ch01
53 Pages

ch01

Course Number: ACCOUNTING 1234, Spring 2010

College/University: Abu Dhabi University

Word Count: 12555

Rating:

Document Preview

C HAPTER 1 ACCOUNTING IN ACTION SUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOM’S TAXONOMY Item 1. 2. 3. 4. 5. 6. 7. 8. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. a 55. a 56. a 57. a 58. 59. 60. 61. 62. 63. 64. 65. 164. 165. 166. sg st a SO 1 1 1 2 2 2 2 2 1 1 1 1 1 1 1 1 2 2 2 2 2 2 9 9 9 9 2 2 2 3 3 4 4 2 6 6 BT K K C K K C K C K K K C K K K K C C C C C C K K K C K K C K C K K C K K Item 9....

Unformatted Document Excerpt
Coursehero >> United Arab Emirates >> Abu Dhabi University >> ACCOUNTING 1234

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

HAPTER C 1 ACCOUNTING IN ACTION SUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOM’S TAXONOMY Item 1. 2. 3. 4. 5. 6. 7. 8. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. a 55. a 56. a 57. a 58. 59. 60. 61. 62. 63. 64. 65. 164. 165. 166. sg st a SO 1 1 1 2 2 2 2 2 1 1 1 1 1 1 1 1 2 2 2 2 2 2 9 9 9 9 2 2 2 3 3 4 4 2 6 6 BT K K C K K C K C K K K C K K K K C C C C C C K K K C K K C K C K K C K K Item 9. 10. 11. 12. 13. 14. 15. 16. 66. 67. 68. 69. 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 167. 168. 169. SO 2 2 2 2 2 2 3 4 4 4 4 4 4 4 4 4 5 5 5 5 5 5 5 5 5 5 5 5 5 5 6 6 6 6 6 6 BT K K K K K K K K C K K C K K C K K K K K K C C K K C K K K K K K K AP AP C Item 17. 18. 19. 20. 21. 22. 23. 24. 91. 92. 93. 94. 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 108. 109. 110. 111. 112. 113. 114. 115. 170. 171. 172. SO 4 4 4 5 5 5 5 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 7 7 7 7 7 7 7 7 7 8 8 BT K K K C K K K K C K K C K K K K K C K C AP AP AP AP AP C AP C C C C C C C AP C Item 25. 26. 27. 28. 29. 30. 31. 32. 116. 117. 118. 119. 120. 121. 122. 123. 124. 125. 126. 127. 129. 129. 130. 131. 132. 133. 134. 135. 136. 137. 138. 139. 140. 173. 174. SO 6 6 7 7 7 7 8 8 7 7 7 7 7 7 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 BT K K K C C C K K K C C C AN C C C K K K K C AP AP AP K K AP AP AP AP AP AP AP AP AP Item sg sg SO 1 2 3 4 5 6 7 8 8 8 8 8 8 8 8 8 8 8 8 1 1 1 2 2 4 4 5 6 7 7 8 BT K K K C K K K K AP AP AP AP AP AP AN AN AN AN AN K K K K K K K K K C C K True-False Statements 33. 34. sg 35. sg 36. sg 37. sg 38. sg 39. sg 40. 141. 142. 143. 144. 145. 146. 147. 148. 149. 150. 151. sg 152. st 153. st 154. sg 155. st 156. sg 157. st 158. sg 159. sg 160. sg 161. sg 162. sg 163. Multiple Choice Questions Brief Exercises This question also appears in the Study Guide. This question also appears in a self-test at the student companion website. This question covers a topic in an appendix to the chapter. 1-2 Test Bank for Accounting Principles, Eighth Edition SUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOM’S TAXONOMY Exercises 175. 176. 177. 178. 179. 180. 202. 203. 2,4 6 6 6 6 6 1 2 K C C AP C AP K K 181. 182. 183. 184. 185. 186. 204. 205. 6 6 6 7 7 7 2 2 C AN C C AN C K K 187. 188. 189. 190. 191. 192. 206. 207. 7 7 7 7 7 7 4 4 C AP C C C C K K 193. 194. 195. 196. 197. 198. 208. 209. 7 8 8 8 8 8 5 6 C AP C AP AN C K K 199. 200. 201. 8 8 8 AP AP AP Completion Statements 210. 211. 6 8 K K SUMMARY OF STUDY OBJECTIVES BY QUESTION TYPE Item 1. 2. 3. 4. 5. 6. 7. 15. 16. 17. 18. 20. 21. 22. 24. 25. 26. 38. 88. 89. Type TF TF TF TF TF TF TF TF TF TF TF TF TF TF TF TF TF TF MC MC Item 33. 41. 42. 8. 9. 10. 11. 35. 19. 36. 64. 23. 37. 74. 90. 91. 92. 93. 94. 95. Type TF MC MC TF TF TF TF TF TF TF MC TF TF MC MC MC MC MC MC MC Item 43. 44. 45. 12. 13. 14. 34. 62. 65. 66. 67. 75. 76. 77. 96. 97. 98. 99. 100. 101. Type Item Type Item Type MC MC MC MC MC MC MC Item 202. Type C Item Type Study Objective 1 MC 46. MC 152. MC 47. MC 153. MC 48. MC 154. Study Objective 2 TF 49. MC 53. TF 50. MC 54. TF 51. MC 59. TF 52. MC 60. Study Objective 3 MC 63. MC Study Objective 4 MC 68. MC 71. MC 69. MC 72. MC 70. MC 73. Study Objective 5 MC 78. MC 81. MC 79. MC 82. MC 80. MC 83. Study Objective 6 MC 102. MC 160. MC 103. MC 165. MC 104. MC 166. MC 105. MC 167. MC 106. MC 168. MC 107. MC 169. 