABiostat1725_Fall2008\Handouts\Chapter 6\data\samplingAHT_5000.dta" . sum(AGE) Variable | Obs Mean Std. Dev. Min Max -+-AGE | 5000 66.8502 7.653
Cal Poly - CS - 996
Homework # 1 CS 996-Spring 2005 Information Security Management Task I: Read Krutz, pp 83103, Risk Management Task II This part is just a survey for the SFS students. One of the purposes of this course is to ensure that the SFS students have covered all t
Cal Poly - CS - 996
Homework # 23 Both due on 2/16 CS 996-Spring 2005 Information Security Management PLEASE SUBMIT THESE AS TWO SEPARATE HOMEWORKS SUBMIT THIS AND ALL FUTURE HOMEWORKS TO:PolyISM@gmail.comBackground for both assignments: Poly is going to set up a new, stre
Cal Poly - CS - 996
Homework # 5, part A Security Metrics Due March 2, 2005 CS 996-Spring 2005 Information Security Management SUBMIT THIS AND ALL HOMEWORKS TO: PolyISM@gmail.com Pretend you are a security analyst at Polytechnic. You have just had the following (highly sim
Cal Poly - CS - 996
Homework # 4, part A ISO 17799 Due March 2, 2005 CS 996-Spring 2005 Information Security Management SUBMIT THIS AND ALL HOMEWORKS TO: PolyISM@gmail.com For the homework I would like you folks to read areas 5 and 10 and do your best to apply them to the GT
Cal Poly - CS - 996
Additional Guidelines for Presentations and Homework Submissions 1. For all student lectures, keep in mind that the theme is SECURITY Management, not just management topics. Cover some general management topics if needed, but only to set the stage for the
Cal Poly - CS - 996
Homework # 6 ISO 17799 Due March 9, 2005 CS 996-Spring 2005 Information Security Management SUBMIT THIS AND ALL HOMEWORKS TO: PolyISM@gmail.com 1. Design a security awareness workshop for the poly faculty? (no fancy powerpoint stuff just a word document o
Cal Poly - CS - 996
Homework # 8b Evaluation and Classified Systems Due April 6, 2005 CS 996-Spring 2005 Information Security Management SUBMIT THIS AND ALL HOMEWORKS TO: PolyISM@gmail.com NOTE: This counts as a full week's assignment, half of a week's assignment (there's en
Cal Poly - CS - 996
The Application Audit Process - A Guide for Information Security ProfessionalsGIAC Security Essentials Certification (GSEC) Practical Assignment Version 1.4cKey fingerprint = AF19 FA27 2F94 998D FDB5 DE3D F8B5 06E4 A169 4E46 SANS Institute 2005SANSI
Cal Poly - CS - 996
Homework # 9b Information Security Policy: EMSEC/TRANSSEC/TEMPEST Due April 20, 2005 CS 996-Spring 2005 Information Security Management SUBMIT THIS AND ALL HOMEWORKS TO: PolyISM@gmail.com 1. Perform EMSEC/TRANSSEC risk analysis on GTS system. Identify the
Cal Poly - CS - 996
Homework 9a Due April 20 Question 1. Develop Security Use Cases for GTS application. Develop Scenarios for GTS (view transcript, request transcript for a potential employer/grad school) ou can use the following as guidelines: http:/www.jot.fm/issues/issue
Cal Poly - CS - 996
HW # 11 A Legal Requirements Due: May 4, 2005 CS 996-Spring 2005 Information Security Management 1) Which laws presented in this lecture apply to the GTS system described in class? 2) Suppose the GTS system wanted to comply with the SOX requirements for i
Cal Poly - CS - 996
Homework # 13A OCTAVE Due May 4, 2005 CS 996-Spring 2005 Information Security Management SUBMIT THIS AND ALL HOMEWORKS TO: PolyISM@gmail.com Q1: Determine which organization category (OCTAVE or OCTAVE-S) Polytechic University fits into by answering the `s
Cal Poly - CS - 996
Homework # 12A Certification and Accreditation Due May 4, 2005 CS 996-Spring 2005 Information Security Management SUBMIT THIS AND ALL HOMEWORKS TO: PolyISM@gmail.com 1. For your GTS, use the table in the slide to determine the certification level and prov
Cal Poly - CS - 996
Homework # 12C Information Systems Security Officer Due May 4, 2005 CS 996-Spring 2005 Information Security Management SUBMIT THIS AND ALL HOMEWORKS TO: PolyISM@gmail.com For the GTS system, create a miniCIAPP. It doesn't have to be in the form given in t
Cal Poly - CS - 996
