53 Pages

ch20

Course: ACCOUNTING 1234, Spring 2010
School: Abu Dhabi University
Rating:
 
 
 
 
 

Word Count: 13310

Document Preview

HAPTER C 20 JOB ORDER COST ACCOUNTING SUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMY Item 1. 2. 3. 4. 5. 6. 7. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 146. 147. sg st SO 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 BT K C C C C K C K K K C C C C C AP K K C K C C C K C K K AP K AP AP Item 8. 9. 10. 11. 12. 13. 14. 58. 59. 60. 61. 62....

Register Now

Unformatted Document Excerpt

Coursehero >> Other International >> Abu Dhabi University >> ACCOUNTING 1234

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
HAPTER C 20 JOB ORDER COST ACCOUNTING SUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMY Item 1. 2. 3. 4. 5. 6. 7. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 146. 147. sg st SO 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 BT K C C C C K C K K K C C C C C AP K K C K C C C K C K K AP K AP AP Item 8. 9. 10. 11. 12. 13. 14. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. 148. 149. SO 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 BT K C C C C K C K C C K K AP K C K K K C C K K C C K AP AP AP AP AP AP Item 15. 16. 17. 18. 19. 20. 21. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94. 95. 96. 97. 98. 99. 100. 101. 150. 151. SO 2 2 3 3 3 3 3 3 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 5 5 5 5 5 4 4 BT K K K K C C K AP AP AP AP AP AP AP AP AP C K C C K AP C K AP C C C AP AP AP Item 22. 23. 24. 25. 26. 27. 28. 102. 103. 104. 105. 106. 107. 108. 109. 110. 111. 112. 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. 123. 152. 153. SO 4 4 4 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 6 6 6 6 6 5 6 BT C K C C K K K C C C C AP AP AP C C AP AP AP AP AP AP AP AP AP AP AP C C AP AP Item 29. 30. sg 31. sg 32. sg 33. sg 34. sg 35. 124. 125. 126. 127. 128. 129. 130. 131. 132. 133. 134. 135. st 136. sg 137. st 138. sg 139. st 140. sg 141. st 142. sg 143. st 144. sg 145. 154. 155. SO 6 6 1 2 3 4 6 6 6 6 6 6 6 6 6 6 6 6 6 1 2 2 3 3 4 4 6 6 6 6 6 BT C C C K K K K C K C AP C C C C C C C C K K K K K AP K C K K AP AP True-False Statements Multiple Choice Questions Brief Exercises This question also appears in the Study Guide. This question also appears in a self-test at the student companion website. 20 - 2 Test Bank for Accounting Principles, Eighth Edition SUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMY Exercises 156. 157. 158. 159. 160. 179. 180. 2 24 24 24 2,3 1 1 AP C AP C AP K K 161. 162. 163. 164. 165. 181. 182. 2 5 25 25 25 2,3 1 2 AP AP AN AP AP K K 166. 26 AP 167. 2,3,6 AP 168. 26 AP 169. 3 AP 170. 35 AN 183. 184. 2 3 K AP 171. 172. 173. 174. 175. 185. 186. 3,5 3,5 4 4,6 4,6 3 4 AP AP AP AP AP K K 176. 177. 178. 4,6 5 5 AP AP AP Completion Statements 187. 188. 6 6 K K SUMMARY OF STUDY OBJECTIVES BY QUESTION TYPE Item 1. 2. 3. 8. 9. 10. 11. 12. 13. 14. 17. 18. 19. 20. 21. 33. 61. 22. 23. 24. 34. 81. 82. Type TF TF TF TF TF TF TF TF TF TF TF TF TF TF TF TF MC TF TF TF TF MC MC Item 4. 5. 6. 15. 16. 32. 44. 45. 46. 47. 62. 63. 64. 65. 66. 67. 68. 83. 84. 85. 86. 87. 88. Type TF TF TF TF TF TF MC MC MC MC MC MC MC MC MC MC MC MC MC MC MC MC MC Item 7. 31. 36. 48. 49. 50. 51. 52. 53. 54. 69. 70. 71. 72. 73. 74. 75. 89. 90. 91. 92. 93. 94. Type Item Type Item Type MC MC MC MC BE BE Ex Ex Ex Ex BE BE Ex Ex Ex Ex Ex Ex Ex Ex Ex Ex Ex Item 43. 136. 179. 160. 161. 162. 163. 164. 165. 166. 162. 163. 164. 165. 166. 167. 168. 164. 166. 168. 170. 173. 174. Type MC MC C Ex Ex Ex Ex Ex Ex Ex Ex Ex Ex Ex Ex Ex Ex Ex Ex Ex Ex Ex Ex Item 180. 181. Type C C Study Objective 1 TF 37. MC 40. TF 38. MC 41. MC 39. MC 42. Study Objective 2 MC 55. MC 138. MC 56. MC 146. MC 57. MC 147. MC 58. MC 156. MC 59. MC 157. MC 60. MC 158. MC 137. MC 159. Study Objective 3 MC 76. MC 148. MC 77. MC 149. MC 78. MC 157. MC 79. MC 158. MC 80. MC 159. MC 139. MC 160. MC 140. MC 161. Study Objective 4 MC 95. MC 157. MC 96. MC 158. MC 141. MC 159. MC 142. MC 161. MC 150. BE 162. MC 151. BE 163. 167. 168. 182. 183. Ex Ex C C 169. 170. 171. 172. 184. 185. Ex Ex Ex Ex C C 175. 176. 186. Ex Ex C Job Order Cost Accounting 20 - 3 25. 26. 27. 28. 97. 98. 29. 30. 35. 119. 120. TF TF TF TF MC MC TF TF TF MC MC 99. 100. 101. 102. 103. 104. 121. 122. 123. 124. 125. MC MC MC MC MC MC MC MC MC MC MC 105. 106. 107. 108. 109. 110. 126. 127. 128. 129. 130. Study Objective 5 MC 111. MC 117. MC 112. MC 118. MC 113. MC 152. MC 114. MC 161. MC 115. MC 162. MC 116. MC 163. Study Objective 6 MC 131. MC 143. MC 132. MC 144. MC 133. MC 145. MC 134. MC 153. MC 135. MC 154. BE = Brief Exercise Ex = Exercise MC MC BE Ex Ex Ex MC MC MC BE BE 164. 166. 168. 170. 171. 172. 155. 166. 167. 168. 174. Ex Ex Ex Ex Ex Ex BE Ex Ex Ex Ex 177. 178. Ex Ex 175. 176. 187. 188. Ex Ex C C Note: TF = True-False MC = Multiple Choice C = Completion The chapter also contains one set of ten Matching questions and four Short-Answer Essay questions. CHAPTER STUDY OBJECTIVES 1. Explain the characteristics and purposes of cost accounting. Cost accounting involves the procedures for measuring, recording, and reporting product costs. From the data accumulated, companies determine the total cost and the unit cost of each product. The two basic types of cost accounting systems are job order cost and process cost. 2. Describe the flow of costs in a job order cost accounting system. In job order cost accounting, manufacturing costs are first accumulated in three accounts: Raw Materials Inventory, Factory Labor, and Manufacturing Overhead. The accumulated costs are then assigned to Work in Process Inventory and eventually to Finished Goods Inventory and Cost of Goods Sold. 3. Explain the nature and importance of a job cost sheet. A job cost sheet is a form used to record the costs chargeable to a specific job and to determine the total and unit costs of the completed job. Job cost sheets constitute the subsidiary ledger for the Work in Process Inventory control account. 4. Indicate how the predetermined overhead rate is determined and used. The predetermined overhead rate is based on the relationship between estimated annual overhead costs and expected annual operating activity. This is expressed in terms of a common activity base, such as direct labor cost. The rate is used in assigning overhead costs to work in process and to specific jobs. 5. Prepare entries for jobs completed and sold. When jobs are completed, the cost is debited to Finished Goods Inventory and credited to Work in Process Inventory. When a job is sold the entries are: (a) Debit Cash or Accounts Receivable and credit Sales for the selling price, and (b) Debit Cost of Goods Sold and credit Finished Goods Inventory for the cost of the goods. 20 - 4 Test Bank for Accounting Principles, Eighth Edition 6. Distinguish between under- and overapplied manufacturing overhead. Underapplied manufacturing overhead means that the overhead assigned to work in process is less than the overhead incurred. Overapplied overhead means that the overhead assigned to work in process is greater than the overhead incurred. TRUE-FALSE STATEMENTS 1. 2. Cost accounting is primarily concerned with accumulating information about product costs. A job order cost system is most appropriate when a large volume of uniform products are produced. A process cost accounting system is appropriate for similar products that are continuously mass produced. The perpetual inventory method cannot be used in a job order cost system. A job order cost system and a process cost system are two alternative methods for valuing inventories. A job order cost system identifies costs with a particular job rather than with a set time period. A company may use either a job order cost system or a process cost system, but not both. Raw Materials Inventory, Factory Labor, and Manufacturing Overhead are all control accounts in the general ledger when a job order cost accounting system is used. Accumulating and assigning manufacturing costs are two important activities in a job order cost system. Recording the acquisition of raw materials is a part of accumulating manufacturing costs. Manufacturing costs are generally incurred in one period and recorded in a subsequent period. The Purchases account is credited for all raw materials purchase returns and allowances. The stores ledger cards are the subsidiary ledger for Raw Materials Inventory control account in the general ledger. When raw materials are purchased, the Work in Process Inventory account is debited. Factory labor should be assigned to selling and administrative expenses on a proportionate basis. Fringe benefits and payroll taxes associated with factory workers should be accumulated as a part of Factory Labor. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. Job Order Cost Accounting 17. 20 - 5 Job order cost sheets constitute the subsidiary ledger of the control account Work In Process Inventory. In a job order cost system, each entry to the Work In Process Inventory account should be accompanied by a posting to one or more job cost sheets. Direct materials requisitioned from the storeroom should be charged to the Work In Process Inventory account and the job cost sheets for the individual jobs on which the materials were used. Manufacturing overhead is the only product cost that can be assigned to jobs as soon as the costs are incurred. There should be a separate job cost sheet for each job. Actual manufacturing overhead costs are assigned to each job by tracing each overhead cost to a specific job. The formula for the predetermined overhead rate is estimated annual overhead costs divided by an estimated activity base. Actual manufacturing overhead costs should be charged to the Work in Process Inventory account as they are incurred. A good system of internal control requires that the job order cost sheet be destroyed as soon as the job is complete. Finished Goods Inventory is charged for the cost of jobs completed during a period. When goods are sold, the Cost of Goods Sold account is debited and Work in Process Inventory account is credited. Total manufacturing costs for a period consists of the costs of direct materials used, the cost of direct labor incurred, and the manufacturing overhead applied during the period. Overapplied overhead means that actual manufacturing overhead costs were greater than the manufacturing overhead costs applied to jobs. If monthly financial statements are prepared, underapplied overhead is shown as a prepaid expense on the balance sheet. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. Additional True-False Questions 31. A cost accounting system consists of manufacturing cost accounts that are fully integrated into the general ledger of a company. The cost of raw materials purchased is credited to Raw Materials Inventory when materials are received. Requisitions for direct materials are posted daily to the individual job cost sheets. 32. 33. 20 - 6 34. Test Bank for Accounting Principles, Eighth Edition The predetermined overhead rate is based on the relationship between estimated annual overhead costs and expected annual operating activity expressed in terms of a common activity base. At the end of the year, underapplied overhead is usually credited to Cost of Goods Sold. 35. Answers to True-False Statements Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. 1. 2. 3. 4. 5. T F T F T 6. 7. 8. 9. 10. T F F T T 11. 12. 13. 14. 15. F F T F F 16. 17. 18. 19. 20. T T T T F 21. 22. 23. 24. 25. T F T F F 26. 27. 28. 29. 30. T F T F T 31. 32. 33. 34. 35. T F T T F MULTIPLE CHOICE QUESTIONS 36. Which of the following is one of the components of cost accounting? a. It involves measuring product costs. b. It involves the determination of company profits. c. It requires GAAP to be applied. d. It requires cost minimizing principles. A major purpose of cost accounting is to a. classify all costs as operating or nonoperating. b. measure, record, and report period costs. c. provide information to stockholders for investment decisions. d. measure, record, and report product costs. The two basic types of cost accounting systems are a. job order and job accumulation systems. b. job order and process cost systems. c. process cost and batch systems. d. job order and batch systems. A process cost system would most likely be used by a company that makes a. motion pictures. b. repairs to automobiles. c. breakfast cereal. d. college graduation announcements. Which of the following would be accounted for using a job order cost system? a. The production of personal computers b. The production of automobiles c. The refining of petroleum d. The construction of a new campus building Process costing is used when a. the production process is continuous. b. production is aimed at filling a specific customer order. c. dissimilar products are involved. d. costs are to be assigned to specific jobs. 37. 38. 39. 40. 41. Job Order Cost Accounting 42. Process costing is not used when a. similar goods are being produced. b. large volumes are produced. c. jobs have distinguishing characteristics. d. a series of connected manufacturing processes is necessary. An important feature of a job order cost system is that each job a. must be similar to previous jobs completed. b. has its own distinguishing characteristics. c. must be completed before a new job is accepted. d. consists of one unit of output. 20 - 7 43. 44. As of December 31, 2008, Stand Still Industries had $1,500 of raw materials inventory. At the beginning of 2008, there was $1,200 of materials on hand. During the year, the company purchased $183,000 of materials; however, it paid for only $175,500. How much inventory was requisitioned for use on jobs during 2008? a. $175,200 b. $182,700 c. $183,300 d. $175,800 The flow of costs in a job order cost system a. involves accumulating manufacturing costs incurred and assigning the accumulated costs to work done. b. cannot be measured until all jobs are complete. c. measures product costs for a set time period. d. generally follows a LIFO cost flow assumption. In a job order cost accounting system, the Raw Materials Inventory account is a. an expense. b. a control account. c. not used. d. a period cost. When a job is completed and all costs have been accumulated on a job cost sheet, the journal entry that should be made is a. Finished Goods Inventory Direct Materials Direct Labor Manufacturing Overhead b. Work In Process Inventory Direct Materials Direct Labor Manufacturing Overhead c. Raw Materials Inventory Work In Process Inventory d. Finished Goods Inventory Work In Process Inventory 45. 