ch04
60 Pages

ch04

Course Number: ACCOUNTING 1234, Spring 2010

College/University: Abu Dhabi University

Word Count: 13913

Rating:

Document Preview

C HAPTER 4 COMPLETING THE ACCOUNTING CYCLE SUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOM’S TAXONOMY Item 1. 2. 3. 4. 5. 6. 7. 8. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 155. 156. 157. sg st a SO 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 BT K K C C K K C K K K K C C K C K K K K K K C K C AP C K K K K K K AN AN AN Item 9. 10....

Unformatted Document Excerpt
Coursehero >> United Arab Emirates >> Abu Dhabi University >> ACCOUNTING 1234

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

HAPTER C 4 COMPLETING THE ACCOUNTING CYCLE SUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOM’S TAXONOMY Item 1. 2. 3. 4. 5. 6. 7. 8. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 155. 156. 157. sg st a SO 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 BT K K C C K K C K K K K C C K C K K K K K K C K C AP C K K K K K K AN AN AN Item 9. 10. 11. 12. 13. 14. 15. 16. 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. 158. 159. 160. SO 2 2 2 2 2 2 3 3 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 5 BT K K K K K K C K K K K K K K C K K C K K C C C C C AN C C C C AN C Item 17. 18. 19. 20. 21. 22. 23. 24. 86. 87. 88. 89. 90. 91. 92. 93. 94. 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 108. 109. SO 4 4 5 5 5 6 6 6 2 3 3 3 3 3 3 3 3 3 3 4 4 4 4 4 4 4 4 4 5 5 5 5 5 6 6 BT K C C K C K C C C K C K K K K K C C C K K K K K K K K K K AN K C AN AN AP Item 25. 26. 27. 28. 29. a 30. sg 31. sg 32. 110. 111. 112. 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. 123. 124. 125. 126. 127. 128. 129. 130. 131. 132. 133. 164. 165. a 166. SO 6 6 6 6 6 7 1 2 5 5 5 5 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 7 BT C K K K K K K K K AN AN AN K K C K K C C K K K K K K K C AN AN AN AN AN AP K AP Item sg sg SO 2 3 6 6 6 BT K K C K K True-False Statements 33. 34. sg 35. sg 36. sg 37. Multiple Choice Questions 134. 135. 136. 137. 138. 139. 140. 141. a 142. a 143. sg 144. sg 145. sg 146. sg 147. st 148. sg 149. st 150. sg 151. st 152. sg 153. st,a 154. 6 6 6 6 6 6 6 6 7 7 1 2 2 3 4 4 5 5 6 6 7 AN AN K K K K AP AP K K C K K K K K K AN K K K Brief Exercises K 161. K 162. AN 163. This question also appears in the Study Guide. This question also appears in a self-test at the student companion website. This question covers a topic in an appendix to the chapter. 4-2 Test Bank for Accounting Principles, Eighth Edition SUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOM’S TAXONOMY Exercises 167. 168. 169. 170. 171. 190. 191. 192. 1 1 1 1 2 1 1 2 C C AN AN AN K K K 172. 173. 174. 175. 176. 193. 194. 195. 2 2 2 2 2 2 2 3 AP AP AP AP AP K K K 177. 178. 179. 180. 181. 196. 197. 198. 3 3 4 5 5 4 6 6 C AN C AN AN K K K 182. 183. 184. 185. 186. 199. 200. 201. 5 5 6 6 6 6 6 6 AN AN AN AP AP K K K a a 187. 188. a 189. 7 7 7 AN AN AN Completion Statements SUMMARY OF STUDY OBJECTIVES BY QUESTION TYPE Item 1. 2. 3. 4. 5. 8. 9. 10. 11. 12. 13. 14. 32. 15. 16. 34. 17. 18. 97. 19. 20. 21. Type TF TF TF TF TF TF TF TF TF TF TF TF TF TF TF TF TF TF MC TF TF TF Item 6. 7. 31. 38. 39. 33. 56. 57. 58. 59. 60. 61. 62. 87. 88. 89. 98. 99. 100. 106. 107. 108. Type TF TF TF MC MC TF MC MC MC MC MC MC MC MC MC MC MC MC MC MC MC MC Item 40. 41. 42. 43. 44. 63. 64. 65. 66. 67. 68. 69. 70. 90. 91. 92. 101. 102. 103. 109. 110. 111. Type Item Type Item Type MC MC MC MC MC MC MC MC MC MC MC MC MC MC MC BE MC Ex C MC BE BE 180. 181. 182. Ex Ex Ex 183. Ex Item 55. 144. 167. 168. 169. 145. 146. 155. 156. 157. 158. 171. 172. 177. 178. 195. Type MC MC Ex Ex Ex MC MC BE BE BE BE Ex Ex Ex Ex C Item 170. 190. 191. Type Ex C C Study Objective 1 MC 45. MC 50. MC 46. MC 51. MC 47. MC 52. MC 48. MC 53. MC 49. MC 54. Study Objective 2 MC 71. MC 79. MC 72. MC 80. MC 73. MC 81. MC 74. MC 82. MC 75. MC 83. MC 76. MC 84. MC 77. MC 85. MC 78. MC 86. Study Objective 3 MC 93. MC 96. MC 94. MC 147. MC 95. MC 159. Study Objective 4 MC 104. MC 149. MC 105. MC 179. MC 148. MC 196. Study Objective 5 MC 112. MC 151. MC 113. MC 160. MC 150. MC 161. 173. 174. 175. 176. 192. 193. 194. Ex Ex Ex Ex C C C Completing the Accounting Cycle 4-3 SUMMARY OF STUDY OBJECTIVES BY QUESTION TYPE 22. 23. 24. 25. 26. 27. 28. 29. 30. 142. a TF TF TF TF TF TF TF TF TF MC 35. 36. 37. 114. 115. 116. 117. 118. a a TF TF TF MC MC MC MC MC MC MC 119. 120. 121. 122. 123. 124. 125. 126. a a a 143. 154. 166. 187. Study Objective 6 MC 127. MC 135. MC 128. MC 136. MC 129. MC 137. MC 130. MC 138. MC 131. MC 139. MC 132. MC 140. MC 133. MC 141. MC 134. MC 152. a Study Objective 7 BE a188. Ex Ex a189. Ex BE = Brief Exercise Ex = Exercise MC MC MC MC MC MC MC MC 153. 162. 163. 164. 165. 184. 185. 186. MC BE BE BE BE Ex Ex Ex 197. 198. 199. 200. 201. C C C C C Note: TF = True-False MC = Multiple Choice C = Completion The chapter also contains one set of ten Matching questions and five Short-Answer Essay questions. CHAPTER STUDY OBJECTIVES 1. Prepare a worksheet. The steps in preparing a worksheet are: (a) Prepare a trial balance on the worksheet, (b) Enter the adjustments in the adjustments columns, (c) Enter adjusted balances in the adjusted trial balance columns, (d) Extend adjusted trial balance amounts to appropriate financial statement columns, and (e) Total the statement columns, compute net income (or net loss), and complete the worksheet. 2. Explain the process of closing the books. Closing the books occurs at the end of an accounting period. The process is to journalize and post closing entries and then rule and balance all accounts. In closing the books, companies make separate entries to close revenues and expenses to Income Summary, Income Summary to Owner's Capital, and Owner's Drawings to Owner's Capital. Only temporary accounts are closed. 3. Describe the content and purpose of a post-closing trial balance. A post-closing trial balance contains the balances in permanent accounts that are carried forward to the next accounting period. The purpose of this trial balance is to prove the equality of these balances. 4. State the required steps in the accounting cycle. The required steps in the accounting cycle are: (1) analyze business transactions, (2) journalize the transactions, (3) post to ledger accounts, (4) prepare a trial balance, (5) journalize and post adjusting entries, (6) prepare an adjusted trial balance, (7) prepare financial statements, (8) journalize and post closing entries, and (9) prepare a post-closing trial balance. 5. Explain the approaches to preparing correcting entries. One approach for determining the correcting entry is to compare the incorrect entry with the correct entry. After comparison, the company makes a correcting entry to correct the accounts. An alternative to a correcting entry is to reverse the incorrect entry and then prepare the correct entry. 4-4 Test Bank for Accounting Principles, Eighth Edition 6. Identify the sections of a classified balance sheet. A classified balance sheet categorizes assets as current assets; long-term investments; property, plant, and equipment; and intangibles. Liabilities are classified as either current or long-term. There is also an owner's (owners’) equity section, which varies with the form of business organization. a 7. Prepare reversing entries. Reversing entries are the opposite of the adjusting entries made in the preceding period. Some companies choose to make reversing entries at the beginning of a new accounting period to simplify the recording of later transactions related to the adjusting entries. In most cases, only accrued adjusting entries are reversed. TRUE-FALSE STATEMENTS 1. A worksheet is a mandatory form that must be prepared along with an income statement and balance sheet. If a worksheet is used, financial statements can be prepared before adjusting entries are journalized. If total credits in the income statement columns of a worksheet exceed total debits, the enterprise has net income. It is not necessary to prepare formal financial statements if a worksheet has been prepared because financial position and net income are shown on the worksheet. The adjustments on a worksheet can be posted directly to the accounts in the ledger from the worksheet. The adjusted trial balance columns of a worksheet are obtained by subtracting the adjustment columns from the trial balance columns. The balance of the depreciation expense account will appear in the income statement debit column of a worksheet. Closing entries are unnecessary if the business plans to continue operating in the future and issue financial statements each year. The owner's drawing account is closed to the Income Summary account in order to properly determine net income (or loss) for the period. After closing entries have been journalized and posted, all temporary accounts in the ledger should have zero balances. Closing revenue and expense accounts to the Income Summary account is an optional bookkeeping procedure. Closing the drawing account to Capital is not necessary if net income is greater than owner's drawings during the period. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. Completing the Accounting Cycle 13. 4-5 The owner's drawing account is a permanent account whose balance is carried forward to the next accounting period. Closing entries are journalized after adjusting entries have been journalized. The amounts appearing on an income statement should agree with the amounts appearing on the post-closing trial balance. The post-closing trial balance is entered in the first two columns of a worksheet. A business entity has only one accounting cycle over its economic existence. The accounting cycle begins at the start of a new accounting period. Both correcting entries and adjusting entries always affect at least one balance sheet account and one income statement account. Correcting entries are made any time an error is discovered even though it may not be at the end of an accounting period. An incorrect debit to Accounts Receivable instead of the correct account Notes Receivable does not require a correcting entry because total assets will not be misstated. In a corporation, Retained Earnings is a part of owners' equity. A company's operating cycle and fiscal year are usually the same length of time. Cash and office supplies are both classified as current assets. Long-term investments would appear in the property, plant, and equipment section of the balance sheet. A liability is classified as a current liability if the company is to pay it within the forthcoming year. A company's liquidity is concerned with the relationship between long-term investments and long-term debt. Current assets are customarily the first items listed on a classified balance sheet. The operating cycle of a company is determined by the number of years the company has been operating. Reversing entries are an optional bookkeeping procedure. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. a 30. Additional True-False Questions 31. After a worksheet has been completed, the statement columns contain all data that are required for the preparation of financial statements. To close net income to owner's capital, Income Summary is debited and Owner's Capital is credited. 32. 4-6 33. 34. Test Bank for Accounting Principles, Eighth Edition In one closing entry, Owner's Drawing is credited and Income Summary is debited. The post-closing trial balance will contain only owner's equity statement accounts and balance sheet accounts. The operating cycle of a company is the average time required to collect the receivables resulting from producing revenues. Current assets are listed in the order of liquidity. Current liabilities are obligations that the company is to pay within the coming year. 35. 36. 37. Answers to True-False Statements Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. 1. 2. 3. 4. 5. 6. F T T F F F 7. 8. 9. 10. 11. 12. T F F T F F 13. 14. 15. 16. 17. 18. F T F F F T 19. 20. 21. 22. 23. 24. F T F T F T 25. 26. 27. 28. 29. a 30. F T F T F T 31. 32. 33. 34. 35. 36. T T F F F T 37. T MULTIPLE CHOICE QUESTIONS 38. Preparing a worksheet involves a. two steps. b. three steps. c. four steps. d. five steps. The adjustments entered in the adjustments columns of a worksheet are a. not journalized. b. posted to the ledger but not journalized. c. not journalized until after the financial statements are prepared. d. journalized before the worksheet is completed. The information for preparing a trial balance on a worksheet is obtained from a. financial statements. b. general ledger accounts. c. general journal entries. d. business documents. After the adjusting entries are journalized and posted to the accounts in the general ledger, the balance of each account should agree with the balance shown on the a. adjusted trial balance. b. post-closing trial balance. c. the general journal. d. adjustments columns of the worksheet. 39. 40. 41. Completing the Accounting Cycle 42. 4-7 If the total debit column exceeds the total credit column of the income statement columns on a worksheet, then the company has a. earned net income for the period. b. an error because debits do not equal credits. c. suffered a net loss for the period. d. to make an adjusting entry. A worksheet is a multiple column form that facilitates the a. identification of events. b. measurement process. c. preparation of financial statements. d. analysis process. Which of the following companies would be least likely to use a worksheet to facilitate the adjustment process? a. Large company with numerous accounts b. Small company with numerous accounts c. All companies, since worksheets are required under generally accepted accounting principles d. Small company with few accounts A worksheet can be thought of as a(n) a. permanent accounting record. b. optional device used by accountants. c. part of the general ledger. d. part of the journal. The account, Supplies, will appear in the following debit columns of the worksheet. a. Trial balance b. Adjusted trial balance c. Balance sheet d. All of these When constructing a worksheet, accounts are often needed that are not listed in the trial balance already entered on the worksheet from the ledger. Where should these additional accounts be shown on the worksheet? a. They should be inserted in alphabetical order into the trial balance accounts already given. b. They should be inserted in chart of account order into the trial balance already given. c. They should be inserted on the lines immediately below the trial balance totals. d. They should not be inserted on the trial balance until the next accounting period. When using a worksheet, adjusting entries are journalized a. after the worksheet is completed and before financial statements are prepared. b. before the adjustments are entered on to the worksheet. c. after the worksheet is completed and after financial statements have been prepared. d. before the adjusted trial balance is extended to the proper financial statement columns. 