Homework 10A: Physical Security Due May 4, 2005 1. As a security officer, you have been informed that classified information will be discussed/stored in the room where CS 996 is currently held. What recommendations would you make for physical security to
illinoisstate.edu - PHI - 101
PHIL 101, Basic Issues in Philosophy, Fall, 2007 Prof. Deutsch (TUR 152c and Prof. Swindler TUR 150)Web site: http:/www.philosophy.ilstu.edu/phi101/ This course is designed to provide students with an overview of some of the main issues that have occupie
UT Chattanooga - ONEWEB - 212
Chapter 16 Regression Analysis: Model BuildingLearning Objectives 1. 2. 3. 4. 5. 6. 7. Learn how the general linear model can be used to model problems involving curvilinear relationships. Understand the concept of interaction and how it can be accounted
Lake County - AE - 440
CDR Presentation 26 Nov 2007Dust ThrustersDain Christensen Julene Forner Jessica Howe Jonathan Newhall David Roman Michael Straka Kyle VonnahmenOverviewConstraint Analysis Jonathan Newhall Structures Julene Forner Propulsion Kyle Vonnahmen Aerodynamic
Washington University in St. Louis - M - 233
Calculus IIIMath 233 Spring 2007 In-term exam 02/07This problem set contains sixteen problems numbered 1 through 16. Problems 1 15 are multiple choice problems, which each count 5% of your total score. Problem 16 will be hand-graded and counts 25% of yo
Washington - FACULTY - 152
CHEMISTRY 150 C Winter 1997 Name: _ SHOW YOUR WORK IN THE SPACE PROVIDED. POINTS AS INDICATED ( ) GOOD LUCK !HOUR EXAM #2 2/12/97(A)TA Name/Section _ Score: p. 1 _ p. 2 _ p. 3 _ p. 4 _ p. 5 _ p. 6 _ Total _1. (5)Name two allotropes of the element O a
Washington - IFORT - 90
Intel Fortran Libraries ReferenceDocument Number: 253262-003 World Wide Web: http:/developer.intel.comDisclaimer and Legal InformationThe information in this manual is subject to change without notice and Intel Corporation assumes no responsibility or
Iowa State - BUS - 370
<html> <head> <linkrel="stylesheet"type="text/css" href="http:/www.bus.iastate.edu/Include/style/style.css"/> <metaname="GENERATOR"content="MicrosoftFrontPage12.0"> <metaname="ProgId"content="FrontPage.Editor.Document"> <title>IowaStateUniversityCollegeof
illinoisstate.edu - ECO - 372
Journal of the History of Economic Thought Cumulative IndexSubVol. No. 19 14 14 23 26 12 12 22 24 25 23 23 26 13 22 11 23 16 13 23 15 21 14 27 23 14 20 20 18 17 19 18 21 20 Pp. Year Title Author Rutherford, Malcolm Backhouse, Roger E. Backhouse, Roger E.
Iowa State - BUS - 371
<html> <head> <linkrel="stylesheet"type="text/css" href="http:/www.bus.iastate.edu/Include/style/style.css"/> <metaname="GENERATOR"content="MicrosoftFrontPage12.0"> <metaname="ProgId"content="FrontPage.Editor.Document"> <title>IowaStateUniversityCollegeof
UCSB - PSY - 111
Psy 111 Basic concepts in BiopsychologyLecture 7-9 : Sensory SystemsWebsite: http:/mentor.lscf.ucsb.edu/course/fall/psyc111/Objectives Describe the general principles of sensory system organization. Define transduction and the various types of stimuli
Dartmouth - ENGS - 37
ECO-INDUSTRIAL PARKS across the USA:(Source: http:/www.usc.edu/schools/sppd/research/NCEID/Profiles/Mini_Sites/) (22 November 2002)The Londonderry Ecological Industrial Park, New Hampshire The Town of Londonderry, NH is using eco-industrial development
Washington - B - 571
'$General Linear Model for Correlated DataObjectives: Weighted least squares methods Moment estimation Sandwich variance Linear mixed models. Models for covariance Maximum likelihood and REML Empirical Bayes estimation &186%Heagerty, Bio/Stat 571'
National Taiwan University - AMIS - 626
PEOPLES LIFE INSURANCE COMPANY v. THE UNITED STATES No. 348-63 UNITED STATES COURT OF CLAIMS179 Ct. Cl. 318; 373 F.2d 924; 1967 U.S. Ct. Cl. LEXIS 35; 67-1 U.S. TaxCas. (CCH) P9301; 19 A.F.T.R.2d (RIA) 979 March 17, 1967, DecidedSYLLABUS: [*1]ON T
UCSB - PSYC - 111