46. 47. 20 - 8 48. Test Bank for Accounting Principles, Eighth Edition The two major steps in the flow of costs are a. allocating and assigning. b. acquiring and accumulating. c. accumulating and assigning. d. accumulating and amortizing. The Raw Materials Inventory account is a. a subsidiary account. b. debited for invoice costs and freight costs chargeable to the purchaser. c. debited for purchase discounts taken. d. debited for purchase returns and allowances. Records of individual items of raw materials would not be maintained a. electronically. b. manually. c. on store ledger cards. d. in the Raw Materials Inventory account. Cost of raw materials is debited to Raw Materials Inventory when the a. materials are ordered. b. materials are received. c. materials are put into production. d. bill for the materials is paid. Raw Materials Inventory records are also referred to as a. the Raw Materials control account. b. the store ledger cards. c. the purchases journal. d. periodic inventory records. After all postings have been completed, the sum of the balances in the raw materials subsidiary ledger should equal the a. balance in the Raw Materials Inventory control account. b. cost of materials charged to Work in Process Inventory. c. cost of materials purchased. d. cost of materials placed into production. Factory labor costs a. are accumulated in a control account. b. do not include pension costs. c. include vacation pay. d. are based on workers net pay. Factory Labor is a(n) a. expense account. b. control account. c. subsidiary account. d. manufacturing cost clearing account. 49. 50. 51. 52. 53. 54. 55. Job Order Cost Accounting 56. Kline Manufacturing has the following labor costs: FactoryGross wages FactoryNet wages Employer Payroll Taxes Payable $195,000 160,000 25,000 20 - 9 The entry to record the cost of factory labor and the associated payroll tax expense will include a debit to Factory Labor for a. $220,000. b. $195,000. c. $185,000. d. $170,000. 57. Factory labor costs a. accumulate in advance of utilization. b. accumulate in a control account. c. include sick pay earned by factory workers. d. accumulate in the Factory Labor Expense account. Which of the following is not a control account? a. Manufacturing Overhead b. Factory Labor c. Accounts Receivable d. Raw Materials Inventory Manufacturing Overhead would not have a subsidiary account for a. utilities. b. property taxes. c. insurance. d. raw materials inventory. The entry to record the acquisition of raw materials on account is a. Work in Process Inventory Accounts Payable b. Manufacturing Overhead Raw Materials Inventory Accounts Payable c. Accounts Payable Raw Materials Inventory d. Raw Materials Inventory Accounts Payable Which one of the following best describes a job cost sheet? a. It is a form used to record the costs chargeable to a specific job and to determine the total and unit costs of the completed job. b. It is used to track manufacturing overhead costs to specific jobs. c. It is used by management to understand how direct costs affect profitability. d. It is a daily form that management uses for tracking worker productivity on which employee raises are based. 58. 59. 60. 61. 20 - 10 Test Bank for Accounting Principles, Eighth Edition 62. Job cost sheets constitute the subsidiary ledger for the a. Finished Goods Inventory account. b. Cost of Goods Sold account. c. Work In Process Inventory account. d. Cost of Goods Manufactured account. A materials requisition slip showed that direct materials requested were $53,000 and indirect materials requested were $9,000. The entry to record the transfer of materials from the storeroom is a. Work In Process Inventory................................................... 53,000 Raw Materials Inventory ............................................. 53,000 b. Direct Materials.................................................................... 53,000 Indirect Materials ................................................................. 9,000 Work in Process Inventory .......................................... 62,000 c. Manufacturing Overhead ..................................................... 62,000 Raw Materials Inventory ............................................. 62,000 d. Work In Process Inventory................................................... 53,000 Manufacturing Overhead ..................................................... 9,000 Raw Materials Inventory ............................................. 62,000 The job cost sheet does not show a. costs chargeable to a specific job. b. the total costs of a completed job. c. the unit cost of a completed job. d. the cost of goods sold. Under an effective system of internal control, the authorization for issuing materials is made a. orally. b. on a prenumbered materials requisition slip. c. by the accounting department. d. by anyone on the production line. A copy of the materials requisition slip a. is routed to the treasurer's office for payment. b. becomes the subsidiary ledger for the Work in Process Inventory. c. can be used as a subsidiary ledger for Raw Materials Inventory. d. is retained by the storeroom, and the original is sent to accounting. Materials requisition slips are costed a. by production supervisors. b. by factory personnel who work on the production line. c. after the goods have been sold. d. using any of the inventory costing methods. Posting to control accounts in a costing system are made a. monthly. b. daily. c. annually. d. semi-annually. 63. 64. 65. 66. 67. 68. Job Order Cost Accounting 69. 20 - 11 Which one of the following should be equal to the balance of the work in process inventory account at the end of the period? a. The total of the amounts transferred from raw materials for the current period b. The sum of the costs shown on the job cost sheets of unfinished jobs c. The total of manufacturing overhead applied to work in process for the period d. The total manufacturing costs for the period Which of the following shows entries only to control accounts? a. Factory Labor Wages Payable b. Work in Process Factory Labor Raw Materials Inventory Wages Payable c. Work in Process Manufacturing Overhead Raw Materials Inventory d. Factory Labor Raw Materials Inventory Accounts Payable Wages Payable A time ticket does not indicate the a. employee's name. b. account to be charged. c. number of personal exemptions claimed by the employee. d. job number. Which one of the following is a source document that impacts the job cost sheet? a. Raw materials receiving slips b. Materials purchase orders c. Labor time tickets d. Finished goods shipping documents Time tickets should be approved by a. the audit committee. b. co-workers. c. the employee's supervisor. d. the payroll department. If the entry to assign factory labor showed only a debit to Work In Process Inventory, then all labor costs were a. direct labor. b. indirect labor. c. overtime related. d. regular hours. The principal accounting record used in assigning costs to jobs is a. a job cost sheet. b. the cost of goods manufactured schedule. c. the Manufacturing Overhead control account. d. the store ledger cards. 70. 71. 72. 73. 74. 75. 20 - 12 Test Bank for Accounting Principles, Eighth Edition 76. The following information is available for completed Job No. 402: Direct materials, $60,000; direct labor, $90,000; manufacturing overhead applied, $45,000; units produced, 5,000 units; units sold, 4,000 units. The cost of the finished goods on hand from this job is a. $30,000. b. $195,000. c. $39,000. d. $156,000. Sportly, Inc. completed Job No. B14 during 2008. The job cost sheet listed the following: Direct materials Direct labor Manufacturing overhead applied Units produced Units sold $33,000 $18,000 $12,000 3,000 units 1,800 units 77. How much is the cost of the finished goods on hand from this job? a. $63,000 b. $37,800 c. $25,200 d. $30,600 78. Madison Inc. uses job order costing for its brand new line of sewing machines. The cost incurred for production during 2008 totaled $12,000 of materials, $6,000 of direct labor costs, and $4,000 of manufacturing overhead applied. The company ships all goods as soon as they are completed which results in no finished goods inventory on hand at the end of any year. Beginning work in process totaled $10,000, and the ending balance is $6,000. During the year, the company completed 40 machines. How much is the cost per machine? a. $450 b. $650 c. $550 d. $800 As of December 31, 2008, Nilsen Industries had $2,000 of raw materials inventory. At the beginning of 2008, there was $1,600 of materials on hand. During the year, the company purchased $244,000 of materials; however it paid for only $234,000. How much inventory was requisitioned for use on jobs during 2008? a. $244,400 b. $234,400 c. $233,600 d. $243,600 Cost of goods manufactured equals $44,000 for 2008. Finished goods inventory is $2,000 at the beginning of the year and $5,500 at the end of the year. Beginning and ending work in process for 2008 are $4,000 and $5,000, respectively. How much is cost of goods sold for the year? a. $46,500 b. $42,000 c. $40,500 d. $47,500 79. 80. Job Order Cost Accounting 81. 20 - 13 A company expected its annual overhead costs to be $600,000 and direct labor costs to be $1,000,000. Actual overhead was $580,000, and actual labor costs totaled $1,100,000. How much is the companys predetermined overhead rate to the nearest cent? a. $0.58 b. $0.53 c. $0.60 d. $0.55 Vektek, Inc. thinks machine hours is the best activity base for its manufacturing overhead. The estimate of annual overhead costs for its jobs was $615,000. The company used 1,000 hours of processing on Job No. B12 during the period and incurred overhead costs totaling $630,000. The budgeted machine hours for the year totaled 20,000. How much overhead should be applied to Job No. B12? a. $630 b. $30,750 c. $31,500 d. $615 Hill Mfg. provided the following information from its accounting records for 2008: Expected production Actual production Budgeted overhead Actual overhead 30,000 labor hours 28,000 labor hours $900,000 $870,000 82. 83. How much is the overhead application rate if Hill bases the rate on direct labor hours? a. $31.07 per hour b. $30.00 per hour c. $29.00 per hour d. $28.00 per hour 84. Kinney Company applies overhead on the basis of 150% of direct labor cost. Job No. 176 is charged with $50,000 of direct materials costs and $60,000 of manufacturing overhead. The total manufacturing costs for Job No. 176 is a. $110,000. b. $200,000. c. $150,000. d. $135,000. Redman Company manufactures customized desks. The following pertains to Job No. 978: Direct materials used Direct labor hours worked Direct labor rate per hour Machine hours used Applied factory overhead rate per machine hour What is the total manufacturing cost for Job No. 978? a. $13,100 b. $14,300 c. $15,300 d. $16,500 $6,300 300 $12.00 200 $22.00 85. 20 - 14 Test Bank for Accounting Principles, Eighth Edition 86. Henson Company applies overhead on the basis of 120% of direct labor cost. Job No. 190 is charged with $60,000 of direct materials costs and $90,000 of manufacturing overhead. The total manufacturing costs for Job No. 190 is a. $150,000. b. $258,000. c. $162,000. d. $225,000. Norman Company manufactures customized desks. The following pertains to Job No. 953: Direct materials used Direct labor hours worked Direct labor rate per hour Machine hours used Applied factory overhead rate per machine hour What is the total manufacturing cost for Job No. 953? a. $17,600 b. $19,200 c. $20,600 d. $22,200 88. Oliver Company provided the following information from its accounting records for 2008: Expected production Actual production Budgeted overhead Actual overhead 60,000 labor hours 56,000 labor hours $1,500,000 $1,450,000 $8,400 300 $16.00 200 $30.00 87. How much is the overhead application rate if Oliver Company bases it on direct labor hours? a. $25.00 per hour b. $26.79 per hour c. $25.89 per hour d. $24.17 per hour 89. The labor costs that have been identified as indirect labor should be charged to a. manufacturing overhead. b. direct labor. c. the individual jobs worked on. d. salary expense. Manufacturing overhead is applied to each job a. at the time when the overhead cost is incurred. b. by means of a predetermined overhead rate. c. at the end of the year when actual costs are known. d. only if the overhead costs can be directly traced to that job. The predetermined overhead rate is based on the relationship between a. estimated annual costs and actual activity. b. estimated annual costs and expected annual activity. c. actual monthly costs and actual annual activity. d. estimated monthly costs and actual monthly activity. 90. 91. Job Order Cost Accounting 92. The predetermined overhead rate is a. determined on a moving average basis throughout the year. b. not calculated until actual overhead costs are incurred. c. determined at the beginning of the year. d. determined at the end of the current year. 20 - 15 93. In calculating a predetermined overhead rate, a recent trend in automated manufacturing operations is to choose an activity base related to a. direct labor hours. b. indirect labor dollars. c. machine hours. d. raw materials dollars. If annual overhead costs are expected to be $750,000 and direct labor costs are expected to be $1,000,000, then a. $1.33 is the predetermined overhead rate. b. for every dollar of manufacturing overhead, 75 cents of direct labor will be assigned. c. for every dollar of direct labor, 75 cents of manufacturing overhead will be assigned. d. a predetermined overhead rate cannot be determined. Overhead application is recorded with a a. credit to Work in Process Inventory. b. credit to Manufacturing Overhead. c. debit to Manufacturing Overhead. d. credit to job cost sheets. Manufacturing overhead applied is added to direct labor incurred and to what other item to equal total manufacturing costs for the period? a. Goods available for sale b. Raw materials purchased c. Work in process d. Direct materials used At the beginning of the year, Monroe Company estimates annual overhead costs to be $1,500,000 and that 300,000 machine hours will be operated. Using machine hours as a base, the amount of overhead applied during the year if actual machine hours for the year was 315,000 hours is a. $1,500,000. b. $1,428,572. c. $1,050,000. d. $1,575,000. Cost of goods sold is obtained from a. analysis of all the control accounts in the cost system. b. the finished goods inventory records. c. the work in process inventory records. d. the Raw Materials Inventory control account. When determining costs of jobs, how does a company account for indirect materials? a. It is added to work in process as used. b. It remains part of raw materials inventory. c. It is transferred out of raw materials into manufacturing overhead when used. d. It is transferred out of raw materials into work in process as used. 94. 