43. 44. 45. 46. 47. 48. 4-8 49. Test Bank for Accounting Principles, Eighth Edition Assuming that there is a net loss for the period, debits equal credits in all but which section of the worksheet? a. Income statement columns b. Adjustments columns c. Trial balance columns d. Adjusted trial balance columns Adjusting entries are prepared from a. source documents. b. the adjustments columns of the worksheet. c. the general ledger. d. last year's worksheet. The net income (or loss) for the period a. is found by computing the difference between the income statement credit column and the balance sheet credit column on the worksheet. b. cannot be found on the worksheet. c. is found by computing the difference between the income statement columns of the worksheet. d. is found by computing the difference between the trial balance totals and the adjusted trial balance totals. The worksheet does not show a. net income or loss for the period. b. revenue and expense account balances. c. the ending balance in the owner's capital account. d. the trial balance before adjustments. If the total debits exceed total credits in the balance sheet columns of the worksheet, owner's equity a. will increase because net income has occurred. b. will decrease because a net loss has occurred. c. is in error because a mistake has occurred. d. will not be affected. 50. 51. 52. 53. Use the following information for questions 54–55. The income statement and balance sheet columns of Pine Company's worksheet reflects the following totals: Income Statement Dr. Cr. $58,000 $48,000 Balance Sheet Dr. Cr. $34,000 $44,000 Totals 54. The net income (or loss) for the period is a. $48,000 income. b. $10,000 income. c. $10,000 loss. d. not determinable. Completing the Accounting Cycle 55. 4-9 To enter the net income (or loss) for the period into the above worksheet requires an entry to the a. income statement debit column and the balance sheet credit column. b. income statement credit column and the balance sheet debit column. c. income statement debit column and the income statement credit column. d. balance sheet debit column and the balance sheet credit column. Closing entries are necessary for a. permanent accounts only. b. temporary accounts only. c. both permanent and temporary accounts. d. permanent or real accounts only. Each of the following accounts is closed to Income Summary except a. Expenses. b. Owner's Drawing. c. Revenues. d. All of these are closed to Income Summary. Closing entries are made a. in order to terminate the business as an operating entity. b. so that all assets, liabilities, and owner's capital accounts will have zero balances when the next accounting period starts. c. in order to transfer net income (or loss) and owner's drawing to the owner's capital account. d. so that financial statements can be prepared. Closing entries are a. an optional step in the accounting cycle. b. posted to the ledger accounts from the worksheet. c. made to close permanent or real accounts. d. journalized in the general journal. The income summary account a. is a permanent account. b. appears on the balance sheet. c. appears on the income statement. d. is a temporary account. If Income Summary has a credit balance after revenues and expenses have been closed into it, the closing entry for Income Summary will include a a. debit to the owner's capital account. b. debit to the owner's drawing account. c. credit to the owner's capital account. d. credit to the owner's drawing account. Closing entries are journalized and posted a. before the financial statements are prepared. b. after the financial statements are prepared. c. at management's discretion. d. at the end of each interim accounting period. 56. 57. 58. 59. 60. 61. 62. 4 - 10 63. Test Bank for Accounting Principles, Eighth Edition Closing entries a. are prepared before the financial statements. b. reduce the number of permanent accounts. c. cause the revenue and expense accounts to have zero balances. d. summarize the activity in every account. Which of the following is a true statement about closing the books of a proprietorship? a. Expenses are closed to the Expense Summary account. b. Only revenues are closed to the Income Summary account. c. Revenues and expenses are closed to the Income Summary account. d. Revenues, expenses, and the owner's drawing account are closed to the Income Summary account. Closing entries may be prepared from all but which one of the following sources? a. Adjusted balances in the ledger b. Income statement and balance sheet columns of the worksheet c. Balance sheet d. Income and owner's equity statements In order to close the owner's drawing account, the a. income summary account should be debited. b. income summary account should be credited. c. owner's capital account should be credited. d. owner's capital account should be debited. In preparing closing entries a. each revenue account will be credited. b. each expense account will be credited. c. the owner's capital account will be debited if there is net income for the period. d. the owner's drawing account will be debited. The most efficient way to accomplish closing entries is to a. credit the income summary account for each revenue account balance. b. debit the income summary account for each expense account balance. c. credit the owner's drawing balance directly to the income summary account. d. credit the income summary account for total revenues and debit the income summary account for total expenses. The closing entry process consists of closing a. all asset and liability accounts. b. out the owner's capital account. c. all permanent accounts. d. all temporary accounts. The final closing entry to be journalized is typically the entry that closes the a. revenue accounts. b. owner's drawing account. c. owner's capital account. d. expense accounts. 64. 65. 66. 67. 68. 69. 70. Completing the Accounting Cycle 71. An error has occurred in the closing entry process if a. revenue and expense accounts have zero balances. b. the owner's capital account is credited for the amount of net income. c. the owner's drawing account is closed to the owner's capital account. d. the balance sheet accounts have zero balances. The Income Summary account is an important account that is used a. during interim periods. b. in preparing adjusting entries. c. annually in preparing closing entries. d. annually in preparing correcting entries. The balance in the income summary account before it is closed will be equal to a. the net income or loss on the income statement. b. the beginning balance in the owner's capital account. c. the ending balance in the owner's capital account. d. zero. 4 - 11 72. 73. 74. After closing entries are posted, the balance in the owner's capital account in the ledger will be equal to a. the beginning owner's capital reported on the owner's equity statement. b. the amount of the owner's capital reported on the balance sheet. c. zero. d. the net income for the period. Use the following information for questions 75–79. The income statement for the month of June, 2008 of Delgado Enterprises contains the following information: Revenues Expenses: Wages Expense Rent Expense Supplies Expense Advertising Expense Insurance Expense Total expenses Net income 75. The entry to close the revenue account includes a a. debit to Income Summary for $3,400. b. credit to Income Summary for $3,400. c. debit to Income Summary for $7,000. d. credit to Income Summary for $7,000. The entry to close the expense accounts includes a a. debit to Income Summary for $3,400. b. credit to Rent Expense for $1,000, c. credit to Income Summary for $3,600. d. debit to Wages Expense for $2,000. $7,000 $2,000 1,000 300 200 100 3,600 $3,400 76. 4 - 12 77. Test Bank for Accounting Principles, Eighth Edition After the revenue and expense accounts have been closed, the balance in Income Summary will be a. $0. b. a debit balance of $3,400. c. a credit balance of $3,400. d. a credit balance of $7,000. The entry to close Income Summary to Delgado, Capital includes a. a debit to Revenue for $7,000. b. credits to Expenses totalling $3,600. c. a credit to Income Summary for $3,400 d. a credit to Delgado, Capital for $3,400. At June 1, 2008, Delgado reported owner’s equity of $35,000. The company had no owner drawings during June. At June 30, 2008, the company will report owner’s equity of a. $35,000. b. $42,000. c. $38,400. d. $31,600. 78. 79. Use the following information for questions 80–86. The income statement for the year 2008 of Nova Co. contains the following information: Revenues Expenses: Wages Expense Rent Expense Advertising Expense Supplies Expense Utilities Expense Insurance Expense Total expenses Net income (loss) 80. The entry to close the revenue account includes a a. debit to Income Summary for $3,500. b. credit to Income Summary for $3,500. c. debit to Revenues for $70,000. d. credit to Revenues for $70,000. The entry to close the expense accounts includes a a. debit to Income Summary for $3,500. b. credit to Income Summary for $3,500. c. debit to Income Summary for $73,500. d. debit to Wages Expense for $2,500. After the revenue and expense accounts have been closed, the balance in Income Summary will be a. $0. b. a debit balance of $3,500. c. a credit balance of $3,500. d. a credit balance of $70,000. $70,000 $45,000 12,000 6,000 6,000 2,500 2,000 73,500 $(3,500) 81. 82. Completing the Accounting Cycle 83. The entry to close Income Summary to Nova, Capital includes a. a debit to Revenue for $70,000. b. credits to Expenses totalling $73,500. c. a credit to Income Summary for $3,500. d. a credit to Nova, Capital for $3,500. 4 - 13 84. At January 1, 2008, Nova reported owner’s equity of $50,000. Owner drawings for the year totalled $10,000. At December 31, 2008, the company will report owner’s equity of a. $13,500. b. $36,500. c. $40,000. d. $43,500. After all closing entries have been posted, the Income Summary account will have a balance of a. $0. b. $3,500 debit. c. $3,500 credit. d. $36,500 credit. After all closing entries have been posted, the revenue account will have a balance of a. $0. b. $70,000 credit. c. $70,000 debit. d. $3,500 credit. A post-closing trial balance is prepared a. after closing entries have been journalized and posted. b. before closing entries have been journalized and posted. c. after closing entries have been journalized but before the entries are posted. d. before closing entries have been journalized but after the entries are posted. All of the following statements about the post-closing trial balance are correct except it a. shows that the accounting equation is in balance. b. provides evidence that the journalizing and posting of closing entries have been properly completed. c. contains only permanent accounts. d. proves that all transactions have been recorded. A post-closing trial balance will show a. only permanent account balances. b. only temporary account balances. c. zero balances for all accounts. d. the amount of net income (or loss) for the period. A post-closing trial balance should be prepared a. before closing entries are posted to the ledger accounts. b. after closing entries are posted to the ledger accounts. c. before adjusting entries are posted to the ledger accounts. d. only if an error in the accounts is detected. 85. 86. 87. 88. 89. 90. 4 - 14 91. Test Bank for Accounting Principles, Eighth Edition A post-closing trial balance will show a. zero balances for all accounts. b. zero balances for balance sheet accounts. c. only balance sheet accounts. d. only income statement accounts. The purpose of the post-closing trial balance is to a. prove that no mistakes were made. b. prove the equality of the balance sheet account balances that are carried forward into the next accounting period. c. prove the equality of the income statement account balances that are carried forward into the next accounting period. d. list all the balance sheet accounts in alphabetical order for easy reference. The balances that appear on the post-closing trial balance will match the a. income statement account balances after adjustments. b. balance sheet account balances after closing entries. c. income statement account balances after closing entries. d. balance sheet account balances after adjustments. Which account listed below would be double ruled in the ledger as part of the closing process? a. Cash b. Owner's Capital c. Owner's Drawing d. Accumulated Depreciation A double rule applied to accounts in the ledger during the closing process implies that a. the account is an income statement account. b. the account is a balance sheet account. c. the account balance is not zero. d. a mistake has been made, since double ruling is prescribed. The heading for a post-closing trial balance has a date line that is similar to the one found on a. a balance sheet. b. an income statement. c. an owner's equity statement. d. the worksheet. Which one of the following is usually prepared only at the end of a company's annual accounting period? a. Preparing financial statements b. Journalizing and posting adjusting entries c. Journalizing and posting closing entries d. Preparing an adjusted trial balance The step in the accounting cycle that is performed on a periodic basis (i.e., monthly, quarterly) is a. analyzing transactions. b. journalizing and posting adjusting entries. c. preparing a post-closing trial balance. d. posting to ledger accounts. 92. 93. 94. 95. 96. 97. 98. Completing the Accounting Cycle 99. 4 - 15 Which one of the following is an optional step in the accounting cycle of a business enterprise? a. Analyze business transactions b. Prepare a worksheet c. Prepare a trial balance d. Post to the ledger accounts The final step in the accounting cycle is to prepare a. closing entries. b. financial statements. c. a post-closing trial balance. d. adjusting entries. Which of the following steps in the accounting cycle would not generally be performed daily? a. Journalize transactions b. Post to ledger accounts c. Prepare adjusting entries d. Analyze business transactions Which of the following steps in the accounting cycle may be performed more frequently than annually? a. Prepare a post-closing trial balance b. Journalize closing entries c. Post closing entries d. Prepare a trial balance Which of the following depicts the proper sequence of steps in the accounting cycle? a. Journalize the transactions, analyze business transactions, prepare a trial balance b. Prepare a trial balance, prepare financial statements, prepare adjusting entries c. Prepare a trial balance, prepare adjusting entries, prepare financial statements d. Prepare a trial balance, post to ledger accounts, post adjusting entries The two optional steps in the accounting cycle are preparing a. a post-closing trial balance and reversing entries. b. a worksheet and post-closing trial balances. c. reversing entries and a worksheet. d. an adjusted trial balance and a post-closing trial balance. The first required step in the accounting cycle is a. reversing entries. b. journalizing transactions in the book of original entry. c. analyzing transactions. d. posting transactions. Correcting entries a. always affect at least one balance sheet account and one income statement account. b. affect income statement accounts only. c. affect balance sheet accounts only. d. may involve any combination of accounts in need of correction. 