Psy 111 Basic concepts in BiopsychologyLecture 10: Somatosensory SystemsWebsite: http:/mentor.lscf.ucsb.edu/course/fall/psyc111/Objectives Define the somatosensory system(s) and describe differences in sensitivity. Describe the variety of transduction
Harvard - I - 296
The Laws of CyberspaceLawrence Lessig Draft 3Lessig 1998: This essay was presented at the Taiwan Net '98 conference, in Taipei, March, 1998. Jack N. and Lillian R. Berkman Professor for Entrepreneurial Legal Stud-ies, Harvard Law School. Thanks to Tim
University of Rochester - PHYS - 310
Physics 310 Lab 4 Transformers, Diodes, & Power SuppliesEquipment: Oscope, W02G Bridge Rectifier, 110 6.3V transformer, four 1N4004 diodes, 1k, 10F, 100F, 1N5231 Zeenerdiode, - Watt 100 , 270, LED, LM7805 Regulator, LM317 Adjustable Regulator, Heathkit
Stanford - BMIR - 273
Domain Ontologies in Software Engineering:Use of Protg with the EON Architecture Mark A. MusenSection on Medical Informatics Stanford University School of Medicine Stanford, California 94305-5479 U.S.A.Domain ontologies are formal descriptions of the c
University of Rochester - PHYS - 344
Phys 344Ch 5 Lect 4Feb 28th , 20091Wed. 3/4 Fri. 3/65.5 Dilute Solution 5.6 Chemical EquilibriumHW17: 73,76,82 HW18:83,84,86,88,89,91Mon. 3/9 Review Wed. 3/11 Exam 2 Fri. 3/ 13 (C 10.7) S 6.0, 6.1 Boltzmann Statistics HW19: 2, 3, 4, 6, 12 Bonus: Ph
Berkeley - EE - 40
EECS40/43Appendix 1Appendix 1: ResistorsFigure 1 shows how to read resistor values. The color code contains two digits, a multiplier, and a tolerance value. The bands represent a number in a modified scientific notation: the first two bands represent t
National Taiwan University - ECON - 508
Poverty in TransitionBryan GriffithCopyright 2005 Bryan M. GriffithOutlinePoverty is badInequality Happens International Aid must be targeted.Poverty Level DefinedAbsolute PovertyWorld Bank - $1 USD PPP (1993) per day World Bank - $2 USD PPP (1993
Rutgers - CS - 473
%!PS-Adobe-2.0 %Creator: dvips(k) 5.83 Copyright 1998 Radical Eye Software %Title: first.dvi %Pages: 39 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Roman CMSY10 CMSY8 Times-Bold CMSY6 Courier %+ Times-Italic CMMI10 CMR10 CMR8 CMEX10
National Taiwan University - AMIS - 626
ACCOUNTING AND MANAGEMENT INFORMATION SYSTEMS 626 Spring 2008 Answer Key to First Examination - Part One of Two Points are assigned as follows: I. THE MCAULEYS 81 II. FILING STATUS, STANDARD DEDUCTION, AND EXEMPTIONS 32 III. INCLUSIONS 34 IV. TAX
N.C. State - CS - 5764
High-Speed Visual Estimation Using Preattentive ProcessingCHRISTOPHER G. HEALEY, KELLOGG S. BOOTH, and JAMES T. ENNS The University of British ColumbiaA new method is presented for performing rapid and accurate numerical estimation. The method is derive
UCLA - CS - 218
fe Pcfw_o Rtoy0Rt e ePe P u h Pet8ueiu P er ee8 cP eee oP e eR (e BPe eP tPeeePo PP h t tioUPe Te te eRo i8 $ee utR oorv x 8H P ecfw_eBPR eRy hefPcBt ee f tooPe ttee tPePxh 86e Re PFH t h eRRvee eYo P U PU eRP 9 u$8eePeeoPFiPPxP tfe6 y4 e eecfw_0 e o e e
BU - CS - 511
NumberTheoryAlgorithmsZephGrunschlagCopyrightZephGrunschlag,20012002.AgendaEuclideanAlgorithmforGCD NumberSystems Decimalnumbers(base10) Binarynumbers(base2) Onescomplement TwoscomplementGeneralbasebnumbersystems Addition Multiplication Subtractio
Los Angeles Southwest College - STAT - 525
STATJ 525 Statistical Quality Control Summer 2009 All Sections Class Meetings: There will be no class meetings as such. All classes may be viewed at video.sc.edu ( no www) . Choose "College of Arts and Sciences" and then "STAT J525". The ID is statistics
Iowa State - EE - 435
EE 435Lecture 32 Quantization Noise in Data Converters Spectral CharacterizationReview from Last LectureNoiseWe will define Noise to be the difference between the actual output and the desired output of a system Types of noise: Random noise due to mov
Michigan - SI - 110
Copyright and Digital Media in a PostNapster WorldBy GartnerG2 and The Berkman Center for Internet & Society at Harvard Law SchoolTable of contents0. Introduction.2 1. Evolution of Copyright Law: How We Got Here.3The U.S. Constitution and the Copyrigh