95. 96. 97. 98. 99. 20 - 16 Test Bank for Accounting Principles, Eighth Edition 100. In a job order cost system, a credit to Manufacturing Overhead will be accompanied by a debit to a. Cost of Goods Manufactured. b. Finished Goods Inventory. c. Work in Process Inventory. d. Raw Materials Inventory. During 2008, Lawson Manufacturing expected Job No. 26 to cost $600,000 of overhead, $1,000,000 of materials, and $400,000 in labor. Lawson applied overhead based on direct labor cost. Actual production required an overhead cost of $560,000, $1,100,000 in materials used, and $440,000 in labor. All of the goods were completed. What amount was transferred to Finished Goods? a. $2,000,000 b. $2,100,000 c. $2,140,000 d. $2,200,000 Debits to Work in Process Inventory are accompanied by a credit to all but which one of the following accounts? a. Raw Materials Inventory b. Factory Labor c. Manufacturing Overhead d. Cost of Goods Sold Which of the following is not viewed as part of accumulating manufacturing costs in a job order cost system? a. Cost of goods sold is recognized b. Raw materials are purchased c. Factory labor is incurred d. Manufacturing overhead is incurred Which of the following is not viewed as part of assigning manufacturing costs in a job order cost system? a. Manufacturing overhead is applied b. Raw materials are used c. Manufacturing overhead is incurred d. Completed goods are recognized In determining total manufacturing costs on the cost of goods manufactured schedule, a. beginning work in process inventory should have a zero balance. b. actual manufacturing overhead costs appear as a deduction. c. manufacturing overhead applied is added to direct materials and direct labor. d. ending work in process inventory is deducted from beginning work in process inventory. 101. 102. 103. 104. 105. Job Order Cost Accounting Use the following information for questions 106107. Baxter Company developed the following data for the current year: Beginning work in process inventory Direct materials used Actual overhead Overhead applied Cost of goods manufactured Total manufacturing costs 106. Baxter Company's direct labor cost for the year is a. $45,000. b. $225,000. c. $135,000. d. $180,000. Baxter Company's ending work in process inventory is a. $435,000. b. $300,000. c. $285,000. d. $135,000. Russell Manufacturing Company developed the following data: Beginning work in process inventory Direct materials used Actual overhead Overhead applied Cost of goods manufactured Ending work in process $180,000 140,000 220,000 160,000 240,000 300,000 $150,000 90,000 180,000 135,000 165,000 450,000 20 - 17 107. 108. Russell Manufacturing Company's total manufacturing costs for the period is a. $380,000. b. $360,000. c. $260,000. d. cannot be determined from the data provided. 109. Which of the following is not used in assigning manufacturing costs to work in process inventory? a. Actual manufacturing overhead b. Time tickets c. Materials requisitions d. Predetermined overhead rate On the cost of goods manufactured schedule, the cost of goods manufactured agrees with the a. balance of Finished Goods Inventory at the end of the period. b. total debits to Work in Process Inventory during the period. c. amount transferred from Work in Process Inventory to Finished Goods during the period. d. debits to Cost of Goods Sold during the period. 110. 20 - 18 Test Bank for Accounting Principles, Eighth Edition 111. Gannon Company had the following information at December 31: Finished goods inventory, January 1 Finished goods inventory, December 31 $ 50,000 150,000 If the cost of goods manufactured during the year amounted to $2,100,000 and annual sales were $2,750,000, the amount of gross profit for the year is a. $650,000. b. $2,000,000. c. $750,000. d. $550,000. 112. Vernon Company incurred direct materials costs of $500,000 during the year. Manufacturing overhead applied was $90,000 and is applied at the rate of 60% of direct labor costs. Vernon Companys total manufacturing costs for the year was a. $740,000. b. $644,000. c. $590,000. d. $944,000. Use the following information for questions 113114. Payne Company developed the following data for the current year: Beginning work in process inventory Direct materials used Actual overhead Overhead applied Cost of goods manufactured Total manufacturing costs 113. $ 34,000 52,000 44,000 46,000 225,000 214,000 How much is Payne Company's direct labor cost for the year? a. $127,000 b. $150,000 c. $116,000 d. $82,000 How much is Payne Company's ending work in process inventory for the year? a. $23,000 b. $121,000 c. $21,000 d. $93,000 Chmelar Manufacturing Company developed the following data: Beginning work in process inventory Direct materials used Actual overhead Overhead applied Cost of goods manufactured Ending work in process $ 20,000 120,000 140,000 135,000 320,000 15,000 114. 115. Job Order Cost Accounting How much are total manufacturing costs for the period? a. $395,000 b. $315,000 c. $275,000 d. $305,000 116. Barger Company had the following information at December 31: Finished goods inventory, January 1 Finished goods inventory, December 31 $30,000 42,000 20 - 19 If the cost of goods manufactured during the year amounted to $665,000 and annual sales were $998,000, how much is the amount of gross profit for the year? a. $333,000 b. $303,000 c. $653,000 d. $345,000 117. Chin Company incurred direct materials costs of $300,000 during the year. Manufacturing overhead applied was $280,000 and is applied based on direct labor costs. The predetermined overhead rate is 70%. How much are Chin Companys total manufacturing costs for the year? a. $776,000 b. $700,000 c. $580,000 d. $980,000 During 2008, Denson Manufacturing expected Job No. 51 to cost $450,000 of overhead, $750,000 of materials, and $300,000 in labor. Denson applied overhead based on direct labor cost. Actual production required an overhead cost of $420,000, $825,000 in materials used, and $330,000 in labor. All of the goods were completed. What amount was transferred to Finished Goods? a. $1,605,000 b. $1,650,000 c. $1,500,000 d. $1,575,000 During 2008, Speck Manufacturing expected Job No. 59 to cost $450,000 of overhead, $750,000 of materials, and $300,000 in labor. Speck applied overhead based on direct labor cost. Actual production required an overhead cost of $420,000, $825,000 in materials used, and $330,000 in labor. All of the goods were completed. How much is the amount of over- or underapplied overhead? a. $30,000 underapplied b. $30,000 overapplied c. $75,000 underapplied d. $75,000 overapplied Kimble Company applies overhead on the basis of machine hours. Given the following data, compute overhead applied and the under- or overapplication of overhead for the period: Estimated annual overhead cost $1,200,000 Actual annual overhead cost $1,145,000 Estimated machine hours 300,000 Actual machine hours 280,000 118. 119. 120. 20 - 20 Test Bank for Accounting Principles, Eighth Edition a. b. c. d. 121. $1,120,000 applied and $25,000 overapplied $1,200,000 applied and $25,000 overapplied $1,120,000 applied and $25,000 underapplied $1,145,000 applied and neither under- nor overapplied Barnes Company applies overhead on the basis of machine hours. Given the following data, compute overhead applied and the under- or overapplication of overhead for the period: Estimated annual overhead cost Actual annual overhead cost Estimated machine hours Actual machine hours a. b. c. d. $1,500,000 $1,430,000 375,000 350,000 $1,400,000 applied and $30,000 overapplied $1,500,000 applied and $30,000 overapplied $1,400,000 applied and $30,000 underapplied $1,430,000 applied and neither under- nor overapplied 122. A company assigned overhead to work in process. At year end, what does the amount of overapplied overhead mean? a. The overhead assigned to work in process is greater than the estimated overhead costs. b. The overhead assigned to work in process is less than the estimated overhead costs. c. The overhead assigned to work in process is less than the actual overhead. d. The overhead assigned to work in process is greater than the overhead incurred. If the Manufacturing Overhead account has a debit balance at the end of a period, it means that a. actual overhead costs were less than overhead costs applied to jobs. b. actual overhead costs were greater than overhead costs applied to jobs. c. actual overhead costs were equal to overhead costs applied to jobs. d. no jobs have been completed. If the manufacturing overhead costs applied to jobs worked on were greater than the actual manufacturing costs incurred during a period, overhead is said to be a. underapplied. b. overapplied. c. in error. d. prepaid. At the end of the year, any balance in the Manufacturing Overhead account is generally eliminated by adjusting a. Work In Process Inventory. b. Finished Goods Inventory. c. Cost of Goods Sold. d. Raw Materials Inventory. If Manufacturing Overhead has a credit balance at the end of the period, then a. overhead has been underapplied. b. the overhead assigned to Work in Process Inventory is less than the overhead incurred. c. overhead has been overapplied. d. management must take corrective action. 123. 124. 125. 126. Job Order Cost Accounting 127. 20 - 21 The Manufacturing Overhead account shows debits of $30,000, $24,000, and $28,000 and one credit for $86,000. Based on this information, manufacturing overhead a. has been overapplied. b. has been underapplied. c. has not been applied. d. shows a zero balance. When monthly financial statements are prepared, a difference between actual overhead and overhead applied will appear on a. the balance sheet. b. the income statement. c. the statement of stockholders' equity. d. none of the financial statements. When monthly financial statements are prepared, overapplied overhead will appear as a. unearned revenue. b. a current asset. c. a loss on the income statement under "Other Expenses and Losses." d. miscellaneous expense. When monthly financial statements are prepared, underapplied overhead will appear as a. unearned revenue. b. a current asset. c. "Other Revenues and Gains," on the income statement. d. a reduction to cost of goods sold. If manufacturing overhead has been underapplied during the year, the adjusting entry at the end of the year will show a a. debit to Manufacturing Overhead. b. credit to Cost of Goods Sold. c. debit to Work in Process Inventory. d. debit to Cost of Goods Sold. If manufacturing overhead has been overapplied during the year, the adjusting entry at the end of the year will show a a. debit to Manufacturing Overhead. b. credit to Finished Goods Inventory c. debit to Cost of Goods Sold. d. credit to Work in Process Inventory. The existence of under- or overapplied overhead at the end of the month a. is expected to be offset in future months. b. indicates that an error has been made. c. requires a retroactive adjustment to the cost of all jobs completed. d. is written off as a bad estimate expense. Conceptually, any under- or overapplied overhead at the end of the year should be allocated among all of the following except a. cost of goods sold. b. ending work in process inventory. c. ending raw materials inventory. d. ending finished goods inventory. 128. 129. 130. 131. 132. 133. 134. 20 - 22 Test Bank for Accounting Principles, Eighth Edition 135. If, at the end of the year, Manufacturing Overhead has been overapplied, it means that a. actual overhead costs were greater than the overhead assigned to jobs. b. actual overhead costs were less than the overhead assigned to jobs. c. overhead has not been applied to jobs still in process. d. cost of goods will have to be increased by the amount of the overapplied overhead. Additional Multiple Choice Questions 136. A process cost system would be used for all of the following except the a. manufacture of cereal. b. refining of petroleum. c. printing of wedding invitations. d. production of automobiles. In a job order cost system, it would be correct in recording the purchase of raw materials to debit a. Work in Process Inventory. b. Work in Process and Manufacturing Overhead. c. Raw Materials Inventory. d. Finished Goods Inventory. In a manufacturing company, the cost of factory labor consists of all of the following except a. employer payroll taxes. b. fringe benefits incurred by the employer. c. net earnings of factory workers. d. gross earnings of factory workers. Which of the following is not a control account? a. Raw Materials Inventory b. Factory Labor c. Manufacturing Overhead d. All of these are control accounts. When the company assigns factory labor costs to jobs, the direct labor cost is debited to a. Direct Labor. b. Factory Labor. c. Manufacturing Overhead. d. Work in Process Inventory. Jinnah Company applies overhead on the basis of 200% of direct labor cost. Job No. 501 is charged with $60,000 of direct materials costs and $80,000 of manufacturing overhead. The total manufacturing costs for Job No. 501 is a. $140,000. b. $220,000. c. $180,000. d. $200,000. Companies assign Manufacturing overhead to work in process on an estimated basis through the use of a(n) 137. 138. 139. 140. 141. 