100. 101. 102. 103. 104. 105. 106. 4 - 16 107. Test Bank for Accounting Principles, Eighth Edition Speedy Bike Company received a $940 check from a customer for the balance due. The transaction was erroneously recorded as a debit to Cash $490 and a credit to Service Revenue $490. The correcting entry is a. debit Cash, $940; credit Accounts Receivable, $940. b. debit Cash, $450 and Accounts Receivable, $490; credit Service Revenue, $940. c. debit Cash, $450 and Service Revenue, $490; credit Accounts Receivable, $940. d. debit Accounts Receivable, $940; credit Cash, $450 and Service Revenue, $490. If errors occur in the recording process, they a. should be corrected as adjustments at the end of the period. b. should be corrected as soon as they are discovered. c. should be corrected when preparing closing entries. d. cannot be corrected until the next accounting period. A correcting entry a. must involve one balance sheet account and one income statement account. b. is another name for a closing entry. c. may involve any combination of accounts. d. is a required step in the accounting cycle. An unacceptable way to make a correcting entry is to a. reverse the incorrect entry. b. erase the incorrect entry. c. compare the incorrect entry with the correct entry and make a correcting entry to correct the accounts. d. correct it immediately upon discovery. Cole Company paid the weekly payroll on January 2 by debiting Wages Expense for $45,000. The accountant preparing the payroll entry overlooked the fact that Wages Expense of $27,000 had been accrued at year end on December 31. The correcting entry is a. Wages Payable.................................................................... 27,000 Cash......................................................................... 27,000 b. Cash .................................................................................... 18,000 Wages Expense....................................................... 18,000 c. Wages Payable.................................................................... 27,000 Wages Expense....................................................... 27,000 d. Cash .................................................................................... 27,000 Wages Expense....................................................... 27,000 Tyler Company paid $530 on account to a creditor. The transaction was erroneously recorded as a debit to Cash of $350 and a credit to Accounts Receivable, $350. The correcting entry is a. Accounts Payable ................................................................ 530 Cash......................................................................... 530 b. Accounts Receivable ........................................................... 350 Cash......................................................................... 350 c. Accounts Receivable ........................................................... 350 Accounts Payable .................................................... 350 d. Accounts Receivable ........................................................... 350 Accounts Payable ................................................................ 530 Cash......................................................................... 880 108. 109. 110. 111. 112. Completing the Accounting Cycle 113. 4 - 17 A lawyer collected $830 of legal fees in advance. He erroneously debited Cash for $380 and credited Accounts Receivable for $380. The correcting entry is a. Cash ..................................................................................... 380 Accounts Receivable............................................................ 450 Unearned Revenue .................................................. 830 b. Cash ..................................................................................... 830 Service Revenue ...................................................... 830 c. Cash ..................................................................................... 450 Accounts Receivable............................................................ 380 Unearned Revenue .................................................. 830 d. Cash ..................................................................................... 450 Accounts Receivable ................................................ 450 All of the following are property, plant, and equipment except a. supplies. b. machinery. c. land. d. buildings. The first item listed under current liabilities is usually a. accounts payable. b. notes payable. c. salaries payable. d. taxes payable. Office Equipment is classified in the balance sheet as a. a current asset. b. property, plant, and equipment. c. an intangible asset. d. a long-term investment. A current asset is a. the last asset purchased by a business. b. an asset which is currently being used to produce a product or service. c. usually found as a separate classification in the income statement. d. an asset that a company expects to convert to cash or use up within one year. An intangible asset a. does not have physical substance, yet often is very valuable. b. is worthless because it has no physical substance. c. is converted into a tangible asset during the operating cycle. d. cannot be classified on the balance sheet because it lacks physical substance. Liabilities are generally classified on a balance sheet as a. small liabilities and large liabilities. b. present liabilities and future liabilities. c. tangible liabilities and intangible liabilities. d. current liabilities and long-term liabilities. 114. 115. 116. 117. 118. 119. 4 - 18 120. Test Bank for Accounting Principles, Eighth Edition Which of the following would not be classified a long-term liability? a. Current maturities of long-term debt b. Bonds payable c. Mortgage payable d. Lease liabilities Which of the following liabilities are not related to the operating cycle? a. Wages payable b. Accounts payable c. Utilities payable d. Bonds payable Intangible assets include each of the following except a. copyrights. b. goodwill. c. land improvements. d. patents. It is not true that current assets are assets that a company expects to a. realize in cash within one year. b. sell within one year. c. use up within one year. d. acquire within one year. The operating cycle of a company is the average time that is required to go from cash to a. sales in producing revenues. b. cash in producing revenues. c. inventory in producing revenues. d. accounts receivable in producing revenues. On a classified balance sheet, current assets are customarily listed a. in alphabetical order. b. with the largest dollar amounts first. c. in the order of liquidity. d. in the order of acquisition. Intangible assets are a. listed under current assets on the balance sheet. b. not listed on the balance sheet because they do not have physical substance. c. noncurrent resources. d. listed as a long-term investment on the balance sheet. The relationship between current assets and current liabilities is important in evaluating a company's a. profitability. b. liquidity. c. market value. d. accounting cycle. 121. 122. 123. 124. 125. 126. 127. Completing the Accounting Cycle 128. 4 - 19 The most important information needed to determine if companies can pay their current obligations is the a. net income for this year. b. projected net income for next year. c. relationship between current assets and current liabilities. d. relationship between short-term and long-term liabilities. Use the following information for questions 129–137. The following items are taken from the financial statements of Cerner Company for the year ending December 31, 2008: Accounts payable Accounts receivable Accumulated depreciation – equipment Advertising expense Cash Cerner, Capital (1/1/08) Cerner, Drawing Depreciation expense Insurance expense Note payable, due 6/30/09 Prepaid insurance (12-month policy) Rent expense Salaries expense Service revenue Supplies Supplies expense Equipment 129. $ 18,000 11,000 28,000 21,000 15,000 102,000 14,000 12,000 3,000 70,000 6,000 17,000 32,000 133,000 4,000 6,000 210,000 What is the company’s net income for the year ending December 31, 2008? a. $133,000 b. $42,000 c. $28,000 d. $12,000 What is the balance that would be reported for owner’s equity at December 31, 2008? a. $102,000 b. $130,000 c. $144,000 d. $158,000 What are total current assets at December 31, 2008? a. $26,000 b. $32,000 c. $36,000 d. $218,000 What is the book value of the equipment at December 31, 2008? a. $238,000 b. $210,000 c. $182,000 d. $170,000 130. 131. 132. 4 - 20 133. Test Bank for Accounting Principles, Eighth Edition What are total current liabililites at December 31, 2008? a. $18,000 b. $70,000 c. $88,000 d. $0 What are total long-term liabilities at December 31, 2008? a. $0 b. $70,000 c. $88,000 d. $90,000 What is total liabilities and owner’s equity at December 31, 2008? a. $176,000 b. $190,000 c. $218,000 d. $232,000 The sub-classifications for assets on the company’s classified balance sheet would include all of the following except: a. Current Assets. b. Property, Plant, and Equipment. c. Intangible Assets. d. Long-term Assets. The current assets should be listed on Cerner’s balance sheet in the following order: a. cash, accounts receivable, prepaid insurance, equipment. b. cash, prepaid insurance, supplies, accounts receivable. c. cash, accounts receivable, prepaid insurance, supplies. d. equipment, supplies, prepaid insurance, accounts receivable, cash. Which statement about long-term investments is not true? a. They will be held for more than one year. b. They are not currently used in the operation of the business. c. They include investments in stock of other companies and land held for future use. d. They can never include cash accounts. What is the order in which assets are generally listed on a classified balance sheet? a. Current and long-term b. Current; property, plant, and equipment; long-term investments; intangible assets c. Current; property, plant, and equipment; intangible assets; long-term investments d. Current; long-term investments; property, plant, and equipment; intangible assets 134. 135. 136. 137. 138. 139. 140. These are selected account balances on December 31, 2008. Land (location of the corporation’s office building) Land (held for future use) Corporate Office Building Inventory Equipment Office Furniture Accumulated Depreciation $100,000 150,000 600,000 200,000 450,000 100,000 300,000 Completing the Accounting Cycle 4 - 21 What is the total amount of property, plant, and equipment that will appear on the balance sheet? a. $1,300,000 b. $1,100,000 c. $1,600,000 d. $950,000 141. The following selected account balances appear on the December 31, 2008 balance sheet of Ming Co. Land (location of the corporation’s office building) Land (held for future use) Corporate Office Building Inventory Equipment Office Furniture Accumulated Depreciation $150,000 225,000 900,000 300,000 675,000 150,000 450,000 What is the total amount of property, plant, and equipment that will be reported on the balance sheet? a. $1,950,000 b. $1,650,000 c. $2,400,000 d. $1,425,000 a 142. A reversing entry a. reverses entries that were made in error. b. is the exact opposite of an adjusting entry made in a previous period. c. is made when a business disposes of an asset it previously purchased. d. is made when a company sustains a loss in one period and reverses the effect with a profit in the next period. 143. If a company utilizes reversing entries, they will a. be made at the beginning of the next accounting period. b. not actually be posted to the general ledger accounts. c. be made before the post-closing trial balance. d. be part of the adjusting entry process. a Additional Multiple Choice Questions 144. The steps in the preparation of a worksheet do not include a. analyzing documentary evidence. b. preparing a trial balance on the worksheet. c. entering the adjustments in the adjustment columns. d. entering adjusted balances in the adjusted trial balance columns. Balance sheet accounts are considered to be a. temporary owner's equity accounts. b. permanent accounts. c. capital accounts. d. nominal accounts. 145. 4 - 22 146. Test Bank for Accounting Principles, Eighth Edition Income Summary has a credit balance of $12,000 in J. Sawyer Co. after closing revenues and expenses. The entry to close Income Summary is a. credit Income Summary $12,000, debit J. Sawyer, Capital $12,000. b. credit Income Summary $12,000, debit J. Sawyer, Drawing $12,000. c. debit Income Summary $12,000, credit J. Sawyer, Drawing $12,000. d. debit Income Summary $12,000, credit J. Sawyer, Capital $12,000. The post-closing trial balance contains only a. income statement accounts. b. balance sheet accounts. c. balance sheet and income statement accounts. d. income statement, balance sheet, and owner's equity statement accounts. Which of the following is an optional step in the accounting cycle? a. Adjusting entries b. Closing entries c. Correcting entries d. Reversing entries Which one of the following statements concerning the accounting cycle is incorrect? a. The accounting cycle includes journalizing transactions and posting to ledger accounts. b. The accounting cycle includes only one optional step. c. The steps in the accounting cycle are performed in sequence. d. The steps in the accounting cycle are repeated in each accounting period. Correcting entries are made a. at the beginning of an accounting period. b. at the end of an accounting period. c. whenever an error is discovered. d. after closing entries. On September 23, Pitts Company received a $350 check from Mike Moluf for services to be performed in the future. The bookkeeper for Pitts Company incorrectly debited Cash for $350 and credited Accounts Receivable for $350. The amounts have been posted to the ledger. To correct this entry, the bookkeeper should a. debit Cash $350 and credit Unearned Service Revenue $350. b. debit Accounts Receivable $350 and credit Unearned Service Revenue $350. c. debit Accounts Receivable $350 and credit Cash $350. d. debit Accounts Receivable $350 and credit Service Revenue $350. All of the following are owner's equity accounts except a. the Capital account. b. Capital Stock. c. Investment in Stock. d. Retained Earnings. 147. 148. 149. 150. 151. 152. Completing the Accounting Cycle 153. 4 - 23 Current liabilities a. are obligations that the company is to pay within the forthcoming year. b. are listed in the balance sheet in order of their expected maturity. c. are listed in the balance sheet, starting with accounts payable. d. should not include long-term debt that is expected to be paid within the next year. a 154. The use of reversing entries a. is a required step in the accounting cycle. b. changes the amounts reported in the financial statements. c. simplifies the recording of subsequent transactions. d. is required for all adjusting entries. Answers to Multiple Choice Questions Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. d c b a c c d b d c c a b c c a c 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. b b b c d d c b c c c d b d d b d 72. 73. 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. c a b d b c d c c c b c b a a a d 89. 90. 91. 92. 93. 94. 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. a b c b b c a a c b b c c d c c c 106. 107. 108. 109. 110. 111. 112. 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. d c b c b c d c a b b d a d a d c 123. 124. 125. 126. 127. 128. 129. 130. 131. 132. 133. 134. 135. 136. 137. 138. 139. d b c c b c b b c c c a c d c d d 140. 141. a 142. a 143. 144. 145. 146. 147. 148. 149. 150. 151. 152. 153. a 154. d d b a a b d b d b c b c a c 4 - 24 Test Bank for Accounting Principles, Eighth Edition BRIEF EXERCISES BE 155 Use the following income statement for the year 2008 for J. S. Caper Company to prepare entries to close the revenue and expense accounts for the company. Service revenues Expenses: Wages Expense Rent Expense Advertising Expense Total expenses Net income (loss) $100,000 $40,000 12,500 5,700 58,200 $ 41,800 Solution 155 (5 min.) 100,000 100,000 58,200 40,000 12,500 5,700 Service Revenue ................................................................................... Income Summary ...................................................................... Income Summary .................................................................................. Wages Expense ........................................................................ Rent Expense ............................................................................ Advertising Expense.................................................................. BE 156 T. Price Company earned net income of $43,000 during 2008. The company had owner drawings totalling $30,000 during the period. Prepare the entries to close Income Summary and the Price, Drawing account. Solution 156 (3 min.) 43,000 43,000 30,000 30,000 Income Summary .................................................................................. Price, Capital ............................................................................. Price, Capital ......................................................................................... Price, Drawing ........................................................................... BE 157 At April 1, 2008, Clinton Company reported a balance of $22,000 in the Clinton, Capital account. Clinton Company earned revenues of $50,000 and incurred expenses of $32,000 during April 2008. The company had owner drawings of $10,000 during the month. (a) Prepare the entries to close Income Summary and the Clinton, Drawing acccount at April 30, 2008. (b) What is the balance in Clinton, Capital on the April 30, 2008 post-closing trial balance? Completing the Accounting Cycle Solution 157 (3 min.) 18,000 4 - 25 (a) Income Summary ........................................................................... Clinton, Capital .................................................................. Clinton, Capital ............................................................................... Clinton, Drawing ................................................................ (b) $22,000 + $18,000 – $10,000 = $30,000 18,000 10,000 10,000 BE 158 Identify which of the following are temporary accounts of Renfro Company. (1) Renfro, Capital (2) Renfro, Drawing (3) Equipment (4) Accumulated Depreciation (5) Depreciation Expense Solution 158 (3 min.) (2) Renfro, Drawing, (5) Depreciation Expense BE 159 Identify which of the following accounts would have balances on a post-closing trial balance. (1) Service Revenue (2) Income Summary (3) Notes Payable (4) Interest Expense (5) Cash Solution 159 (3 min.) (3) Notes Payable, (5) Cash BE 160 Prepare the necessary correcting entry for each of the following. a. A payment on account of $500 was debited to Accounts Payable $550 and credited to Cash $550. b. The collection of Accounts Receivable of $660 was recorded as a debit to Cash $660 and a credit to Service Revenue $660. 4 - 26 Test Bank for Accounting Principles, Eighth Edition (4 min.) 50 50 660 660 Solution 160 a. Cash ................................................................................................ Accounts Payable ................................................................ b. Service Revenue ............................................................................. Accounts Receivable ........................................................... BE 161 Prepare the necessary correcting entry for each of the following. a. A payment of $5,000 for salaries was recorded as a debit to Supplies Expense and a credit to Cash. b. A purchase of supplies on account for $1,000 was recorded as a debit to Equipment and a credit to Accounts Payable. Solution 161 (4 min.) 5,000 5,000 1,000 1,000 a. Salaries Expense ............................................................................ Supplies Expense................................................................... b. Supplies........................................................................................... Equipment .............................................................................. BE 162 The following accounts were included on Stacy’s Style Consultants post-closing trial balance at December 31, 2008: Accounts payable Accounts receivable Cash Stacy, Capital Stacy, Drawing Interest expense Note payable, due 8/31/11 Supplies Service revenue Equipment (a) What are total current assets? (b) What are total current liabilities? $ 2,000 5,500 11,000 40,000 10,000 3,000 60,000 1,000 39,000 5,000 Solution 162 (4 min.) (a) $5,500 + $11,000 + $1,000 = $17,500 (b) $2,000 Completing the Accounting Cycle BE 163 4 - 27 The following items are taken from the adjusted trial balance of Salon Company for the month ending July 31, 2008: Accounts payable Accounts receivable Accumulated depreciation – equipment Cash Depreciation expense Equipment Salon, Capital 7/1/08 Service revenue Supplies $ 2,000 3,000 8,000 2,200 2,000 54,000 52,000 33,000 1,200 Prepare the current assets section of Salon’s classified balance sheet. Solution 163 (4 min.) $2,200 3,000 1,200 $6,400 Current assets: Cash Accounts receivable Supplies Total current assets BE 164 The following information is available for Juxton Company for the year ended December 31, 2008: Accounts payable Accumulated depreciation, equipment Juxton, Capital Intangible assets Notes payable (due in 5 years) Accounts receivable Cash Short-term investments Equipment Long-term investments $ 2,700 4,000 7,800 2,500 7,500 1,500 2,600 1,000 7,500 6,900 Instructions Use the above information to prepare a classified balance sheet for the year ended December 31, 2008. 4 - 28 Test Bank Accounting for Principles, Eighth Edition (10 min.) JUXTON COMPANY Balance Sheet For the Year Ended December 31, 2008 Solution 164 Assets Current Assets Cash Short-term investments Accounts receivable Total Current Assets Investments Long-term investments Property, Plant, and Equipment Equipment Less Accumulated depreciation, equipment Intangible assets Total Assets Liabilities and Owner’s Equity Current Liabilities Accounts payable Long-term liabilities Notes payable Total Liabilities Owner’s equity Juxton, Capital Total owner’s equity Total liabilities and owner’s equity $2,600 1,000 1,500 $5,100 6,900 7,500 4,000 3,500 2,500 $18,000 $2,700 7,500 $10,200 7,800 7,800 $18,000 BE 165 The following lettered items represent a classification scheme for a balance sheet, and the numbered items represent accounts found on balance sheets. In the blank next to each account, write the letter indicating to which category it belongs. A. B. C. D. _____ 1. _____ 2. _____ 3. _____ 4. _____ 5. Current assets Long-term investments Property, plant, and equipment Intangible assets Accumulated Depreciation Jones, Capital Interest Expense Salary Payable Jones, Drawing E. F. G. H. Current liabilities Long-term liabilities Owner’s equity Not on the balance sheet Inventory Patents Prepaid Rent Mortgage Payable Land Held for Investment _____ 6. _____ 7. _____ 8. _____ 9. _____ 10. Completing the Accounting Cycle Solution 165 1. 2. 3. 4. 5. C G H E H (5 min.) 6. 7. 8. 9. 10. A D A F B 4 - 29 a BE 166 J. Bishop Company prepared the following adjusting entries at year end on December 31, 2008: (a) Interest Expense ........................................................................... 100 Interest Payable ................................................................... 100 (d) Interest Receivable ....................................................................... Interest Revenue .................................................................. Salary Expense ............................................................................. Salary Payable ..................................................................... 250 250 4,000 4,000 (c) In an effort to minimize errors in recording transactions, J. Bishop Company utilizes reversing entries. Prepare reversing entries on January 1, 2009. a Solution 166 (5 min.) 100 100 (a) Reverse the entry to accrue interest expense. Interest Payable ............................................................................ Interest Expense .................................................................. Reverse the entry to accrue interest revenue. Interest Revenue........................................................................... Interest Receivable............................................................... Reverse the entry to accrue salaries expense. Salary Payable .............................................................................. Salary Expense .................................................................... (b) 250 250 (c) 4,000 4,000 4 - 30 Test Bank for Accounting Principles, Eighth Edition EXERCISES Ex. 167 The worksheet for Kiner Company has been completed through the adjusted trial balance. You are ready to extend each amount to the appropriate financial statement column. Indicate for each account, the financial statement column to which the account should be extended by placing a check mark (√) in the appropriate column. ——————————————————————————————————————————— Income Statement Balance Sheet Account Title Dr. Cr. Dr. Cr. ——————————————————————————————————————————— (1) Cash ——————————————————————————————————————————— (2) Kiner, Capital ——————————————————————————————————————————— (3) Mortgage Payable ——————————————————————————————————————————— (4) Interest Receivable ——————————————————————————————————————————— (5) Supplies ——————————————————————————————————————————— (6) Accounts Payable ——————————————————————————————————————————— (7) Short-term Investments ——————————————————————————————————————————— (8) Repair Expense ——————————————————————————————————————————— ( September was $600 but will not be paid until October. Instructions Using the above information, complete the worksheet on the following page for Mann's Copy Shop for the month of September. MANN’S COPY SHOP Worksheet For the Month Ended September 30, 2008 Trial Balance Account Titles Cash Supplies Prepaid Insurance Equipment Accum. Depreciation— Equipment Accounts Payable Notes Payable Mann, Capital Mann, Drawing Copy Revenue Utilities Expense Totals Supplies Expense Insurance Expense Depreciation Expense Rent Expense Rent Payable Totals Net Income Totals Debit 1,000 1,100 2,200 24,000 Credit Adjustments Debit Credit Adjusted Trial Balance Debit Credit Income Statement Debit Credit Balance Sheet Debit Credit 4,500 2,400 4,000 15,300 2,400 4,900 400 31,100 31,100 4 - 36 Test Bank for Accounting Principles, Eighth Edition (15 min.) MANN’S COPY SHOP Worksheet For the Month Ended September 30, 2008 Trial Balance Adjustments Debit Credit Adjusted Trial Balance Debit Credit Income Statement Debit Credit Balance Sheet Debit 1,000 300 2,000 24,000 4,900 2,400 4,000 15,300 2,400 4,900 400 31,100 31,100 (a) 800 (b) 200 (c) 400 (d) 600 (d) 600 Solution 170 Account Titles Cash Supplies Prepaid Insurance Equipment Accum. Depreciation— Equipment Accounts Payable Notes Payable Mann, Capital Mann, Drawing Copy Revenue Utilities Expense Totals Supplies Expense Insurance Expense Depreciation Expense Rent Expense Rent Payable Totals Net Income Totals Debit 1,000 1,100 2,200 24,000 Credit Credit 1,000 (a) 800 300 (b) 200 2,000 24,000 4,500 2,400 4,000 15,300 (c) 400 4,900 2,400 4,000 15,300 2,400 4,900 400 800 200 400 600 2,400 2,500 4,900 600 4,900 29,700 27,200 2,500 4,900 29,700 29,700 2,400 4,900 400 800 200 400 600 600 2,000 32,100 32,100 2,000 Completing the Accounting Cycle Ex. 171 Prepare the necessary closing entries based on the following selected accounts. Accumulated Depreciation Depreciation Expense Kline, Capital Kline, Drawing Salaries Expense Service Revenue $10,000 5,000 20,000 12,000 18,000 30,000 4 - 37 Solution 171 (8–10 min.) 30,000 30,000 23,000 5,000 18,000 7,000 7,000 12,000 12,000 Service Revenue.................................................................................... Income Summary ....................................................................... Income Summary................................................................................... Depreciation Expense ................................................................ Salaries Expense ....................................................................... Income Summary................................................................................... Kline, Capital .............................................................................. Kline, Capital.......................................................................................... Kline, Drawing ............................................................................ Ex. 172 All revenue and expense accounts have been closed at the end of the calendar year for Staley Company. The Income Summary account has total debits of $520,000 and total credits of $600,000. As of the same date, Ron Staley, Capital has a balance of $115,000, and Ron Staley, Drawing has a balance of $48,000. Instructions (a) Journalize the entries required to complete the closing of the accounts. (b) Prepare an owner's equity statement for the year ended December 31, 2008. Solution 172 (a) (10 min.) 80,000 80,000 Income Summary .......................................................................... Ron Staley, Capital............................................................... (To close net income to capital) Ron Staley, Capital ....................................................................... Ron Staley, Drawing............................................................. (To close drawings to capital) 48,000 48,000 4 - 38 Test Bank for Accounting Principles, Eighth Edition (cont.) STALEY COMPANY Owner's Equity Statement For the Year Ended December 31, 2008 Solution 172 (b) Ron Staley, Capital, January 1 Add: Net income Less: Drawings Ron Staley, Capital, December 31 $115,000 80,000 195,000 48,000 $147,000 Ex. 173 At March 31, account balances after adjustments for Norton Cinema are as follows: Accounts Cash Concession Supplies Theatre Equipment Accumulated Depreciation—Theatre Equipment Accounts Payable Norton, Capital Norton, Drawing Admission Ticket Revenues Popcorn Revenues Candy Revenues Advertising Expense Concession Supplies Expense Depreciation Expense Film Rental Expense Rent Expense Salaries Expense Utilities Expense Account Balances (After Adjustment) $ 6,000 4,000 50,000 12,000 5,000 20,000 12,000 60,000 32,000 19,000 12,000 19,000 4,000 16,000 12,000 18,000 5,000 Instructions Prepare the closing journal entries for Norton Cinema. Solution 173 (10 min.) 60,000 32,000 19,000 111,000 Mar. 31 Admission Ticket Revenues.................................................. Popcorn Revenues................................................................ Candy Revenues................................................................... Income Summary........................................................ (To close revenue accounts) Completing the Accounting Cycle Solution 173 (cont.) 86,000 4 - 39 31 Income Summary................................................................... Advertising Expense.................................................... Concession Supplies Expense .................................... Depreciation Expense ................................................. Film Rental Expense ................................................... Rent Expense .............................................................. Salaries Expense......................................................... Utilities Expense .......................................................... (To close expense accounts) 31 Income Summary................................................................... Norton, Capital............................................................. (To transfer net income to capital) 31 Norton, Capital....................................................................... Norton, Drawing........................................................... (To close drawings to capital) 12,000 19,000 4,000 16,000 12,000 18,000 5,000 25,000 25,000 12,000 12,000 Ex. 174 Presented below is an adjusted trial balance for Trent Company, at December 31, 2008. Cash Accounts receivable Prepaid insurance Equipment Depreciation expense M. Trent, Drawing Advertising expense Rent expense Salary expense Insurance expense $12,700 20,000 15,000 35,000 7,000 1,500 1,400 800 3,000 1,600 $98,000 Accounts payable Notes payable Accumulated Depreciation— Equipment Service revenue M. Trent, Capital Unearned revenue $10,000 9,000 14,000 25,000 24,000 16,000 $98,000 Instructions (a) Prepare closing entries for December 31, 2008. (b) Determine the balance in M. Trent's capital account after the entries have been posted. Solution 174 (a) (10 min.) $25,000 $7,000 3,000 1,600 1,400 800 Computation of Net Income: Service revenue Depreciation expense Salary expense Insurance expense Advertising expense Rent expense Net Income 13,800 $11,200 4 - 40 Test Bank for Accounting Principles, Eighth Edition (cont.) 25,000 25,000 Solution 174 Dec. 31 Service Revenue ................................................................. Income Summary........................................................ (To close revenue account) 31 Income Summary................................................................. Depreciation Expense................................................. Advertising Expense ................................................... Rent Expense ............................................................. Salary Expense........................................................... Insurance Expense ..................................................... (To close expense accounts) 31 Income Summary................................................................. M. Trent, Capital ......................................................... (To close net income to capital) 31 M. Trent, Capital .................................................................. M. Trent, Drawing ....................................................... (To close drawings to capital) (b) M. Trent, Capital 1,500 Bal. 24,000 11,200 33,700 13,800 7,000 1,400 800 3,000 1,600 11,200 11,200 1,500 1,500 Ex. 175 The adjusted account balances of the Fitness Center at July 31 are as follows: Accounts Account Balances Cash $11,000 Accounts Receivable 15,000 Supplies 4,000 Prepaid Insurance 8,000 Buildings 300,000 Accumulated Depreciation— Buildings 120,000 Accounts Payable 19,000 Utley, Capital 195,000 Utley, Drawing 15,000 Accounts Service Revenue Interest Revenue Depreciation Expense Insurance Expense Salary Expense Supplies Expense Utilities Expense Account Balances $100,000 8,000 27,000 6,000 35,000 9,000 12,000 Instructions Prepare the end of the period closing entries for the Fitness Center. Completing the Accounting Cycle Solution 175 July 31 (10 min.) 100,000 8,000 4 - 41 Service Revenue .................................................................. Interest Revenue .................................................................. Income Summary ........................................................ (To close revenue accounts) Income Summary ................................................................. Depreciation Expense ................................................. Insurance Expense...................................................... Salary Expense ........................................................... Supplies Expense........................................................ Utilities Expense .......................................................... (To close expense accounts) Income Summary ................................................................. Utley, Capital ............................................................... (To close net income to capital) Utley, Capital ........................................................................ Utley, Drawing ............................................................. (To close drawings to capital) 108,000 31 89,000 27,000 6,000 35,000 9,000 12,000 31 19,000 19,000 31 15,000 15,000 Ex. 176 The income statement of Gentry's Shoe Repair is as follows: GENTRY’S SHOE REPAIR Income Statement For the Month Ended April 30, 2008 Revenue Shoe Repair Revenue................................................................... Expenses Salaries Expense .......................................................................... Depreciation Expense ................................................................... Utilities Expense............................................................................ Rent Expense................................................................................ Supplies Expense ......................................................................... Total Expenses ...................................................................... Net Income............................................................................................. $7,500 $3,400 350 400 600 1,050 5,800 $1,700 On April 1, the owner, Lee Gentry, had a capital balance of $12,900. During April, Gentry withdrew $3,000 cash for personal use. Instructions (a) Prepare closing entries at April 30. (b) Prepare an owner's equity statement for the month of April. 4 - 42 Test Bank for Accounting Principles, Eighth Edition (10 min.) 7,500 7,500 5,800 3,400 350 400 600 1,050 1,700 1,700 3,000 3,000 Solution 176 (a) Shoe Repair Revenue.................................................................... Income Summary .................................................................. Income Summary........................................................................... Salaries Expense .................................................................. Depreciation Expense ........................................................... Utilities Expense.................................................................... Rent Expense........................................................................ Supplies Expense ................................................................. Income Summary........................................................................... Gentry, Capital ...................................................................... Gentry, Capital ............................................................................... Gentry, Drawing .................................................................... (b) GENTRY'S SHOE REPAIR Owner's Equity Statement For the Month Ended April 30, 2008 L. Gentry, Capital, April 1 Add: Net Income Less: Drawings L. Gentry, Capital, April 30 $12,900 1,700 14,600 3,000 $11,600 Ex. 177 Identify which of the following accounts would appear in a post- closing trial balance. Accumulated Depreciation Depreciation Expense Interest Payable Jackson, Drawing Service Revenue Store Equipment Solution 177 (3 min.) The following accounts would appear in a post-closing trial balance: Accumulated Depreciation Interest Payable Store Equipment Completing the Accounting Cycle Ex. 178 4 - 43 The trial balances of Foley Company follow with the accounts arranged in alphabetic order. Analyze the data and prepare (a) the adjusting entries and (b) the closing entries made by Foley Company. Trial Balances Unadjusted Adjusted Post-Closing Accounts Payable $10,000 $10,000 $10,000 Accounts Receivable 2,200 3,200 3,200 Accumulated Depreciation 13,000 17,000 17,000 Advertising Expense 0 16,300 0 Cash 60,000 60,000 60,000 Depreciation Expense 0 4,000 0 Equipment 75,000 75,000 75,000 Foley, Capital 82,200 82,200 102,400 Foley, Drawing 11,000 11,000 0 Prepaid Advertising 17,800 1,500 1,500 Prepaid Rent 15,000 11,000 11,000 Rent Expense 0 4,000 0 Service Revenue 96,000 105,000 0 Supplies 3,200 700 700 Supplies Expense 2,000 4,500 0 Unearned Revenue 23,000 15,000 15,000 Wages Expense 38,000 45,000 0 Wages Payable 0 7,000 7,000 Solution 178 (a) (20 min.) 4,000 4,000 16,300 16,300 8,000 8,000 1,000 1,000 4,000 4,000 2,500 2,500 7,000 7,000 Adjusting Entries Depreciation Expense ................................................................... Accumulated Depreciation ................................................... Advertising Expense ..................................................................... Prepaid Advertising .............................................................. Unearned Revenue ....................................................................... Service Revenue .................................................................. Accounts Receivable..................................................................... Service Revenue .................................................................. Rent Expense................................................................................ Prepaid Rent ........................................................................ Supplies Expense ......................................................................... Supplies................................................................................ Wages Expense ............................................................................ Wages Payable .................................................................... 4 - 44 Test Bank for Accounting Principles, Eighth Edition (cont.) 105,000 105,000 73,800 16,300 4,000 4,000 4,500 45,000 31,200 31,200 11,000 11,000 Solution 178 (b) Closing Entries Service Revenue .......................................................................... Income Summary................................................................. Income Summary ......................................................................... Advertising Expense ............................................................ Depreciation Expense.......................................................... Rent Expense ...................................................................... Supplies Expense ................................................................ Wages Expense................................................................... Income Summary ......................................................................... Foley, Capital....................................................................... Foley, Capital................................................................................ Foley, Drawing..................................................................... Ex. 179 Indicate the proper sequence of the steps in the accounting cycle by placing numbers 1-8 in the blank spaces. ____ a. Analyze business transactions. ____ b. Journalize and post adjusting entries. ____ c. Journalize and post closing entries. ____ d. Journalize the transactions. ____ e. Prepare a post-closing trial balance. ____ f. Prepare a worksheet. ____ g. Prepare financial statements. ____ h. Post to ledger accounts. Solution 179 a. b. c. d. 1 6 7 2 (4 min.) e. f. g. h. 8 4 5 3 Completing the Accounting Cycle Ex. 180 Prepare the necessary correcting entry for each of the following. 4 - 45 a. A collection on account of $370 from a customer was credited to Accounts Receivable $730 and debited to Cash $730. b. The purchase of supplies on account for $250 was recorded as a debit to Equipment $250 and a credit to Accounts Payable $250. Solution 180 (5 min.) 360 360 250 250 a. Accounts Receivable........................................................................ Cash ........................................................................................ b. Supplies ........................................................................................... Equipment ............................................................................... Ex. 181 An examination of the accounts of Shaw Company for the month of June revealed the following errors after the transactions were journalized and posted. 1. A check for $750 from R. Linton, a customer on account, was debited to Cash $750 and credited to Service Revenue, $750. 2. A payment for Advertising Expense costing $420 was debited to Utilities Expense, $240 and credited to Cash $240. 3. A bill for $840 for Office Supplies purchased on account was debited to Office Equipment, $480 and credited to Accounts Payable $480. Instructions Prepare correcting entries for each of the above assuming the erroneous entries are not reversed. Explain how the transaction as originally recorded affected net income for the month of June. Solution 181 (10 min.) 750 750 1. Service Revenue.................................................................................... Accounts Receivable..................................................................... (To correct error in recording collection of accounts receivable) The transaction as originally recorded overstated net income by $750. 2. Advertising Expense .............................................................................. Utilities Expense............................................................................ Cash .............................................................................................. (To correct errors in recording advertising expense) The transaction as originally recorded overstated net income by $180. 420 240 180 4 - 46 Test Bank for Accounting Principles, Eighth Edition (cont.) 840 480 360 Solution 181 3. Office Supplies ...................................................................................... Office Equipment .......................................................................... Accounts Payable......................................................................... (To correct error in recording office supplies) The transaction as originally recorded had no effect on net income. Ex. 182 As Jeff Wills was doing his year-end accounting, he noticed that the bookkeeper had made errors in recording several transactions. The erroneous transactions are as follows: (a) (b) (c) (d) A check for $700 was issued for goods previously purchased on account. The bookkeeper debited Accounts Receivable and credited Cash for $700. A check for $380 was received as payment on account. The bookkeeper debited Accounts Payable for $830 and credited Accounts Receivable for $830. When making the entry to record the year's depreciation expense, the bookkeeper debited Accumulated Depreciation for $1,000 and credited Cash for $1,000. When accruing interest on a note payable, the bookkeeper debited Interest Receivable for $200 and credited Interest Payable for $200. Instructions Prepare the appropriate correcting entries. (Do not reverse the original entries.) Solution 182 (a) (b) (5 min.) 700 700 380 450 830 1,000 1,000 2,000 200 200 Accounts Payable......................................................................... Accounts Receivable ........................................................... Cash ............................................................................................. Accounts Receivable .................................................................... Accounts Payable ................................................................ Cash ............................................................................................. Depreciation Expense .................................................................. Accumulated Depreciation................................................... Interest Expense........................................................................... Interest Receivable .............................................................. (c) (d) Completing the Accounting Cycle Ex. 183 4 - 47 Jon Scott, CPA, was asked by Jeff Pine to review the accounting records and prepare the financial statements for his upholstering shop. Jon reviewed the records and found three errors. 1. Cash paid on accounts payable for $930 was recorded as a debit to Accounts Payable $390 and a credit to Cash $390. 2. The purchase of supplies on account for $500 was debited to Equipment $500 and credited to Accounts Payable $500. 3. Jeff withdrew $1,200 of cash and the bookkeeper debited Accounts Receivable for $120 and credited Cash $120. Instructions Prepare an analysis of each error showing the (a) incorrect entry. (b) correct entry. (c) correcting entry. Solution 183 1. (a) (15 min.) 390 390 930 930 540 540 Incorrect Entry Accounts Payable.............................................................. Cash ......................................................................... Correct Entry Accounts Payable.............................................................. Cash ......................................................................... Correcting Entry Accounts Payable.............................................................. Cash ......................................................................... Incorrect Entry Equipment ......................................................................... Accounts Payable..................................................... Correct Entry Supplies............................................................................. Accounts Payable..................................................... Correcting Entry Supplies............................................................................. Equipment ................................................................ Incorrect Entry Accounts Receivable......................................................... Cash ......................................................................... Correct Entry J. Pine, Drawing ................................................................ Cash ......................................................................... Correcting Entry J. Pine, Drawing ................................................................ Accounts Receivable ................................................ Cash ......................................................................... (b) (c) 2. (a) 500 500 500 500 500 500 (b) (c) 3. (a) 120 120 1,200 1,200 1,200 120 1,080 (b) (c) 4 - 48 Ex. 184 Test Bank for Accounting Principles, Eighth Edition Compute the dollar amount of current assets based on the following account balances. Accounts Receivable Accumulated Depreciation Cash Equipment Prepaid Rent Short-term Investments $16,000 27,000 24,000 93,000 7,000 15,000 Solution 184 (4 min.) Current assets amount = $62,000 ($16,000 + $24,000 + $7,000 + $15,000) Ex. 185 The financial statement columns of the worksheet for Audio Concepts at December 31, 2008, are as follows: AUDIO CONCEPTS Worksheet For the Year Ended December 31, 2008 Accounts Cash Accounts Receivable Supplies Prepaid Insurance Audio Equipment Accumulated Depreciation—Audio Equipment Accounts Payable Note Payable Salaries Payable J. Green, Capital J. Green, Drawing Audio Revenue Advertising Expense Depreciation Expense Insurance Expense Rent Expense Salaries Expense Supplies Expense Totals Net Income Income Statement Debit Credit Balance Sheet Debit Credit 15,000 7,000 4,000 6,000 209,000 29,000 19,000 70,000 3,000 112,000 14,000 123,000 21,000 12,000 3,000 17,000 42,000 6,000 101,000 22,000 123,000 123,000 255,000 123,000 255,000 Instructions (a) Calculate the balance of J. Green, Capital that would appear on a balance sheet at December 31, 2008. (b) Prepare a classified balance sheet for Audio Concepts at December 31, 2008 assuming the note payable is a long-term liability. 233,000 22,000 255,000 Completing the Accounting Cycle Solution 185 (a) (15 min.) $112,000 22,000 134,000 14,000 $120,000 4 - 49 J. Green, Capital, January 1 Add: Net Income Less: Drawings J. Green, Capital, December 31 AUDIO CONCEPTS Balance Sheet December 31, 2008 ——————————————————————————————————————————— Assets Current assets Cash ...................................................................................... $ 15,000 Accounts receivable............................................................... 7,000 Supplies ................................................................................. 4,000 Prepaid insurance.................................................................. 6,000 Total current assets ........................................................ 32,000 Property, plant, and equipment Audio equipment.................................................................... $209,000 Less: Accumulated depreciation—audio equipment.............. 29,000 180,000 Total assets .................................................................... $212,000 Liabilities and Owner's Equity Current liabilities Accounts payable .................................................................. Salaries payable .................................................................... Total current liabilities..................................................... Long-term liabilities Note payable.......................................................................... Total liabilities ................................................................. Owner's equity J. Green, Capital.................................................................... Total liabilities and owner's equity .................................. (b) $ 19,000 3,000 22,000 70,000 92,000 120,000 $212,000 4 - 50 Ex. 186 Test Bank for Accounting Principles, Eighth Edition The financial statement columns of the worksheet for Melton Company as of December 31, 2008 are as follows: MELTON COMPANY Worksheet For the Year Ended December 31, 2008 Income Statement Debit Credit Balance Sheet Debit Credit 20,000 6,000 4,500 7,000 50,000 4,800 7,500 23,500 18,000 46,000 4,200 Accounts Cash Accounts Receivable Supplies Prepaid Insurance Equipment Accumulated Depreciation Patents Accounts Payable Bonds Payable (due 2012) Melton, Capital Melton, Drawing Service Revenue Salaries Expense Depreciation Expense Insurance Expense Interest Expense Totals Net Income 25,400 5,200 4,800 5,000 3,500 18,500 6,900 25,400 25,400 25,400 99,200 99,200 92,300 6,900 99,200 Instructions Prepare a classified balance sheet for Melton Company. Solution 186 (15 min.) MELTON COMPANY Balance Sheet December 31, 2008 Assets Current assets Cash ............................................................................................. Accounts receivable ..................................................................... Supplies........................................................................................ Prepaid insurance......................................................................... Total current assets ............................................................. Property, Plant, and Equipment Equipment .................................................................................... Less: Accumulated depreciation—equipment .............................. Intangible assets Patents ......................................................................................... Total assets ......................................................................... $20,000 6,000 4,500 7,000 37,500 $50,000 4,800 45,200 7,500 $90,200 Completing the Accounting Cycle Solution 186 (cont.) 4 - 51 Liabilities and Owner's Equity Current liabilities Accounts payable.......................................................................... Long-term liabilities Bonds payable .............................................................................. Total liabilities....................................................................... Owner's Equity Melton, Capital .............................................................................. Total liabilities and owner's equity ........................................ * Melton, Capital = $48,700 ($46,000 + $6,900 – $4,200). $23,500 18,000 41,500 48,700* $90,200 a Ex. 187 Reisner Company prepared the following adjusting entries at year end on December 31, 2007: (a) Interest Expense ........................................................................... 200 Interest Payable ................................................................... 200 (b) (c) (d) (e) (f) Unearned Revenue ....................................................................... Service Revenue .................................................................. Insurance Expense ....................................................................... Prepaid Insurance ................................................................ Interest Receivable ....................................................................... Interest Revenue .................................................................. Supplies Expense ......................................................................... Supplies................................................................................ Wages Expense ............................................................................ Wages Payable .................................................................... 1,500 1,500 1,200 1,200 100 100 250 250 3,000 3,000 In an effort to minimize errors in recording transactions, Reisner Company utilizes reversing entries. Instructions Prepare reversing entries on January 1, 2008, for the adjusting entries given where appropriate. 4 - 52 a Test Bank for Accounting Principles, Eighth Edition (15 min.) Solution 187 Reversing entries are appropriate for adjusting entries related to accrued revenues and accrued expenses. Three of the entries given are accruals and need to be reversed. (a) Reverse the entry to accrue interest expense. Interest Payable............................................................................ Interest Expense.................................................................. Reverse the entry to accrue interest revenue. Interest Revenue .......................................................................... Interest Receivable .............................................................. Reverse the entry to accrue wages expense. Wages Payable ............................................................................ Wages Expense................................................................... 