142. Job Order Cost Accounting a. b. c. d. 143. actual overhead rate. estimated overhead rate. assigned overhead rate. predetermined overhead rate. 20 - 23 Overapplied manufacturing overhead exists when overhead assigned to work in process is a. more than overhead incurred and there is a debit balance in Manufacturing Overhead at the end of a period. b. less than overhead incurred and there is a debit balance in Manufacturing Overhead at the end of a period. c. more than overhead incurred and there is a credit balance in Manufacturing Overhead at the end of a period. d. less than overhead incurred and there is a credit balance in Manufacturing Overhead at the end of a period. Usually, under- or overapplied overhead is considered to be an adjustment to a. work in process. b. finished goods. c. finished goods and cost of goods sold. d. cost of goods sold. Which of the following statements about under- or overapplied manufacturing overhead is correct? a. After the entry to transfer over- or underapplied overhead to Cost of Goods Sold is posted, Manufacturing Overhead will have a zero balance. b. When Manufacturing Overhead has a credit balance, overhead is said to be underapplied. c. At the end of the year, under- or overapplied overhead is eliminated by a closing entry. d. When annual financial statements are prepared, overapplied overhead is reported in current liabilities. 144. 145. Answers to Multiple Choice Questions Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. a d b c d a c b b a b d c b d b 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. b a c d a c b d d a c d d b d d 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. a b c c c c a a c c b d c c b b 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94. 95. 96. 97. 98. 99. c b d b a a b b c c c b d d b c 100. 101. 102. 103. 104. 105. 106. 107. 108. 109. 110. 111. 112. 113. 114. 115. c d d a c c b a b a c c a c a b 116. 117. 118. 119. 120. 121. 122. 123. 124. 125. 126. 127. 128. 129. 130. 131. d d b d c c d b b c c a a a b d 132. 133. 134. 135. 136. 137. 138. 139. 140. 141. 142. 143. 144. 145. a a c b c c c b d c d c d a 20 - 24 Test Bank for Accounting Principles, Eighth Edition BRIEF EXERCISES BE 146 During the first year of operations, Shapiro Tool accumulated the following manufacturing costs: Raw materials purchased on account Factory labor accrued Incurred manufacturing overhead on account Instructions Prepare separate journal entries for each manufacturing cost. $8,000 6,000 4,000 Solution 146 (4 min.) 8,000 8,000 6,000 6,000 4,000 4,000 Raw Materials Inventory...................................................................... Accounts Payable....................................................................... Factory Labor ...................................................................................... Factory Wages Payable ............................................................. Manufacturing Overhead..................................................................... Accounts Payable....................................................................... BE 147 In January, Harlan, Inc. production supervisor requisitioned raw materials for production as follows: Job 1 $600, Job 2 $900, Job 3 $300, and general factory use, $520. Instructions Prepare a summary journal entry to record raw materials used. Solution 147 (2 min.) 1,800 520 2,320 Work in Process Inventory .................................................................. Manufacturing Overhead..................................................................... Raw Materials Inventory ............................................................. BE 148 Lando Company reported the following amounts for 2008: Raw materials purchased Beginning raw materials inventory Ending raw materials inventory $98,000 5,200 4,500 Ending work in process inventory $ 6,300 Manufacturing overhead costs applied 36,000 Beginning work in process inventory 6,100 Instructions Calculate the cost of materials used in production Job Order Cost Accounting Solution 148 (2 min.) 20 - 25 $5,200 + $98,000 $4,500 = $98,700 BE 149 Builder Bug Company allocates overhead at $9 per direct labor hour. Job A45 required 5 boxes of direct materials at a cost of $30 per box and took employees 12 hours to complete. Employees earn $15 per hour. Instructions Compute the total cost of Job A45. Solution 149 (4 min.) $150 180 108 $438 Direct materials (5 $30) Direct labor (12 hours $15) Overhead (12 hours $9) Total job cost BE 150 Samli Company estimates that annual manufacturing overhead costs will be $600,000. Estimated annual operating activity bases are: direct labor cost $460,000, direct labor hours 40,000 and machine hours 80,000. The actual manufacturing overhead cost for the year was $602,000 and the actual direct labor cost for the year was $456,000. Actual direct labor hours totaled 40,200 and machine hours totaled 79,000. Samli applies overhead based on direct labor hours. Instructions Compute the predetermined overhead rate and determine the amount of manufacturing overhead applied. Determine if overhead is over- or underapplied and the amount. Solution 150 (5 min.) Rate = $600,000 40,000 = $15.00 per direct labor hour Applied = $15 40,200 = $603,000 Overapplied = $603,000 - $602,000 = $1,000 BE 151 Martin Company applies manufacturing overhead based on direct labor hours. Information concerning manufacturing overhead and labor for the year follows: Actual manufacturing overhead $150,000 Estimated manufacturing overhead $140,000 Direct labor hours incurred 4,800 Direct labor hours estimated 5,000 20 - 26 Test Bank for Principles, Accounting Eighth Edition BE 151 (cont.) Instructions Compute the predetermined overhead rate. Solution 151 (2 min.) $140,000 5,000 = $28.00 per direct labor hour BE 152 The manufacturing operations of Reason, Inc. had the following balances for the month of January: Inventories Raw materials Work in process Finished goods January 1 $12,000 21,000 14,000 January 31 $13,000 23,000 16,000 Reason transferred $220,000 of completed goods out of work in process during January. Instructions Compute the cost of goods sold. Solution 152 (2 min.) $14,000 + $220,000 $16,000 = $218,000 BE 153 The following amounts were reported by Samli Company before adjusting its immaterial overapplied manufacturing overhead of $8,000. Raw Materials Inventory Finished Goods Inventory Work in Process Inventory Cost of Goods Sold $ 40,000 60,000 100,000 840,000 Instructions Compute what amount Samli will report as cost of goods sold after it disposes of its overapplied overhead. Solution 153 (2 min.) $840,000 $8,000 = $832,000 Job Order Cost Accounting BE 154 20 - 27 During 2008, Mix Company incurred the following direct labor costs: January $10,000 and February $20,000. Mix uses a predetermined overhead rate of 120% of direct labor cost. Estimated overhead for the 2 months, respectively, totaled $13,000 and $23,800. Actual overhead for the 2 months, respectively, totaled $12,300 and $21,800. Instructions Determine if overhead is over- or underapplied for each of the two months and the respective amounts. Solution 154 (4 min.) Overhead applied: January: 120% $10,000 = $12,000 February: 120% $20,000 = $24,000 Over- or underapplied: January: $12,000 $12,300 = $300 underapplied February: $24,000 $21,800 = $2,200 overapplied BE 155 At December 31, Ding Company reported the following balances in its accounts: Cost of Goods Sold Finished Goods Inventory $210,000 30,000 The companys balance in its Manufacturing Overhead account at the same date was a debit of $6,600. Instructions Prepare the entry to adjust the over- or underapplied overhead amount at December 31. Solution 155 (2 min.) 6,600 6,600 Cost of Goods Sold................................................................................ Manufacturing Overhead ................................................................ 20 - 28 Test Bank for Accounting Principles, Eighth Edition EXERCISES Ex. 156 The manufacturing operations of Seeley, Inc. had the following balances for the month of January: Raw materials Work in process Finished goods January 1 $12,000 21,000 14,000 January 31 $13,000 23,000 16,000 Seeley transferred $250,000 of completed goods out of work in process during January. Instructions Compute the cost of goods sold for January. Solution 156 (3 min.) $14,000 + $250,000 - $16,000 = $248,000 Ex. 157 A selected list of accounts used by Sloan Manufacturing Company follows: Code A Cash B Accounts Receivable C Raw Materials Inventory D Work In Process Inventory E Finished Goods Inventory Code F G H I J Accounts Payable Factory Labor Manufacturing Overhead Cost of Goods Sold Sales Sloan Manufacturing Company uses a job order system and maintains perpetual inventory records. Instructions Place the appropriate code letter in the columns indicating the appropriate account(s) to be debited and credited for the transactions listed below. Account(s) Account(s) Transactions Debited Credited 1. Raw materials were purchased on account. 2. Issued a check to Estes Machine Shop for repair work on factory equipment. 3. Direct materials were requisitioned for Job 280. 4. Factory labor was paid as incurred. 5. Recognized direct labor and indirect labor used. Job Order Cost Accounting Ex. 157 (cont.) 20 - 29 Account(s) Account(s) Transactions Debited Credited 6. The production department requisitioned indirect materials for use in the factory. 7. Overhead was applied to production based on a predetermined overhead rate of $8 per labor hour. 8. Goods that were completed were transferred to finished goods. 9. Goods costing $80,000 were sold for $105,000 on account. 10. Paid for raw materials purchased previously on account. Solution 157 (1015 min.) Account(s) Account(s) Transactions Debited Credited 1. Raw materials were purchased on account. C F 2. Issued a check to Estes Machine Shop for H A repair work on factory equipment. 3. Direct materials were requisitioned for Job 280 D C 4. Factory labor was paid as incurred. G A 5. Recognized direct labor and indirect labor used D, H G 6. The production department requisitioned indirect H C materials for use in the factory. 7. Overhead was applied to production based on a on a predetermined overhead rate of $8 per labor hour D H 8. Goods that were completed were transferred to E D finished goods. 9. Goods costing $80,000 were sold for $105,000 B, I J, E on account. 10. Paid for raw materials purchased previously F A on account. 20 - 30 Test Bank for Accounting Principles, Eighth Edition Ex. 158 Finn Manufacturing Company uses a job order cost accounting system and keeps perpetual inventory records. Prepare journal entries to record the following transactions during the month of June. June 1 8 Purchased raw materials for $25,000 on account. Raw materials requisitioned by production: Direct materials $8,000 Indirect materials 1,000 Paid factory utilities, $2,100 and repairs for factory equipment, $3,000. Incurred $78,000 of factory labor. Time tickets indicated the following: Direct Labor (4,500 hrs $12 per hr) = Indirect Labor (3,000 hrs $8 per hr) = $54,000 24,000 $78,000 15 25 25 25 Applied manufacturing overhead to production based on a predetermined overhead rate of $9 per direct labor hour worked. Goods costing $18,000 were completed in the factory and were transferred to finished goods. Goods costing $15,000 were sold for $20,000 on account. 28 30 Solution 158 June 1 (1623 min.) 25,000 25,000 Raw Materials Inventory ..................................................... Accounts Payable ...................................................... (Purchase of raw materials on account) Work In Process Inventory .................................................. Manufacturing Overhead .................................................... Raw Materials Inventory ............................................ (To assign materials to jobs and overhead) Manufacturing Overhead .................................................... Cash .......................................................................... (To record payment of factory utilities and repairs) Factory Labor ...................................................................... Factory Wages Payable ............................................. (To record factory labor costs) Work In Process Inventory .................................................. Manufacturing Overhead .................................................... Factory Labor ............................................................. (To assign factory labor to jobs and overhead) 8 8,000 1,000 9,000 15 5,100 5,100 25 78,000 78,000 25 54,000 24,000 78,000 Job Order Cost Accounting Solution 158 25 (cont.) 40,500 20 - 31 Work In Process Inventory .................................................. Manufacturing Overhead ............................................ (To apply overhead to jobs) Finished Goods Inventory ................................................... Work In Process Inventory ......................................... (To record completion of production) Accounts Receivable ........................................................... Cost of Goods Sold ............................................................. Sales ........................................................................... Finished Goods Inventory ........................................... (To record sales of finished goods and its cost) 40,500 28 18,000 18,000 30 20,000 15,000 20,000 15,000 Ex. 159 Selected accounts of Kosar Manufacturing Company at year end appear below: RAW MATERIALS INVENTORY (a) 40,000 (d) 25,000 WORK IN PROCESS INVENTORY (d) (e) (f) 25,000 60,000 90,000 (g) 140,000 FINISHED GOODS INVENTORY (g) 140,000 (h) 120,000 (h) COST OF GOODS SOLD 120,000 MANUFACTURING OVERHEAD FACTORY LABOR (b) 110,000 (e) 85,000 (c) (e) 75,000 25,000 (f) 90,000 Instructions Explain the probable transaction that took place for each of the items identified by letters in the accounts. For example: (a) Raw materials costing $40,000 were purchased. Solution 159 (a) (b) (c) (d) (e) (914 min.) (f) (g) (h) Raw materials costing $40,000 were purchased. Factory labor costs incurred amounted to $110,000. Actual manufacturing overhead costs incurred were $75,000. Direct materials requisitioned for production amounted to $25,000. Factory labor used consisted of: Direct labor $60,000 Indirect labor 25,000 Manufacturing overhead applied to production was $90,000. Completed goods costing $140,000 were transferred to finished goods inventory. Finished goods costing $120,000 were sold. 20 - 32 Test Bank for Accounting Principles, Eighth Edition Ex. 160 Sardin Company begins the month of March with $17,000 of work in process costs from Job 324. Information from job cost sheets shows the following additional costs assigned during March, April, and May of 2008: Manufacturing Costs Assigned Job No. March April May 324 $26,000 325 18,000 $23,000 $15,000 326 41,000 11,000 327 16,000 31,000 328 24,000 46,000 Job 324 was completed in March. Jobs 325 and 327 were completed in May, and Job 326 was completed in April. Jobs are sold during the month after completion. Total revenue for jobs sold during the 3-month period is $145,000. Instructions Calculate the balances of the work in process and finished goods inventory accounts at the end of May. Solution 160 (56 min.) Work in process Job 328 $24,000 + $46,000 = $70,000 Finished goods Job 325 $18,000 + $23,000 + $15,000 = $ 56,000 Job 327 $16,000 + $31,000 = 47,000 $103,000 Ex. 161 The gross earnings of factory workers for Dinkel Company during the month of January are $250,000. The employer's payroll taxes for the factory payroll are $30,000. Of the total accumulated cost of factory labor, 75% is related to direct labor and 25% is attributable to indirect labor. Instructions (a) Prepare the entry to record the factory labor costs for the month of January. (b) Prepare the entry to assign factory labor to production. (c) Prepare the entry to assign manufacturing overhead to production, assuming the predetermined overhead rate is 125% of direct labor cost. Solution 161 (a) (812 min.) 280,000 250,000 30,000 Factory Labor ............................................................................... Factory Wages Payable....................................................... Payroll Taxes Payable ......................................................... Job Order Cost Accounting Solution 161 (b) (cont.) 210,000 70,000 20 - 33 Work in Process Inventory ............................................................ Manufacturing Overhead............................................................... Factory Labor ....................................................................... ($280,000 75% = $210,000) Work in Process Inventory ............................................................ Manufacturing Overhead...................................................... ($210,000 125% = $262,500) 280,000 (c) 262,500 262,500 Ex. 162 Darden Manufacturing uses a job order cost accounting system. On April 1, the company has Work in Process Inventory of $7,600 and two jobs in process: Job No. 221, $3,600, and Job No. 222, $4,000. During April, a summary of source documents reveals the following: For Job No. 221 222 223 224 General use Totals Materials Requisition Slips $2,200 1,700 2,400 2,100 600 $9,000 Labor Time Tickets $ 3,600 3,200 2,900 2,800 400 $12,900 Darden applies manufacturing overhead to jobs at an overhead rate of 60% of direct labor cost. Job No. 221 is completed during the month. Instructions (a) Prepare summary journal entries to record the raw materials requisitioned, factory labor used, the assignment of manufacturing overhead to jobs, and the completion of Job No. 221. (b) Calculate the balance of the Work in Process Inventory account at April 30. Solution 162 (a) April 30 (1015 min.) Work in Process Inventory ............................................. Manufacturing Overhead ................................................ Raw Materials Inventory ........................................ Work in Process Inventory ............................................. Manufacturing Overhead ................................................ Factory Labor ........................................................ Work in Process Inventory ............................................. Manufacturing Overhead ....................................... ($12,500 60% = $7,500) Finished Goods Inventory .............................................. Work in Process Inventory..................................... ($3,600 + $2,200 + $3,600 + $2,160 = $11,560) 8,400 600 9,000 12,500 400 12,900 7,500 7,500 11,560 11,560 20 - 34 Test Bank for Accounting Principles, Eighth Edition Solution 162 (cont.) (b) Work in Process Inventory, April 30 = $24,440 Job No. 222 Job No. 223 Job No. 224 $10,820 7,040 6,580 $24,440 ($4,000 + $1,700 + $3,200 + $1,920) ($2,400 + $2,900 + $1,740) ($2,100 + $2,800 + $1,680) Ex. 163 Manufacturing cost data for Dolan Company, which uses a job order cost system, are presented below: Case A Case B Direct Materials Used (a) $103,000 Direct Labor $ 70,000 130,000 Manufacturing Overhead Applied 56,000 (d) Total Manufacturing Costs 230,000 (e) Work in Process, 1/1/08 (b) 45,000 Total Cost of Work in Process 290,000 (f) Work in Process, 12/31/08 (c) 40,000 Cost of Goods Manufactured 210,000 (g) Instructions Indicate the missing amount for each letter. Assume that overhead is applied on the basis of direct labor cost and that the rate is the same for both cases. Solution 163 Case A (912 min.) $290,000 (c) = $210,000 (c) = $80,000 (a) + $70,000 + $56,000 = $230,000 (a) = $104,000 $230,000 + (b) = $290,000 (b) = $60,000 Case B [Note that the overhead rate from Case A is 80% ($56,000 $70,000)] $130,000 80% = (d) (d) = $104,000 $103,000 + $130,000 + $104,000 = (e) (e) = $337,000 $337,000 + $45,000 = (f) (f) = $382,000 $382,000 $40,000 = (g) (g) = $342,000 Job Order Cost Accounting Ex. 164 20 - 35 Farr Corporation had the following transactions during its first month of operations: 1. Purchased raw materials on account, $85,000. 2. Raw Materials of $30,000 were requisitioned to the factory. An analysis of the materials requisition slips indicated that $6,000 was classified as indirect materials. 3. Factory labor costs incurred were $125,000 of which $100,000 pertained to factory wages payable and $25,000 pertained to employer payroll taxes payable. 4. Time tickets indicated that $104,000 was direct labor and $21,000 was indirect labor. 5. Overhead costs incurred on account were $112,000. 6. Manufacturing overhead was applied at the rate of 150% of direct labor cost. 7. Goods costing $135,000 are still incomplete at the end of the month; the other goods were completed and transferred to finished goods. 8. Finished goods costing $100,000 to manufacture were sold on account for $130,000. Instructions Journalize the above transactions for Farr Corporation. Solution 164 (1217 min.) 85,000 85,000 24,000 6,000 30,000 125,000 100,000 25,000 104,000 21,000 125,000 112,000 112,000 156,000 156,000 149,000 149,000 1. Raw Materials Inventory................................................................... Accounts Payable.................................................................... 2. Work in Process Inventory ............................................................... Manufacturing Overhead.................................................................. Raw Materials Inventory.......................................................... 3. Factory Labor ................................................................................... Factory Wages Payable .......................................................... Payroll Taxes Payable............................................................. 4. Work in Process Inventory ............................................................... Manufacturing Overhead.................................................................. Factory Labor .......................................................................... 5. Manufacturing Overhead.................................................................. Accounts Payable.................................................................... 6. Work in Process Inventory ............................................................... Manufacturing Overhead......................................................... ($104,000 150% = $156,000) 7. Finished Goods Inventory ................................................................ Work in Process Inventory ...................................................... ($24,000 + $104,000 + $156,000 = $284,000) ($284,000 $135,000 = $149,000) 8. Accounts Receivable........................................................................ Sales ....................................................................................... Cost of Goods Sold .......................................................................... Finished Goods Inventory ....................................................... 130,000 130,000 100,000 100,000 20 - 36 Test Bank for Accounting Principles, Eighth Edition Ex. 165 Lando Company reported the following amounts for 2008: Raw materials purchased Beginning raw materials inventory Ending raw materials inventory Beginning finished goods inventory Ending finished goods inventory Direct labor used Manufacturing overhead costs applied Beginning work in process inventory Ending work in process inventory $103,000 5,200 4,500 7,600 8,000 25,000 36,000 6,100 6,300 Instructions Calculate (a) the cost of materials used in production and (b) total manufacturing costs. Solution 165 (4 min.) (a) Cost of materials used in production: $5,200 + $103,000 $4,500 = $103,700 (b) Total manufacturing costs: $103,700 + $25,000 + $36,000 = $164,700 Ex. 166 Watson Manufacturing Company employs a job order cost accounting system and keeps perpetual inventory records. The following transactions occurred in the first month of operations: 1. Direct materials requisitioned during the month: Job 101 $22,000 Job 102 20,000 Job 103 24,000 $66,000 2. Direct labor incurred and charged to jobs during the month was: Job 101 $30,000 Job 102 35,000 Job 103 25,000 $90,000 3. Manufacturing overhead was applied to jobs worked on using a predetermined overhead rate based on 80% of direct labor costs. 4. Actual manufacturing overhead costs incurred during the month amounted to $76,000. 5. Job 101 consisting of 1,000 units and Job 103 consisting of 200 units were completed during the month. Job Order Cost Accounting Ex. 166 (cont.) 20 - 37 Instructions (a) Prepare journal entries to record the above transactions. (b) Answer the following questions: 1. How much manufacturing overhead was applied to Job 103 during the month? 2. Compute the unit cost of Jobs 101 and 103. 3. What is the balance in Work In Process Inventory at the end of the month? 4. Determine if manufacturing overhead was under- or overapplied during the month. How much? Solution 166 (1520 min.) 66,000 66,000 90,000 90,000 72,000 72,000 76,000 76,000 145,000 145,000 (a) 1. Work in Process Inventory........................................................ Raw Materials Inventory .................................................. 2. Work in Process Inventory........................................................ Factory Labor .................................................................. 3. Work in Process Inventory........................................................ Manufacturing Overhead ................................................. 4. Manufacturing Overhead .......................................................... Cash, Payables, etc. ........................................................ 5. Finished Goods Inventory......................................................... Work in Process Inventory ............................................... [Job 101 $76,000; Job 103 $69,000see (b) 2] (b) 1. $20,000 ($25,000 80%). 2. Unit cost: Job 101, $76; Job 103, $300. Direct materials Direct labor Overhead applied Total cost Units Unit cost Job 101 $22,000 30,000 24,000 76,000 1,000 $76 Job 103 $24,000 25,000 20,000 69,000 200 $345 3. Work In Process Inventory is $83,000 and consists of work performed on Job 102. Job 102 Direct materials $20,000 Direct labor 35,000 Overhead applied 28,000 Total cost $83,000 4. Manufacturing overhead costs were underapplied by $4,000 during the month. Actual manufacturing overhead $76,000 Manufacturing overhead applied 72,000 Underapplied overhead $ 4,000 20 - 38 Test Bank for Accounting Principles, Eighth Edition Ex. 167 Carpet Manufacturing is a small manufacturer that uses machine-hours as its activity base for assigned overhead costs to jobs. The company estimated the following amounts for 2008 for the company and for Job 62: Company Job 62 Direct materials $60,000 $4,000 Direct labor $25,000 $2,500 Manufacturing overhead costs $54,000 Machine hours 90,000 1,350 During 2008, the actual machine-hours totaled 94,000, and actual overhead costs were $53,000. Instructions (a) Compute the predetermined overhead rate. (b) Compute the total manufacturing costs for Job 62. (c) How much overhead is over or underapplied for the year for the company? State amount and whether it is over- or underapplied. (d) If Carpet Manufacturing sells Job 62 for $14,000, compute the gross profit. Solution 167 (79 min.) (a) $54,000 90,000 = $0.60 per machine hour (b) $4,000 + $2,500 + ($0.60 1,350) = $7,310 (c) Actual Applied = Over/Underapplied $53,000 ($0.60 94,000) = $3,400 overapplied (d) $14,000 $7,310 (from (b) above) = $6,690 Ex. 168 The following inventory information is available for Ricci Manufacturing Corporation for the year ended December 31, 2008: Beginning Ending Inventories: Raw materials $17,000 $19,000 Work in process 9,000 14,000 Finished goods 11,000 8,000 Total $37,000 $41,000 In addition, the following transactions occurred in 2008: 1. Raw materials purchased on account, $95,000. 2. Incurred factory labor, $110,000, all is direct labor. (Credit Factory Wages Payable). 3. Incurred the following overhead costs during the year: Utilities $11,800, Depreciation on manufacturing machinery $10,000, Manufacturing machinery repairs $9,200, Factory insurance $9,000 (Credit Accounts Payable and Accumulated Depreciation). 