200 200 (d) 100 100 (f) 3,000 3,000 a Ex. 188 On December 31, 2008 the adjusted trial balance of the Dixon Personnel Agency shows the following selected data: Commission Receivable, $7,000 Commission Revenue, $70,000 Interest Expense, $10,500 Interest Payable, $2,500 Utilities Expense, $4,800 Accounts Payable, $2,400 Analysis indicates that adjusting entries were made for (a) $7,000 of employment commission revenue earned but not billed, (b) $2,500 of accrued but unpaid interest, and (c) $2,400 of utilities expense accrued but not paid. Instructions (a) Prepare the closing entries at December 31, 2008. (b) Prepare the reversing entries on January 1, 2009. (c) Enter the adjusted trial balance data in T-accounts. Post the entries in (a) and (b) and rule and balance the accounts. (d) Prepare the entries to record (1) the collection of the accrued commission on January 8, (2) payment of the utility bill on January 10, and (3) payment of all the interest due ($3,000) on January 15. (e) Post the entries in (d) to the temporary accounts. (f) What is the interest expense for the month of January 2009? a Solution 188 (25 min.) 70,000 70,000 15,300 10,500 4,800 (a) (1) Commission Revenue ............................................................ Income Summary........................................................... (2) Income Summary ................................................................... Interest Expense............................................................ Utilities Expense ............................................................ Completing the Accounting Cycle a 4 - 53 Solution 188 (cont.) 54,700 54,700 7,000 7,000 2,500 2,500 2,400 2,400 (3) Income Summary .................................................................... Dixon, Capital ................................................................. (b) (1) Commission Revenue ............................................................. Commission Receivable ................................................. (2) Interest Payable ...................................................................... Interest Expense ............................................................ (3) Accounts Payable.................................................................... Utilities Expense............................................................. (c) and (e) Commission Receivable (A) 7,000 (R) 7,000 (C) (R) Commission Revenue 70,000 7,000 (A) (D) 70,000 7,000 Interest Expense (A) (D) 10,500 3,000 (C) (R) 10,500 2,500 (R) Interest Payable 2,500 (A) 2,500 Utilities Expense (A) (D) 4,800 2,400 (C) (R) 4,800 2,400 (R) Accounts Payable 2,400 (A) 2,400 Legend A = Adjusted trial balance amount C = Closing R = Reversing D = January Transaction entries (d) (1) Jan. 8 Cash ...................................................................... Commission Revenue................................... Utilities Expense .................................................... Cash ............................................................. Interest Expense.................................................... Cash ............................................................. 7,000 7,000 2,400 2,400 3,000 3,000 (2) Jan. 10 (3) Jan. 15 (f) Interest expense for January is $500 ($3,000 – $2,500). 4 - 54 a Test Bank for Accounting Principles, Eighth Edition Ex. 189 Transaction and adjustment data for Gore Company for the calendar year end is as follows: 1. December 24 (initial salary entry): $12,000 of salaries earned between December 1 and December 24 are paid. 2. December 31 (adjusting entry): Salaries earned between December 25 and December 31 are $2,000. These will be paid in the January 8 payroll. 3. January 8 (subsequent salary entry): Total salary payroll amounting to $7,000 was paid. Instructions Prepare two sets of journal entries as specified below. The first set of journal entries should assume that the company does not use reversing entries, and the second set should assume that reversing entries are utilized by the company. Assume no reversing entries (a) Initial Salary Entry Assume reversing entries Dec. 24 (b) Adjusting Entry Dec. 31 (c) Closing Entry Dec. 31 (d) Reversing Entry Jan. 1 (e) Subsequent Salary Entry Jan. 8 Completing the Accounting Cycle a 4 - 55 Solution 189 (20 min.) Assume reversing entries Assume no reversing entries (a) Initial Salary Entry 12,000 12,000 Dec. 24 Salaries Expense Cash (b) Adjusting Entry Salaries Expense Cash 12,000 12,000 Dec. 31 Salaries Expense Salaries Payable (c) Closing Entry 2,000 2,000 Salaries Expense Salaries Payable 2,000 2,000 Dec. 31 Income Summary Salaries Expense (d) Reversing Entry 14,000 14,000 Income Summary 14,000 Salaries Expense 14,000 Jan. 1 None Salaries Payable 2,000 Salaries Expense 2,000 (e) Subsequent Salary Entry 2,000 5,000 7,000 Salaries Expense Cash 7,000 7,000 Jan. 8 Salaries Payable Salaries Expense Cash 4 - 56 Test Bank for Accounting Principles, Eighth Edition COMPLETION STATEMENTS 190. The first step in preparing a worksheet is to prepare a ______________ from the general ledger accounts. The account balances appearing in the adjusted trial balance columns are extended to the ______________ columns and the ______________ columns. The process of transferring net income (or loss) for the period to Owner's Capital is accomplished by making ______________ entries. At the end of an accounting period, all revenue and expense accounts are closed to a temporary account called ______________. The Owner's Drawing account is closed to the ______________ account at the end of the accounting period. After all closing entries have been journalized and posted, the final step in the accounting cycle is to prepare a ______________ trial balance. The preparation of a ______________ and ______________ entries are two optional steps in the accounting cycle. Two permanent accounts that are part of the stockholder's equity in a corporation are ______________ and ______________. The four major classifications of assets in a classified balance sheet are: ________________, ________________, ________________ and ________________. The ______________ of a company is the average time that it takes to purchase inventory, selll it on account, and then collect cash from customers. Assets that do not have a physical substance yet often are very valuable are called ______________ assets. Liabilities are generally classified as either ______________ or ______________ on a classified balance sheet. 191. 192. 193. 194. 195. 196. 197. 198. 199. 200. 201. Answers to Completion Statements 190. 191. 192. 193. 194. 195. 196. trial balance income statement, balance sheet closing Income Summary Owner's Capital post-closing worksheet, reversing 197. Capital Stock, Retained Earnings 198. Current Assets; Long-Term Investments; Property, Plant, and Equipment; Intangible Assets 199. operating cycle 200. intangible 201. current, long-term Completing the Accounting Cycle 4 - 57 MATCHING 202. Match the items below by entering the appropriate code letter in the space provided. A. B. C. D. E. ____ ____ ____ ____ ____ ____ ____ ____ ____ Worksheet Permanent accounts Closing entries Income Summary Reversing entry F. G. H. I. J. Capital Stock Current assets Operating cycle Long-term liabilities Correcting entries 1. Obligations that a company expects to pay after one year. 2. A part of owners' equity in a corporation. 3. An optional tool which facilitates the preparation of financial statements. 4. A temporary account used in the closing process. 5. Balance sheet accounts whose balances are carried forward to the next period. 6. The average time that it takes to go from cash to cash in producing revenues. 7. Entries to correct errors made in recording transactions. 8. The exact opposite of an adjusting entry made in a previous period. 9. Entries at the end of an accounting period to transfer the balances of temporary accounts to a permanent owner's equity account. ____ 10. Assets that a company expects to pay or convert to cash or use up within one year. Answers to Matching 1. 2. 3. 4. 5. I F A D B 6. 7. 8. 9. 10. H J E C G 4 - 58 Test Bank for Accounting Principles, Eighth Edition SHORT-ANSWER ESSAY QUESTIONS S-A E 203 A worksheet is an optional working tool used by accountants to facilitate the preparation of financial statements. Consider the steps followed in preparing a worksheet. How does the use of a worksheet assist the accountant. Could financial statements be prepared without a worksheet? Evaluate how the process would differ. Consider factors such as timeliness, accuracy, and efficiency in your evaluation. Solution 203 The worksheet organizes the accountant's work in preparing the income statement and the balance sheet. The worksheet contains the general ledger trial balance, the adjusting entries, and an adjusted trial balance (if 10-column). The columns for these trial balances and entries allow the accountant to prove the equality of the debits and credits at each step of the process. From the adjusted trial balance the balance sheet and income statement amounts are obtained and entered in the appropriate columns. Preparing financial statements without the use of a worksheet would be less organized and probably more prone to errors. And, if errors are made, they will probably be less easy to detect and locate, and, therefore, less efficient and more time consuming. S-A E 204 Journalizing and posting closing entries is a required step in the accounting cycle. Discuss why it is necessary to close the books at the end of an accounting period. If closing entries were not made, how would the preparation of financial statements be affected? Solution 204 Closing entries are prepared to close the income statement accounts (the temporary accounts) of the current year in order to start the next year. Income statement (temporary) accounts are cumulative in nature but only for a year. The closing entries are what separate the accounting periods. The next year's accumulation of income statement data can begin once the accounts are cleared and the balances transferred through the closing entries to owner's equity. S-A E 205 Give the definition of current assets and current liabilities and provide two examples of each. Solution 205 Current assets are assets that a company expects to convert to cash or use up within one year. Examples of current assets include short-term investments, accounts receivable, and inventory. Current liabilities are obligations that the company is to pay within the current year. Examples of current liabilities are accounts payable, wages payable, and taxes payable. Completing the Accounting Cycle S-A E 206 (Ethics) 4 - 59 Under Protection provides underground storage facilities for companies desiring off-site storage of sensitive documents, computer records, and other items. They have developed a sophisticated surveillance and security system which they initially used in their own facilities, and have recently started to market elsewhere as well. The underground storage facilities are made from natural caves in some instances (reinforced and modified as appropriate) and from excavations of natural rock formations in others. The land was purchased over ten years ago for a total of $2.5 million. The modifications have cost approximately $15 million more. The company has never depreciated its storage facilities because the market value of the property has continued to rise. Presently, the market price is between $30 and $40 million. Tom Carr, a new accounting manager, questioned this depreciation policy. Ken Hines, the controller, has told him that he needn't worry about it. For one thing, he says, this is really a special form of Land account, which should not be depreciated at all. For another, this is a privately held company, and so they don't need to worry about misleading investors. All the owners know about and approve the depreciation policy. Required: What are the ethical issues in this situation? Solution 206 The ethical issue is one of integrity. Even though the storage facilities are underground, that does not mean that they can be accounted for simply as land. The structural improvements and surveillance mechanisms will not last forever, and therefore their cost should be allocated over the periods that are benefited. Net income is being overstated because the depreciation expense, at zero, is being understated. A second issue is the harm that may be incurred by outside parties because of the misrepresentation in the financial statements. Even though the owners know about the (lack of) depreciation, they may still use their financial statements to obtain loans. Private investors and bankers should be able to rely on the financial statements. A third issue is that of the integrity of the accountants themselves. If they are being asked to ignore a basic principle of accounting so openly now, they should certainly ask themselves what lies ahead. S-A E 207 (Communication) You have recently started to work for Trent Holmes, manufacturers of cemetery markers and monuments. During your first month at work, you inadvertently recorded as revenue, about $3,000 of prepayments from Wynn Company. The financial statements had been released within the company when you discovered your error. The month-end closing had not been completed, however, and you were able to correct the accounts without incident. Required: Prepare a short note to accompany the re-released financial statements explaining the mistake. 4 - 60 Test Bank for Accounting Principles, Eighth Edition Solution 207 MEMO TO: Department Managers FROM: Lisa Cross, Accounting RE: Month-End Reports ****ATTACHED FINANCIAL STATEMENTS REPLACE THOSE ISSUED JULY 5**** *****DESTROY ALL EARLIER COPIES OF JUNE 30 FINANCIAL STATEMENTS**** An error was made in the recording of Wynn Company's prepayment. The entire $3,000 was recorded as revenue. Since Wynn's order has not been completed or shipped, it should have been recorded as unearned revenue, which is a liability. Note that net income is reduced to only $15,000 as a result of this change. If you have sent any of your summary reports to corporate headquarters, please contact the Accounting Department immediately for correction codes. I am sincerely sorry for any inconvenience or delays caused by this error. (signature)

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 3ADJUSTING THE ACCOUNTSSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62.sg st aSO 1 1 1 1 1 2 2 2 1 1
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 2THE RECORDING PROCESSSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 152. 153.sg stSO 1 1 1 1 2 2 2 2 1 1 1
Abu Dhabi University - ACCOUNTING - 1234
C HAPTER 1ACCOUNTING IN ACTIONSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 3. 4. 5. 6. 7. 8. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. a 55. a 56. a 57. a 58. 59. 60. 61. 62. 63. 64. 65. 164. 165. 166.sg st aSO
Abu Dhabi University - ACCOUNTING - 1234
A PPENDIX CTIME VALUE OF MONEYSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 11. 12. 13. 14. 15. 16. 17. 18. 48. 49. 50. 62. SO 1 1 2 2 2 2 2 3 3 3 3 3 3 1 BT K K K C C AP AP AP AP C AP AP AP K Item 3. 4. 19. 20. 21. 22. 23. 24.
UCLA - LS - ls 4
1/5/10 50% 40% 30% 20% 10% 0%In this imaginary graph, red are batting averages for baseball players using a wooden bat, green are for players using a metal bat. Would you recommend that a new player use a wood or metal bat. 1. Wood 2. Metal 3. Dont know
UCLA - LS 4 - ls 4
Chromosomes - rst reported 1882 (after Mendel) # chromosomes/nucleus in a species is constant. human, 46; corn, 10; fruit y, 8 2 pairs of arms - members of a pair are equal in size longitudinal - 2 identical units, called chromatidsIn the fruit y8 chrom
UCLA - LS 4 - ls 4
Drosophila melanogaster Short life cycle - 12 days Many progeny Easy to grow in laboratoriesCalvin Bridges, an undergraduate dishwasher, discovered a white-eyed fly (normal flies have red eyes) in one of the fly bottles he was about to washKaryotypesca
UCLA - LS 4 - ls 4
1/13/10Sex Determination 1. Sex chromosomes humans; silkworms - presence of Y chromosome Drosophila; nematodes - X to autosome ratio 2. Ploidy (in bees, males are haploid, females diploid) 3. Environment - Bonellia; a sea worm. Larvae are sexually undiff
UCLA - LS 4 - ls 4
1/18/10Hemophilia X-linked disease1. 2. 3. 4.X-linked traits appear more frequently in males. Mutation and trait never pass from father to son. Affected male always passes mutation to daughters, who serve as carriers who pass the trait to 1/2 of their
UCLA - LS 4 - ls 4
1/20/10Hypothesis. You have two plants that are both heterozygous for a single gene displaying a simple dominant/recessive relationship. To test this hypothesis you cross the two plants together and count progeny. Imagine 4 different outcomes, which expe
UCLA - LS 4 - ls 4
1/25/10Tet resistance Auxotroph revertant Bacteriophage resistancePetri dish 5 bacteria 12 hours107 bacteria12 hours107 bacteria12 hoursE. Coli (107 tets and 7 tetr)Media + tet11/25/10107 bacteriaarg- E. coliComplete mediaMinimal media107 b
UCLA - LS 4 - ls 4
1/27/1011/27/10Hfr met+ thi+ pur+ strs X F- met- thi- pur- strr Interrupted matings indicate that met enters the recipient last. Plate progeny on media to select for met+ recombinants. What media would you plate the mated bacteria on? 1. minimal + meth
UCLA - LS 4 - ls 4
2/1/10ra- X rb- 94% large 6% small1Host Range Mutants h+ (wild type) can grow on E. colis but not on E. colir. h can grow on both E. colis and E. colir.212/1/10Recombination in phage +- +r h Xr hPhenotype Clear and small Cloudy and large Cloudy a
UCLA - LS 4 - ls 4
2/3/10Lwoff concludes that; 1. lysogenic bacteria contain a noninfective structure, the prophage. 2. the prophage can turn into an infective phage and that no new phage particle is required for this. 3. In a small percentage of lysogenic bacteria, the pr
UCLA - LS 4 - ls 4
2/8/10AI J KBCDEFGHWhich rII deletion can recombine with which rII point mutation to give WT? Which rII deletion can recombine with which rII deletion to give WT?123456 789+ + +The 5 deletion mutations are used to map a point mutation.A
UCLA - LS 4 - ls 4
2/10/10Fig. 8.3DNARNAPROTEINTRANSCRIPTION RNA differs from DNA: 1. Single stranded 2. Ribose sugar 3. U instead of a TAGGCTAGCTAG TCCGATCGATCAGGCUAGCUAGTranscription goes 5 to 3.3 MAJOR TYPES OF RNA. 1. mRNA: code for protein 2. rRNA: ribosomes 3
UCLA - LS 4 - ls 4
2/14/10UUAUGUCUACUUUAGUUCCUCAUCGUGGGGCAUAGUAC MetSerThrLeuValProHisArgGlyAlaSTOP Missense Mutation UUAUGUCUACUUUAGUUACUCAUCGUGGGGCAUAGUAC MetSerThrLeuValThrHisArgGlyAlaSTOP UUAUGUCUACUUUAGUUCCUCAUCGUCGGGCAUAGUAC MetSerThrLeuValProHisArgArgAlaSTOP Nonsens
UCLA - LS 4 - ls 4
2/17/10IPTG: -galactoside isopropyl-d-thiogalactosideCan bind to Lac repressor => can induce lac operon Can not be cleaved by -galactosidase => constant concentration of inducer Commonly used inducer in the lab.-gal Protein Bacterial Protein12/17/10
UCLA - LS 4 - ls 4
Restric(on/Modica(on100%100%K12(P1) 0.002%K12100%K12(P1)encodesenzymesthatmethylateDNAandcutnon methylatedDNA. HOSTCONTROLLEDRESTRICTIONMODIFICATIONOF.CH3cytosine5methylcytosineRestriction EndonucleasesOver 200 restriction enzymes have been iso
UCLA - LS 4 - ls 4
MstII site is CCTNAGGprobeIn this case, the RFLP does not cause the D mutation, but is linked to the D locus.Hemophilia - X-linked diseaseWhat are the genotypes of the family members?Hemophilia - X-linked diseaseH YH hH -H Yh YH -7 kb 5 kbSou
UCLA - LS 4 - ls 4
REVERSE GENETICSTRANSGENIC MICEGrowth Hormone- made in small amounts in specialized cells located in the anterior pituitary gland. The following constructs were injected: metallothionein promoter-rat growth hormone. M.P. RGH protein rat growth hormone p
UCLA - LS 4 - ls 4
MN blood group frequencies MM MN NN Total 119 76 13 208 p(M) = [(119 + 119 + 76]/ 2 x 208 = .755 q(N) = [(13 + 13 + 76]/2 x 208 = .245 If in HWE expect: MM p2 (.755)2 x (208) = 118.6 MN 2pq 2(.755)(.245) x (208) = 76.9 NN q2 (.245)2 x (208) = 12.5X-linke
UCLA - LS 4 - ls 4
91Fig. 9.17CopyrightTheMcGrawHillCompanies, Inc.Permissionrequiredtoreproduceor displayFig. 9.1792CopyrightTheMcGrawHillCompanies, Inc.Permissionrequiredtoreproduceor displayAutomatedDNAsequencing Fig. 9.18 a93CopyrightTheMcGrawHillCompanies, Inc
UCLA - LS 4 - ls 4
CancerCancerDeaths Es-matednumberofnewcancercasesanddeathsintheUnitedStatesin1997.Cancer: A cell growth disorder resulting from an alteration in genes (mutations) that lead to deregulated (transformed) cell growth. CANCER IS A GENETIC DISEASE Transform
UCLA - LS 4 - ls 4
1 Question 1. Note that the female is the heterogametic sex.22. PedigreeThe following pedigree concerns a very rare human disorder that causes premature puberty in males.1 24567891011121314151617Which mode(s) of inheritance can explain
UCLA - LS 4 - ls 4
1LS 4 Example Midterm 1 questions INTRODUCTORY GENETICS21. Mitosis/MeiosisWe consider an organism with three pairs of chromosomes: the sex chromosomes X and Y, and the pairs of autosomal chromosomes 1 and 2. The female is the heterogametic sex. The st
UCLA - LS 4 - ls 4
Name_LS 4 INTRODUCTORY GENETICS MIDTERM II practice problemsName_ 1 The following cross is done in the Pea plant. P F1 AAbb x AAbb AaBbThese F1 progeny are then testcrossed as follows: AaBb x aabb The A and B alleles are dominant and the a and b allele
UCLA - LS 4 - ls 4
Name_LS 4 INTRODUCTORY GENETICS MIDTERM II practice problemsName_ 1 The following cross is done in the Pea plant. P F1 AAbb x AAbb AaBbThese F1 progeny are then testcrossed as follows: AaBb x aabb The A and B alleles are dominant and the a and b allele
UCLA - LS 4 - ls 4
Q. 1Correct answers in bold . coli ( wild type) . coli ( ts cI) . coli ( ts cII) . coli ( ts N) . coli ( ts cro) . coli ( ts cI, ts cII) . coli ( ts cI, ts N) . coli ( ts cII; ts N) grow at 40C lyse at 40C grow at 40C grow at 40C grow at 40C lyse at 40C
UCLA - LS 4 - ls 4
NAMELS 4 INTRODUCTORY GENETICS MIDTERM III Practice ProblemsNAMEQ. 1 (14 points)Below are listed E. coli strains that are lysogenic for bacteriophage . Each strain has a prophage that contains a ts mutation (or two ts mutations). All strains of E. col
U. Houston - CHEE - 2331
CHEE 2331 Chemical Processes Energy and Energy Balances Chapter 7, pages 313-333Department of Chemical and Biomolecular Engineering EngineeringWhat is energy?The ability to do workEnergy units (F-L)Mechanical Metric Engineering S.I. erg ft-lbf J Ther
U. Houston - BIOL - 1362
1QuestionsonCH1720ToBeCoveredDuringLectureorinExam2Review1. Carryoutthefollowingtranscriptionandtranslationproblem: 2. 3. 4. Puttheeventsthatentaileukaryotictranscriptionandtranslationinchronologicalorder: A)PremRNAisprocessedandspecificsequencesareremo
U. Houston - BIOL - 1362
1B ? 1ASamespeciesordifferentspecies?2A ? 2BSpeciationPopulationof aspeciesMicroevolutionary ForcesPopulationevolves; adaptation Howdo SpeciesForm? Speciation(processofaspeciessplittinginto2more species)bridgesmicroevolutionwithmacroevolution. Bio
U. Houston - BIOL - 1362
Microevolution Microevolution: heritablegeneticchangesthatoccurina population. Naturalselectionactsonindividuals,butpopulationsarethesmallest unitsthatcanevolve. Instudyingmicroevolution,oneanalyzesvariationinnatural populations&determineshow/whytheseva
U. Houston - BIOL - 1362
Onymacris unguicularis, the head standing beetle Namibia Atlantic ocean 1of350,000beetlespecies Hastypicalbeetletraits:pairofwings;6legs;hardexterior Possessesitsownuniquebehavior Priorexample illustratesthefeaturesofalllife:sharedtraits; variation;feat
U. Houston - BIOL - 1362
AnswerstoQuestionsonCH2226ToBeCoveredDuringLectureorinExam3Review1. DuringdroughtyearsontheGalapagos,small,easilyeatenseedsbecomerare,leavingmostlylarge,hard casedseedsthatonlybirdswithlargebeakscaneat.Ifadroughtpersistsforseveralyears,whatshould oneexpe
U. Houston - BIOL - 1362
AnswerstoLectureQuestionsfromWeekof12510 I.Whataretheproductsofmitosis? 1. Howmanycellsareproducedattheendofasinglemitoticdivision? Twocellsareproducedattheendofasinglemitoticdivision. 2. Howmanydifferentkindsofcellsareproducedattheendofasinglemitoticdiv
U. Houston - BIOL - 1362
PhylogenyAsnakeorlizardspecies? Understandingofevolutionaryrelationships(phylogeny)allows onetocomparetraitsofrelated speciestoanswersuchquestions. Constructingphylogeniesoccurs viasystematics classifying organisms&determining evolutionaryrelationships.
U. Houston - BIOL - 1362
BIOTECHNOLOGY PROBLEM1Using the following mammalian DNA sequence and the restriction enzyme, Taq I, find the restriction sites and indicate where the cuts occur. Taq I : 5 T*CGA 3 3 A GC*T 5ABCDECT*CGATTAT*CGAACCTTCAT*CGATT*CGAGCCTTCG GAGC*TAATAGC
U. Houston - BIOL - 1362
AnswerstoLectureQuestionsfrom22210&22410Lectures(QuestionnumbersbelowmatchthoseintheVNETdocument, 1362CH1720Questionstobecoveredduringlecture)1. Carryoutthefollowingtranscriptionandtranslationproblem: 4. E.coliisculturedonagrowthmediumcontainingbotht
U. Houston - BIOL - 1362
Protein Synthesis WorksheetDetermine the amino acid sequence for a polypeptide coded for by the following mRNA transcript:3-T A G G C T A C G G A C T G A A A T T C A T C T T A G A A A T - 5 5-A U C C G A U G C C U G A C U U U A A G U A G A A U C U U U A
U. Houston - BIOL - 1362
AnswerstoRemainingQuestionsfromdocumentQuestionsonCH1720ToBe CoveredDuringLecture 14. Ifaresearcherwaslookingtoclonethegeneforaspecificliverenzyme,itwouldbemostefficient andlogicaltofirstsearchin: A. alivercellandpickitoutwithapairoftweezers. B. ahumanli
U. Houston - BIOL - 1362
1)OnecaninferfromtheCentralDogma,thatdifferentRNAmoleculesarenecessaryinordertosynthesizeDNA fromasequenceofaminoacids(i.e.,protein). A)True B)False Answer:B 2)Inagene,thepresenceofapromoterisrequired A)fortranscriptiontooccur. B)fortranslationtooccur. C)
U. Houston - BIOL - 1362
MboI (2 sites) *GATCThe MboI enzyme will not cut at the ends even though the *GATC is present at both ends. The MboI enzyme cannot properly bind when the target sequence is at these locations. I would not expect you to know this and I would not give you
U. Houston - BIOL - 1362
AnswerstoLectureQuestionsfrom3310Lecture(QuestionnumbersbelowmatchthoseintheVNETdocument, 1362CH1720Questionstobecoveredduringlecture)10. AfterthetransformationstepinaDNAcloningexperiment,oneusuallyfirstscreensforcloneswith antibioticresistance.Whatdoes
U. Houston - BIOL - 1362
1Answer Key: Replication, Transcription, Translation WorksheetExercise A. DNA structure You were given this DNA sequence: 3 TACGGCATT 5; the complete double stranded sequence would look like this (use complimentary base pairing, remember to label ends c
U. Houston - BIOL - 1362
EXAM 1 REVIEW (CH 12 16; Sadava Text: CH 9-11) ALSO: Be familiar with Key Terms for CH 12-16 and go over document titled CH 12-16 Questions to Think About CHAPTER 12 (The Cell Cycle) 1) Cell division & its roles in different organisms; Prokaryote v. Eukar
U. Houston - BIOL - 1362
U. Houston - BIOL - 1362
U. Houston - BIOL - 1362
BASIC QUESTIONS: GENE EXPRESSIONAnswers are not posted to questions 1-19. This is intended more as a study tool; as you review your notes, write out the answers to these questions below. 1. How does information flow in a cell ? 2. What contribution did B
U. Houston - BIOL - 1362
U. Houston - BIOL - 1362
BIOTECHNOLOGY PROBLEM1Using the following mammalian DNA sequence and the restriction enzyme, Taq I, find the restriction sites and indicate where the cuts occur. Taq I : 5 T*CGA 3 3 A GC*T 55 3 CT CGATTATCGAACCTTCAT CGATTCGAGCCTTCG GAGCTAATAGCTTGGAAGTA
U. Houston - BIOL - 1362
U. Houston - BIOL - 1362
1 Assume that a bacterial plasmid carries the gene for resistance to the antibiotic kanamycin. Using the restriction enzyme A, you open the plasmid and insert a segment of a biologically important gene isolated from a mouse. The gene was excised from the
U. Houston - BIOL - 1362
ProkaryoticGenes&RegulationReCapRegulatory genePromoterOperatorABCRepressorproteinBindstooperatorblocking transcription.Proteins(enzymes)of pathwayOperon:Type Functionofgenes inoperon RepressorActive (notranscription) RepressorInactive (transcr
U. Houston - BIOL - 1362
PagestoReadforBiology,Campbell&Reece,8thedition:CH2226 Note:makesuretoviewanyfigures&tablesreferencedinthetext. CH22(Darwin&Modification) o Readpages450466 CH23(EvolutionofPopulations) o Readpages468484 CH24(OriginofSpecies) o Readpages487501;willnotcove
U. Houston - BIOL - 1362
PagestoReadfor Life,TheScienceofBiology,Sadava,etal,8thedition:CH2123&25 Note:makesuretoviewanyfigures&tablesreferencedinthetext. CH21(HistoryofLifeonEarth) o Readpp.465467(materialonfossils) CH22(MechanismsofEvolution) o Readpp.486504;recallgenes&enviro
U. Houston - BIOL - 1362
1362Exam1Distribution&Curve300 250 200 150 100 50 0 <30 30to 40to 50to 60to 70to 80to 90to 100+ 49 79 39 59 69 89 99AVG=69MED =70 >86.45=A >74.49=B >62.52=C >50.56=D
U. Houston - BIOL - 1362
The following is an exam given in 2006; it is intended to be an example of the type & style of questions given on an exam. Using this as your primary study material for the Spring 2009 exam 1 would be a mistake. BIOL 1362 Exam 1 from Spring 2006 CH 11 1.
U. Houston - BIOL - 1362
Key Terms: CH 22 26 (Sadava text: CH 21-23 & 25) Evolution Natural theology Scala naturae Theory of Use & Dis-use Adaptation Population Species Artificial selection Decent with modification Natural selection Differential reproductive success Heritable var
U. Houston - BIOL - 1362
Name _Mitosis and MeiosisBefore you begin, save this Lab Report Template on your computer as LastNameAPBIOMitosis For this lab you will need to access the Mitosis Virtual Microscope (http:/www.jdenuno.com/PDFfiles/Mitosis.pdf) and the Meiosis Virtual Mi