4. Assigned $110,000 of factory labor to jobs. 5. Applied $44,000 of overhead to jobs. Instructions (a) Journalize the above transactions. (b) Reproduce the manufacturing cost and inventory accounts. Use T-accounts. Job Order Cost Accounting Ex. 168 (cont.) 20 - 39 (c) From an analysis of the accounts, compute the following: 1. Raw materials used. 2. Completed jobs transferred to finished goods. 3. Cost of goods sold. 4. Under- or overapplied overhead. Solution 168 (1622 min.) 95,000 95,000 110,000 110,000 40,000 30,000 10,000 110,000 110,000 44,000 44,000 (a) 1. Raw Materials Inventory ........................................................... Accounts Payable ............................................................ 2. Factory Labor............................................................................ Factory Wages Payable................................................... 3. Manufacturing Overhead .......................................................... Accounts Payable ............................................................ Accumulated Depreciation ............................................... 4. Work in Process Inventory........................................................ Factory Labor................................................................... 5. Work in Process Inventory........................................................ Manufacturing Overhead ................................................. (b) Raw Materials Inventory Bal. (1) Bal. 17,000 95,000 19,000 Bal. (4) (5) Bal. Work in Process Inventory 9,000 110,000 44,000 14,000 Factory Labor (2) 110,000 (4) 110,000 Finished Goods Inventory Bal. 11,000 8,000 Manufacturing Overhead (3) 40,000 (5) 44,000 Cost of Goods Sold (c) 1. Raw materials used = $17,000 + $95,000 $19,000 = $93,000. 2. Completed jobs transferred to finished goods = W/P debits $9,000 + $154,000 $14,000 = $149,000. 3. Cost of goods sold = $11,000 + $149,000 $8,000 = $152,000. 4. Overhead overapplied = $4,000 (credit balance in Manufacturing Overhead). 20 - 40 Test Bank for Accounting Principles, Eighth Edition Ex. 169 Builder Bug Company allocates manufacturing overhead at $9 per direct labor hour. Job A45 required 5 boxes of direct materials at a cost of $30 per box and took employees 14 hours to complete. Employees earn $15 per hour. Instructions Compute the total cost of Job A45. Solution 169 (5 min.) $150 210 126 $486 Direct materials (5 boxes $30) Direct labor (14 hours $15) Manufacturing overhead (14 hours $9) Total job cost of Job A45 Ex. 170 Job cost sheets for Howard Manufacturing are as follows: Job No 210 Quantity Manufacturing Overhead 12,000 1,500 Date July 1 8 10 15 25 Direct Materials 7,000 8,500 5,500 Direct Labor 8,000 11,000 14,000 Job No 211 Quantity Manufacturing Overhead 9,000 1,200 Date July 1 10 15 20 27 Direct Materials 4,000 9,000 7,000 Direct Labor 6,000 8,000 12,000 Instructions (a) Answer the following questions. 1. What was the balance in Work in Process Inventory on July 1 if these were the only unfinished jobs? 2. What was the predetermined overhead rate in June if overhead was applied on the basis of direct labor cost? 3. If July is the start of a new fiscal year and the overhead rate is 20% higher than in the preceding year, how much overhead should be applied to Job 210 in July? 4. Assuming Job 210 is complete, what is the total and unit cost of the job? Job Order Cost Accounting Ex. 170 (cont.) 20 - 41 5. Assuming Job 211 is the only unfinished job at July 31, what is the balance in Work in Process Inventory on this date? (b) Journalize the summary entries to record the assignment of costs to the jobs in July. (Note: Make one entry in total for each manufacturing cost element.) Solution 170 (1520 min.) (a) 1. Job 210 $7,000 + $8,000 + $12,000 = $27,000 Job 211 $4,000 + $6,000 + $9,000 = 19,000 $46,000 2. Manufacturing overhead rate = 150% of direct labor cost ($12,000 $8,000 or $9,000 $6,000) 3. July overhead rate = 150% 120% = 180% Overhead applied in July = $25,000 180% = $45,000 4. Direct materials Direct labor Manufacturing overhead ($12,000 + $45,000) Total cost Unit cost ($111,000 1,500) 5. Direct materials Direct labor Manufacturing overhead ($9,000 + $36,000) Total cost of work in process (b) Work in Process Inventory.............................................................. Raw Materials Inventory ........................................................ Work in Process Inventory.............................................................. Factory Labor......................................................................... Work in Process Inventory.............................................................. Manufacturing Overhead ....................................................... $ 21,000 33,000 57,000 $111,000 $74 $20,000 26,000 45,000 $91,000 30,000 30,000 45,000 45,000 81,000 81,000 Ex. 171 Garner Company begins operations on July 1, 2008. Information from job cost sheets shows the following: Manufacturing Costs Assigned Job No. July August September 100 $12,000 $8,800 101 9,800 9,700 $12,000 102 6,000 103 11,800 6,000 104 5,800 7,000 20 - 42 Test Bank for Accounting Principles, Eighth Edition Ex. 171 (cont.) Job 102 was completed in July. Job 100 was completed in August, and Jobs 101 and 103 were completed in September. Each job was sold for 50% above its cost in the month following completion. Instructions (a) Compute the balance in Work in Process Inventory at the end of July. (b) Compute the balance in Finished Goods Inventory at the end of September. (c) Compute the gross profit for August. Solution 171 (a) (1013 min.) $12,000 9,800 $21,800 $31,500 17,800 $49,300 Sales $9,000 COGS $6,000 Gross Profit $3,000 Work in Process Inventory July Job 100 Job 101 Balance, July 31 Finished Goods Inventory Job 101 Job 103 Balance, Sept. 30 Gross Profit Job Number Month August 102 (b) (c) Ex. 172 The accounting records of Roland Manufacturing Company include the following information: Dec. 31 Jan. 1 Work in process inventory $ 70,000 $ 50,000 Finished goods inventory 120,000 160,000 Direct materials used 350,000 Direct labor 220,000 Selling expenses 125,000 Manufacturing overhead is applied at a rate of 150% of direct labor cost. Instructions Answer the following questions: 1. What is the total of the debits to Work in Process Inventory during the year? 2. What is the amount transferred to Finished Goods Inventory during the year? 3. What is the cost of goods sold? Job Order Cost Accounting Solution 172 (1014 min.) $ 350,000 220,000 330,000 $900,000 20 - 43 1. Direct Materials Direct Labor Manufacturing Overhead Applied ($220,000 150%) Total debits 2. Balance From (1) Balance 3. Balance From WIP (see 2) Balance WORK IN PROCESS INVENTORY 50,000 900,000 70,000 Transferred to Finished Goods 880,000 FINISHED GOODS INVENTORY 160,000 880,000 120,000 Cost of Goods Sold 920,000 Ex. 173 Martin Company applies manufacturing overhead based on direct labor hours. Information concerning manufacturing overhead and labor for the year follows: Actual manufacturing overhead Estimated manufacturing overhead Direct labor hours incurred Direct labor hours estimated $118,000 $110,000 4,800 5,000 Instructions Compute (a) the predetermined overhead rate and (b) the amount of applied manufacturing overhead. Solution 173 (a) (b) (4 min.) Predetermined overhead rate: $110,000 5,000 = $22 per direct labor hour Applied manufacturing overhead: 4,800 $22 = $105,600 Ex. 174 Landis Company uses a job order cost system in each of its two manufacturing departments. Manufacturing overhead is applied to jobs on the basis of direct labor cost in Department A and machine hours in Department B. In establishing the predetermined overhead rates for 2008, the following estimates were made for the year: Department B A Manufacturing overhead $1,750,000 $1,600,000 Direct labor cost 1,400,000 1,200,000 Direct labor hours 100,000 100,000 Machine hours 200,000 400,000 20 - 44 Test Bank for Accounting Principles, Eighth Edition Ex. 174 (cont.) During January, the job cost sheet showed the following costs and production data: Department A B Direct materials used $195,000 $128,000 Direct labor cost 100,000 110,000 Manufacturing overhead incurred 135,000 130,000 Direct labor hours 8,000 8,400 Machine hours 16,000 34,000 Instructions (a) Compute the predetermined overhead rate for each department. (b) Compute the total manufacturing cost assigned to jobs in January in each department. (c) Compute the balance in the Manufacturing Overhead account at the end of January and indicate whether overhead is over- or underapplied. Solution 174 (1520 min.) (a) Predetermined overhead rates: Department A (using direct labor cost): $1,750,000 $1,400,000 = 125% Department B (using machine hours): $1,600,000 400,000 = $4 per machine hour (b) Total manufacturing costs by department: Department A: Direct materials Direct labor cost Manufacturing overhead applied ($100,000 125%) Total manufacturing costs Department B: Direct materials Direct labor cost Manufacturing overhead applied (34,000 hrs. $4) Total manufacturing costs (c) Dept. A Dept. B Bal. Underapplied MANUFACTURING OVERHEAD 135,000 130,000 265,000 4,000 Dept. A Dept. B 125,000 136,000 261,000 $195,000 100,000 125,000 $420,000 $128,000 110,000 136,000 $374,000 Ex. 175 Edwards Company applies manufacturing overhead to jobs on the basis of machine hours used. Overhead costs are expected to total $1,600,000 for the year, and machine usage is estimated at 200,000 hours. In January, $173,000 of overhead costs are incurred and 22,000 machine hours are used. For the remainder of the year, $1,720,000 of additional overhead costs are incurred and 214,000 additional machine hours are worked. Job Order Cost Accounting Ex. 175 (cont.) 20 - 45 Instructions (a) Compute the manufacturing overhead rate for the year. (b) What is the amount of over- or underapplied overhead at January 31? How should this amount be reported in the financial statements prepared on January 31? (c) What is the amount of over- or underapplied overhead at December 31? Solution 175 (a) (b) (1114 min.) $8 per machine hour ($1,600,000 200,000) Incurred Applied ($8 22,000) Overapplied overhead $173,000 176,000 $ 3,000 This amount should be reported as an unearned revenue in the current liability section of the January 31 balance sheet. (c) Incurred ($173,000 + $1,720,000) Applied ($8 236,000) Underapplied overhead $1,893,000 1,888,000 $ 5,000 Ex. 176 Klinger Company estimates that annual manufacturing overhead costs will be $2,400,000 for 2008. The actual overhead costs at the end of 2008 are $2,490,000. Activity base information for 2008 follows: Activity Base Estimated Actual Direct Labor Cost $2,000,000 $2,100,000 Direct Labor Hours 200,000 212,000 Machine Hours 150,000 152,000 Instructions (a) Compute the predetermined overhead rate for each activity base. (b) Compute the amount of overhead applied in 2008 for each activity base. (c) Compute the amount of under- or overapplied overhead for 2008 for each activity base. Solution 176 (1216 min.) (a) Predetermined overhead rate as a % of direct labor cost: $2,400,000 $2,000,000 = 120% Predetermined overhead rate per hour of direct labor: $2,400,000 200,000 = $12 per hour Predetermined overhead rate per machine hour used: $2,400,000 150,000 = $16 per machine hour 20 - 46 Test Bank for Accounting Principles, Eighth Edition Solution 176 (cont.) (c) Over- or Underapplied Overhead ($2,520,000 $2,490,000 = $30,000 Overapplied) ($2,544,000 $2,490,000 = $54,000 Overapplied) ($2,432,000 $2,490,000 = $58,000 Underapplied) (b) Overhead applied as a % of direct labor cost: $2,100,000 1.20 = $2,520,000 Overhead applied per hour of direct labor: 212,000 $12 = $2,544,000 Overhead applied per machine hour used: 152,000 $16 = $2,432,000 Ex. 177 Vannoy Manufacturing Company makes specialty tools. In January, Vannoy incurs manufacturing costs of $10,000,000 for direct materials, direct labor, and overhead. 25% of the total costs represents overhead applied. The overhead rate is $1 for every $2 of direct labor costs incurred. Inventory balances were: January 1 $400,000 600,000 400,000 January 31 $500,000 800,000 200,000 Raw materials Work in process Finished goods At the end of January, there was $1,000 of overapplied overhead. Instructions (a) Determine the cost of raw materials purchased in January. (b) Prepare a cost of goods manufactured schedule for January 2008. (c) Compute the cost of goods sold for January. Solution 177 (a) (1520 min.) = = = $2,500,000 $5,000,000 $2,500,000 $ 500,000 2,500,000 3,000,000 400,000 $2,600,000 Overhead applied ($10,000,000 25%) Direct labor used ($2 $2,500,000) Direct materials used ($10,000,000 $7,500,000) Ending raw materials inventory Direct materials used Less: Beginning raw materials inventory Raw materials purchases Job Order Cost Accounting Solution 177 (b) (cont.) 20 - 47 VANNOY MANUFACTURING COMPANY Cost of Goods Manufactured Schedule For the Month Ended January 31, 2008 Work in process, January 1............................................... $ 600,000 Direct materials used ........................................................ $2,500,000 Direct labor........................................................................ 5,000,000 Manufacturing overhead applied....................................... 2,500,000 Total manufacturing costs ........................................... 10,000,000 Total cost of work in process............................................. 10,600,000 Less: Work in process, January 31 .................................. 800,000 Cost of goods manufactured ............................................. $ 9,800,000 (c) Finished goods, January 1 ........................................................................ Cost of goods manufactured ..................................................................... Cost of goods available for sale ................................................................ Finished goods, January 31 ...................................................................... Cost of goods sold ................................................................................... $ 400,000 9,800,000 10,200,000 200,000 $10,000,000 Ex. 178 The following information is available for Kanza Company at December 31, 2008: 1. Inventory balance Finished Goods Work in Process Raw Materials Beginning of Year $14,000 6,000 10,300 End of Year $10,000 8,000 6,500 2. Debit postings to Work in Process Inventory during the year were: Direct materials $90,000 Direct labor 50,000 Manufacturing overhead applied 75,000 3. Sales totaled $310,000 for the year. Instructions (a) Prepare a condensed cost of goods manufactured schedule. (b) Prepare an income statement for the year through gross profit. 20 - 48 Test Bank for Accounting Principles, Eighth Edition Solution 178 (a) (1418 min.) KANZA COMPANY Cost of Goods Manufactured Schedule For the Year Ended December 31, 2008 Work in process, January 1 Direct materials used Direct labor Manufacturing overhead applied Total manufacturing costs Total cost of work in process Less: Work in process, December 31 Cost of goods manufactured (b) $ $90,000 50,000 75,000 215,000 221,000 8,000 $213,000 6,000 KANZA COMPANY (Partial) Income Statement For the Year Ended December 31, 2008 Sales Cost of Goods Sold Finished Goods, January 1 Cost of goods manufactured Cost of goods available for sale Finished Goods, December 31 Cost of goods sold Gross profit $310,000 $ 14,000 213,000 227,000 10,000 217,000 $ 93,000 Job Order Cost Accounting 20 - 49 COMPLETION STATEMENTS 179. Cost accounting involves the measuring, recording, and reporting of ______________ costs. 180. There are two basic types of cost accounting systems: (1)__________________ system, and (2)__________________ system. 181. A ______________ cost system is appropriate when similar products are continuously produced, whereas a ______________ cost system would be more appropriate if the product is custom-made. 182. In a job order system, raw materials purchased are charged to the ______________ account. 183. Of these three accounts; Raw Materials Inventory, Factory Labor, and Manufacturing Overhead, ______________ is not a control account. 184. If $25,000 direct materials are requisitioned for a job and $7,000 of indirect materials are requisitioned for general use, the debit to Work In Process Inventory should be for $______________. 185. The cost of producing a particular job under a job cost system is accumulated on a record called a ___________________. 186. Manufacturing overhead is applied to jobs by means of a ___________________ rate. 187. If actual manufacturing overhead was greater than the amount of manufacturing overhead applied to jobs, the Manufacturing Overhead account will have a ___________ balance and overhead is said to be ______________. 188. At the end of the year, any balance in the Manufacturing Overhead account should be eliminated as an adjustment to ___________________. Answers to Completion Statements 179. 180. 181. 182. 183. 184. 185. 186. 187. 188. product job order cost, process cost process, job order Raw Materials Inventory Factory Labor 25,000 job cost sheet predetermined overhead debit, underapplied cost of goods sold 20 - 50 Test Bank for Accounting Principles, Eighth Edition MATCHING 189. Match the items in the two columns below by entering the appropriate code letter in the space provided. A. B. C. D. E. Cost accounting Materials requisition slip Time ticket Cost accounting system Job order cost system F. G. H. I. J. Process cost system Job cost sheets Predetermined overhead rate Overapplied overhead Underapplied overhead _____ 1. Used to apply manufacturing overhead to jobs. _____ 2. Measures, records, and reports product costs. _____ 3. When actual manufacturing overhead costs are greater than the overhead applied to products. _____ 4. Manufacturing cost accounts are fully integrated into the general ledger. _____ 5. Source document which authorizes issuance of raw materials to production. _____ 6. Appropriate when products have distinguishing and heterogeneous characteristics. _____ 7. Constitute a subsidiary ledger for Work in Process Inventory. _____ 8. Indicates number of hours that employees work and the account to be charged. _____ 9. Appropriate when products are similar and are produced continuously. _____ 10. When actual manufacturing overhead costs are less than the overhead applied to products. Answers to Matching 1. 2. 3. 4. 5. H A J D B 6. 7. 8. 9. 10. E G C F I Job Order Cost Accounting 20 - 51 SHORT-ANSWER ESSAY QUESTIONS S-A E 190 A job order cost accounting system is fully integrated into the general ledger of a company. Identify the major general ledger accounts used in a job order cost system. Explain how manufacturing costs flow through these accounts so that inventories may be costed and income determined when goods are sold. Solution 190 When a job order cost accounting system is fully integrated into the general ledger of a company, the major general ledger accounts used are Raw Materials Inventory, Factory Labor, Manufacturing Overhead, Work in Process Inventory, and Finished Goods Inventory. As manufacturing costs are incurred, they are debited to the Raw Materials Inventory, Factory Labor, and Manufacturing Overhead accounts. As materials are used, labor is assigned, or overhead is applied, the costs are taken out of these accounts and debited to Work in Process Inventory. When jobs are finished, the costs flow from the Work in Process Inventory account to the Finished Goods Inventory account, and when jobs are sold, the costs are transferred to Cost of Goods Sold from Finished Goods Inventory. S-A E 191 Manufacturing overhead items are indirect product costs that cannot be traced to individual products. Explain how manufacturing overhead costs are accumulated and how they are assigned to products in a job order cost system. Solution 191 As manufacturing overhead costs are incurred, they are debited to the Manufacturing Overhead account. As jobs move through the factory, manufacturing overhead costs are applied to specific jobs using the predetermined overhead rate. This rate is computed prior to the beginning of the year by dividing estimated annual overhead costs by expected annual operating activity (generally expressed as direct labor hours, direct labor cost, or machine hours). The overhead is applied by determining how much activity was expended on a particular job (for example, direct labor hours), and applying the rate to that activity. S-A E 192 (Ethics) People Carrier Systems, Inc. (PCS) modifies vans that seat 1520 people by adding additional safety features or wheelchair ramps. Most of its customers are cities and counties, who use the vans to transport school children, the elderly, or the handicapped. The company has specialized in a no-frills approach, emphasizing safety, high quality, and low cost. The company's president was quoted as saying, "Let the other guys make a van pretty. We get people where they need to gofaster, better, and cheaper than anybody else." The company obtains jobs by being the lowest bidder in a sealed bidding process. Recently, the company was solicited by a top-10 college to submit a bid for a van to be used by its athletic team. Some specialized items were required, such as the school's logo on the outside of the van, and the vinyl seats had to be covered in school colors. The company submitted a bid, and was very surprised to obtain it. 20 - 52 Test Bank for Accounting Principles, Eighth Edition S-A E 192 (cont.) When the job was being prepared, the job manager pointed out that several extra costs could result in this job showing a loss. The boss, an ardent supporter of sports in general and this team in particular, told the manager to just record the standard labor and overhead cost for this job. He says that they could use the present rate for specialized jobs, and increase the overhead application rate (used in submitting bids) by 5% for future routine jobs. "After all," he says, "nobody else comes close to our price anyway. This could start a whole new line of business for us." Required: 1. Who are the stakeholders in the decision to increase overhead for routine jobs? 2. Is the decision to subsidize special jobs by increasing the overhead rate on routine jobs ethical? Briefly explain. Solution 192 1. The stakeholders include: The employees and managers of PCS Customers who purchase standard vans Customers who purchase sports vans Shareholders of PCS 2. The decision could be considered ethical, if the company clearly understands that it is allowing the customers of the standard vans to cover some of the costs of the specialty ones. This might not be a bad decision, especially if the specialty business is only a small fraction of the total business. The company might be compromising its own best interests, however, if it arbitrarily damages relationships with existing customers in order to gain others. It seems undeniable that established customers are preferable to untested ones. While probably ethical, the decision may not be a good one. S-A E 193 (Communication) Bridal Treasures, Inc. makes customized wedding gowns. The customer selects a pattern for the basic gown, and then selects fabric and trim. Once the design and the materials have been agreed upon, a Statement of Estimated Cost is signed by the company and by the customer. Overhead is applied based on the number of days a gown is in process. Usually, five gowns are being worked on at a time. Therefore, each gown is charged 1/5 of a daily estimated overhead amount. Customer Ruth Hardin's wedding dress took four days to complete. However, after the first three days had elapsed, Linda Lony, a movie personality, suddenly decided to get married, and ordered a very lavish gown. All other work was suspended, and the work on Ms. Hardin's dress was delayed six days. The final day of its construction was on the tenth day after it had been begun. Required: You are the accounting manager for Bridal Treasures. Write a memo to the billing department. Instruct them as to the appropriate number of overhead days to charge to Ms. Hardin's account. Job Order Cost Accounting Solution 193 TO: Billing Department 20 - 53 FROM: M. Long, Accounting Manager RE: Overhead billing, Gordon account As you know, our standard procedure in billing overhead is to simply multiply our daily overhead rate by the number of days the gown was in our possession. However, for the Hardin gown, and any other jobs we suspended for the Linda Lony gown, we should not charge for the days the gowns were in our possession but not being worked on. We should adjust the billing for the Linda Lony gown, so that it absorbs the full daily cost of overhead, since it actually was the only job worked on during those six days. The Hardin job should be charged only four days of overhead. Other suspended jobs should be treated similarly. Please call if you have questions. (signed)
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 19MANAGERIAL ACCOUNTINGSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 142. 143. 152. 153. 154. 155. SO 1 1 1 1 1 2 2
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 18FINANCIAL STATEMENT ANALYSISSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62.sg stSO 1 1 1 1 1 2
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 17THE STATEMENT OF CASH FLOWSSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 146. 147.sg st aSO 1 1 1 1 1 1 1 2
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 16INVESTMENTSSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 126. 127. 136. 137. 138.sg stSO 1 1 2 2 2 2 2 1 1 1 1 1 2 2 2 2 2
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 15LONG-TERM LIABILITIESSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 55. 55. 56. 57. 58. 59. 60. 61. 62. 155. 156.sg st aSO 1 1 1 1 1 1 1
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 14CORPORATIONS: DIVIDENDS, RETAINED EARNINGS, AND INCOME REPORTINGSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 124. 125. 133. 134
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 13CORPORATIONS: ORGANIZATION AND CAPITAL STOCK TRANSACTIONSSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 145. 14
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 12ACCOUNTING FOR PARTNERSHIPSSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 150. 151.sg st aSO 1 1 1 1 1 2
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 11CURRENT LIABILITIES AND PAYROLL ACCOUNTINGSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 151. 152.sg st a
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 10PLANT ASSETS, NATURAL RESOURCES, AND INTANGIBLE ASSETSSUMMARY OF QUESTIONS BY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 7
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 9ACCOUNTING FOR RECEIVABLESSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 159. 160. 161.sg stSO 1 1
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 8INTERNAL CONTROL AND CASHSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 148. 149. 150.sg stSO 1 1 1 1 2 2
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 7ACCOUNTING INFORMATION SYSTEMSSUMMARY OF QUESTIONS BY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 105. 106. 111. 112. 113. SO 1 1 1 1 2 2 2 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 6INVENTORIESSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 150. 151.sg st aSO 1 1 1 1 1 2 2 1 1 1 1 1 1 1
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 5ACCOUNTING FOR MERCHANDISING OPERATIONSSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 9. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67.sg st aSO
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 4COMPLETING THE ACCOUNTING CYCLESUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 155. 156. 157.sg st aSO
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 3ADJUSTING THE ACCOUNTSSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62.sg st aSO 1 1 1 1 1 2 2 2 1 1
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 2THE RECORDING PROCESSSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 152. 153.sg stSO 1 1 1 1 2 2 2 2 1 1 1
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 1ACCOUNTING IN ACTIONSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. a 55. a 56. a 57. a 58. 59. 60. 61. 62. 63. 64. 65. 164. 165. 166.sg st aSO
Abu Dhabi University - ACCOUNTING - 1234
A PPENDIX CTIME VALUE OF MONEYSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 11. 12. 13. 14. 15. 16. 17. 18. 48. 49. 50. 62. SO 1 1 2 2 2 2 2 3 3 3 3 3 3 1 BT K K K C C AP AP AP AP C AP AP AP K Item 3. 4. 19. 20. 21. 22. 23. 24.
UCLA - LS - ls 4
1/5/10 50% 40% 30% 20% 10% 0%In this imaginary graph, red are batting averages for baseball players using a wooden bat, green are for players using a metal bat. Would you recommend that a new player use a wood or metal bat. 1. Wood 2. Metal 3. Dont know
UCLA - LS 4 - ls 4
Chromosomes - rst reported 1882 (after Mendel) # chromosomes/nucleus in a species is constant. human, 46; corn, 10; fruit y, 8 2 pairs of arms - members of a pair are equal in size longitudinal - 2 identical units, called chromatidsIn the fruit y8 chrom
UCLA - LS 4 - ls 4
Drosophila melanogaster Short life cycle - 12 days Many progeny Easy to grow in laboratoriesCalvin Bridges, an undergraduate dishwasher, discovered a white-eyed fly (normal flies have red eyes) in one of the fly bottles he was about to washKaryotypesca
UCLA - LS 4 - ls 4
1/13/10Sex Determination 1. Sex chromosomes humans; silkworms - presence of Y chromosome Drosophila; nematodes - X to autosome ratio 2. Ploidy (in bees, males are haploid, females diploid) 3. Environment - Bonellia; a sea worm. Larvae are sexually undiff
UCLA - LS 4 - ls 4
1/18/10Hemophilia X-linked disease1. 2. 3. 4.X-linked traits appear more frequently in males. Mutation and trait never pass from father to son. Affected male always passes mutation to daughters, who serve as carriers who pass the trait to 1/2 of their
UCLA - LS 4 - ls 4
1/20/10Hypothesis. You have two plants that are both heterozygous for a single gene displaying a simple dominant/recessive relationship. To test this hypothesis you cross the two plants together and count progeny. Imagine 4 different outcomes, which expe
UCLA - LS 4 - ls 4
1/25/10Tet resistance Auxotroph revertant Bacteriophage resistancePetri dish 5 bacteria 12 hours107 bacteria12 hours107 bacteria12 hoursE. Coli (107 tets and 7 tetr)Media + tet11/25/10107 bacteriaarg- E. coliComplete mediaMinimal media107 b
UCLA - LS 4 - ls 4
1/27/1011/27/10Hfr met+ thi+ pur+ strs X F- met- thi- pur- strr Interrupted matings indicate that met enters the recipient last. Plate progeny on media to select for met+ recombinants. What media would you plate the mated bacteria on? 1. minimal + meth
UCLA - LS 4 - ls 4
2/1/10ra- X rb- 94% large 6% small1Host Range Mutants h+ (wild type) can grow on E. colis but not on E. colir. h can grow on both E. colis and E. colir.212/1/10Recombination in phage +- +r h Xr hPhenotype Clear and small Cloudy and large Cloudy a
UCLA - LS 4 - ls 4
2/3/10Lwoff concludes that; 1. lysogenic bacteria contain a noninfective structure, the prophage. 2. the prophage can turn into an infective phage and that no new phage particle is required for this. 3. In a small percentage of lysogenic bacteria, the pr
UCLA - LS 4 - ls 4
2/8/10AI J KBCDEFGHWhich rII deletion can recombine with which rII point mutation to give WT? Which rII deletion can recombine with which rII deletion to give WT?123456 789+ + +The 5 deletion mutations are used to map a point mutation.A
UCLA - LS 4 - ls 4
2/10/10Fig. 8.3DNARNAPROTEINTRANSCRIPTION RNA differs from DNA: 1. Single stranded 2. Ribose sugar 3. U instead of a TAGGCTAGCTAG TCCGATCGATCAGGCUAGCUAGTranscription goes 5 to 3.3 MAJOR TYPES OF RNA. 1. mRNA: code for protein 2. rRNA: ribosomes 3
UCLA - LS 4 - ls 4
2/14/10UUAUGUCUACUUUAGUUCCUCAUCGUGGGGCAUAGUAC MetSerThrLeuValProHisArgGlyAlaSTOP Missense Mutation UUAUGUCUACUUUAGUUACUCAUCGUGGGGCAUAGUAC MetSerThrLeuValThrHisArgGlyAlaSTOP UUAUGUCUACUUUAGUUCCUCAUCGUCGGGCAUAGUAC MetSerThrLeuValProHisArgArgAlaSTOP Nonsens
UCLA - LS 4 - ls 4
2/17/10IPTG: -galactoside isopropyl-d-thiogalactosideCan bind to Lac repressor => can induce lac operon Can not be cleaved by -galactosidase => constant concentration of inducer Commonly used inducer in the lab.-gal Protein Bacterial Protein12/17/10
UCLA - LS 4 - ls 4
Restric(on/Modica(on100%100%K12(P1) 0.002%K12100%K12(P1)encodesenzymesthatmethylateDNAandcutnon methylatedDNA. HOSTCONTROLLEDRESTRICTIONMODIFICATIONOF.CH3cytosine5methylcytosineRestriction EndonucleasesOver 200 restriction enzymes have been iso
UCLA - LS 4 - ls 4
MstII site is CCTNAGGprobeIn this case, the RFLP does not cause the D mutation, but is linked to the D locus.Hemophilia - X-linked diseaseWhat are the genotypes of the family members?Hemophilia - X-linked diseaseH YH hH -H Yh YH -7 kb 5 kbSou
UCLA - LS 4 - ls 4
REVERSE GENETICSTRANSGENIC MICEGrowth Hormone- made in small amounts in specialized cells located in the anterior pituitary gland. The following constructs were injected: metallothionein promoter-rat growth hormone. M.P. RGH protein rat growth hormone p
UCLA - LS 4 - ls 4
MN blood group frequencies MM MN NN Total 119 76 13 208 p(M) = [(119 + 119 + 76]/ 2 x 208 = .755 q(N) = [(13 + 13 + 76]/2 x 208 = .245 If in HWE expect: MM p2 (.755)2 x (208) = 118.6 MN 2pq 2(.755)(.245) x (208) = 76.9 NN q2 (.245)2 x (208) = 12.5X-linke
UCLA - LS 4 - ls 4
91Fig. 9.17CopyrightTheMcGrawHillCompanies, Inc.Permissionrequiredtoreproduceor displayFig. 9.1792CopyrightTheMcGrawHillCompanies, Inc.Permissionrequiredtoreproduceor displayAutomatedDNAsequencing Fig. 9.18 a93CopyrightTheMcGrawHillCompanies, Inc
UCLA - LS 4 - ls 4
CancerCancerDeaths Es-matednumberofnewcancercasesanddeathsintheUnitedStatesin1997.Cancer: A cell growth disorder resulting from an alteration in genes (mutations) that lead to deregulated (transformed) cell growth. CANCER IS A GENETIC DISEASE Transform
UCLA - LS 4 - ls 4
1 Question 1. Note that the female is the heterogametic sex.22. PedigreeThe following pedigree concerns a very rare human disorder that causes premature puberty in males.1 24567891011121314151617Which mode(s) of inheritance can explain
UCLA - LS 4 - ls 4
1LS 4 Example Midterm 1 questions INTRODUCTORY GENETICS21. Mitosis/MeiosisWe consider an organism with three pairs of chromosomes: the sex chromosomes X and Y, and the pairs of autosomal chromosomes 1 and 2. The female is the heterogametic sex. The st
UCLA - LS 4 - ls 4
Name_LS 4 INTRODUCTORY GENETICS MIDTERM II practice problemsName_ 1 The following cross is done in the Pea plant. P F1 AAbb x AAbb AaBbThese F1 progeny are then testcrossed as follows: AaBb x aabb The A and B alleles are dominant and the a and b allele
UCLA - LS 4 - ls 4
Name_LS 4 INTRODUCTORY GENETICS MIDTERM II practice problemsName_ 1 The following cross is done in the Pea plant. P F1 AAbb x AAbb AaBbThese F1 progeny are then testcrossed as follows: AaBb x aabb The A and B alleles are dominant and the a and b allele
UCLA - LS 4 - ls 4
Q. 1Correct answers in bold . coli ( wild type) . coli ( ts cI) . coli ( ts cII) . coli ( ts N) . coli ( ts cro) . coli ( ts cI, ts cII) . coli ( ts cI, ts N) . coli ( ts cII; ts N) grow at 40C lyse at 40C grow at 40C grow at 40C grow at 40C lyse at 40C
UCLA - LS 4 - ls 4
NAMELS 4 INTRODUCTORY GENETICS MIDTERM III Practice ProblemsNAMEQ. 1 (14 points)Below are listed E. coli strains that are lysogenic for bacteriophage . Each strain has a prophage that contains a ts mutation (or two ts mutations). All strains of E. col
U. Houston - CHEE - 2331
CHEE 2331 Chemical Processes Energy and Energy Balances Chapter 7, pages 313-333Department of Chemical and Biomolecular Engineering EngineeringWhat is energy?The ability to do workEnergy units (F-L)Mechanical Metric Engineering S.I. erg ft-lbf J Ther
U. Houston - BIOL - 1362
1QuestionsonCH1720ToBeCoveredDuringLectureorinExam2Review1. Carryoutthefollowingtranscriptionandtranslationproblem: 2. 3. 4. Puttheeventsthatentaileukaryotictranscriptionandtranslationinchronologicalorder: A)PremRNAisprocessedandspecificsequencesareremo
U. Houston - BIOL - 1362
1B ? 1ASamespeciesordifferentspecies?2A ? 2BSpeciationPopulationof aspeciesMicroevolutionary ForcesPopulationevolves; adaptation Howdo SpeciesForm? Speciation(processofaspeciessplittinginto2more species)bridgesmicroevolutionwithmacroevolution. Bio
U. Houston - BIOL - 1362
Microevolution Microevolution: heritablegeneticchangesthatoccurina population. Naturalselectionactsonindividuals,butpopulationsarethesmallest unitsthatcanevolve. Instudyingmicroevolution,oneanalyzesvariationinnatural populations&determineshow/whytheseva
U. Houston - BIOL - 1362
Onymacris unguicularis, the head standing beetle Namibia Atlantic ocean 1of350,000beetlespecies Hastypicalbeetletraits:pairofwings;6legs;hardexterior Possessesitsownuniquebehavior Priorexample illustratesthefeaturesofalllife:sharedtraits; variation;feat
U. Houston - BIOL - 1362
AnswerstoQuestionsonCH2226ToBeCoveredDuringLectureorinExam3Review1. DuringdroughtyearsontheGalapagos,small,easilyeatenseedsbecomerare,leavingmostlylarge,hard casedseedsthatonlybirdswithlargebeakscaneat.Ifadroughtpersistsforseveralyears,whatshould oneexpe
U. Houston - BIOL - 1362
AnswerstoLectureQuestionsfromWeekof12510 I.Whataretheproductsofmitosis? 1. Howmanycellsareproducedattheendofasinglemitoticdivision? Twocellsareproducedattheendofasinglemitoticdivision. 2. Howmanydifferentkindsofcellsareproducedattheendofasinglemitoticdiv
U. Houston - BIOL - 1362
PhylogenyAsnakeorlizardspecies? Understandingofevolutionaryrelationships(phylogeny)allows onetocomparetraitsofrelated speciestoanswersuchquestions. Constructingphylogeniesoccurs viasystematics classifying organisms&determining evolutionaryrelationships.
U. Houston - BIOL - 1362
BIOTECHNOLOGY PROBLEM1Using the following mammalian DNA sequence and the restriction enzyme, Taq I, find the restriction sites and indicate where the cuts occur. Taq I : 5 T*CGA 3 3 A GC*T 5ABCDECT*CGATTAT*CGAACCTTCAT*CGATT*CGAGCCTTCG GAGC*TAATAGC
U. Houston - BIOL - 1362
AnswerstoLectureQuestionsfrom22210&22410Lectures(QuestionnumbersbelowmatchthoseintheVNETdocument, 1362CH1720Questionstobecoveredduringlecture)1. Carryoutthefollowingtranscriptionandtranslationproblem: 4. E.coliisculturedonagrowthmediumcontainingbotht
U. Houston - BIOL - 1362
Protein Synthesis WorksheetDetermine the amino acid sequence for a polypeptide coded for by the following mRNA transcript:3-T A G G C T A C G G A C T G A A A T T C A T C T T A G A A A T - 5 5-A U C C G A U G C C U G A C U U U A A G U A G A A U C U U U A
U. Houston - BIOL - 1362
AnswerstoRemainingQuestionsfromdocumentQuestionsonCH1720ToBe CoveredDuringLecture 14. Ifaresearcherwaslookingtoclonethegeneforaspecificliverenzyme,itwouldbemostefficient andlogicaltofirstsearchin: A. alivercellandpickitoutwithapairoftweezers. B. ahumanli
U. Houston - BIOL - 1362
1)OnecaninferfromtheCentralDogma,thatdifferentRNAmoleculesarenecessaryinordertosynthesizeDNA fromasequenceofaminoacids(i.e.,protein). A)True B)False Answer:B 2)Inagene,thepresenceofapromoterisrequired A)fortranscriptiontooccur. B)fortranslationtooccur. C)
U. Houston - BIOL - 1362
MboI (2 sites) *GATCThe MboI enzyme will not cut at the ends even though the *GATC is present at both ends. The MboI enzyme cannot properly bind when the target sequence is at these locations. I would not expect you to know this and I would not give you
U. Houston - BIOL - 1362
AnswerstoLectureQuestionsfrom3310Lecture(QuestionnumbersbelowmatchthoseintheVNETdocument, 1362CH1720Questionstobecoveredduringlecture)10. AfterthetransformationstepinaDNAcloningexperiment,oneusuallyfirstscreensforcloneswith antibioticresistance.Whatdoes