61. 155. 156. 164. MC MC MC BE 175. 203. 204. 205. Ex C C C MC MC MC MC MC MC MC BE BE BE BE BE 157. 158. 175. 84. 85. 86. 176. 177. 178. 179. 180. 181. MC MC Ex MC MC MC Ex Ex Ex Ex Ex Ex 206. 207. C C 87. 159. 208. 182. 183. 209. 210. MC MC C Ex Ex C C Accounting in Action 1-3 SUMMARY OF STUDY OBJECTIVES BY QUESTION TYPE 27. 28. 29. 30. 39. 31. 32. 40. 122. 123. 124. 125. a TF TF TF TF TF TF TF TF MC MC MC MC MC 108. 109. 110. 111. 112. 126. 127. 128. 129. 130. 131. 132. a MC MC MC MC MC MC MC MC MC MC MC MC MC 113. 114. 115. 116. 117. 133. 134. 135. 136. 137. 138. 139. a 55. 56. 57. Study Objective 7 MC 118. MC 162. MC 119. MC 170. MC 120. MC 184. MC 121. MC 185. MC 161. MC 186. Study Objective 8 MC 140. MC 147. MC 141. MC 148. MC 142. MC 149. MC 143. MC 150. MC 144. MC 151. MC 145. MC 163. MC 146. MC 171. Study Objective 9 a MC 58. MC MC BE Ex Ex Ex MC MC MC MC MC MC BE 187. 188. 189. 190. 191. 172. 173. 174. 194. 195. 196. 197. Ex Ex Ex Ex Ex BE BE BE Ex Ex Ex Ex 192. 193. Ex Ex 198. 199. 200. 201. 211. Ex Ex Ex Ex C Note: TF = True-False MC = Multiple Choice BE = Brief Exercise Ex = Exercise C = Completion The chapter also contains one set of ten Matching questions and six Short-Answer Essay questions. CHAPTER STUDY OBJECTIVES 1. Explain what accounting is. Accounting is an information system that identifies, records, and communicates the economic events of an organization to interested users. 2. Identify the users and uses of accounting. The major users and uses of accounting are: (a) Management uses accounting information in planning, controlling, and evaluating business operations. (b) Investors (owners) decide whether to buy, hold, or sell their financial interests on the basis of accounting data. (c) Creditors (suppliers and bankers) evaluate the risks of granting credit or lending money on the basis of accounting information. Other groups that use accounting information are taxing authorities, regulatory agencies, customers, labor unions, and economic planners. 3. Understand why ethics is a fundamental business concept. Ethics are the standards of conduct by which actions are judged as right or wrong. If you cannot depend on the honesty of the individuals you deal with, effective communication and economic activity would be impossible, and information would have no credibility. 4. Explain generally accepted accounting principles and the cost principle. Generally accepted accounting principles are a common set of standards used by accountants. The cost principle states that companies should record assets at their cost. 5. Explain the monetary unit assumption and the economic entity assumption. The monetary unit assumption requires that companies include in the accounting records only transaction data that can be expressed in terms of money. The economic entity assumption 1-4 Test Bank for Accounting Principles, Eighth Edition requires that the activities of each economic entity be kept separate from the activities of its owner and other economic entities. 6. State the accounting equation, and define assets, liabilities, and owner's equity. The basic accounting equation is: Assets = Liabilities + Owner's Equity Assets are resources owned by a business. Liabilities are creditorship claims on total assets. Owner's equity is the ownership claim on total assets. 7. Analyze the effects of business transactions on the accounting equation. Each business transaction must have a dual effect on the accounting equation. For example, if an individual asset increases, there must be a corresponding (1) decrease in another asset, or (2) increase in a specific liability, or (3) increase in owner's equity. 8. Understand the four financial statements and how they are prepared. An income statement presents the revenues and expenses of a company for a specified period of time. An owner's equity statement summarizes the changes in owner's equity that have occurred for a specific period of time. A balance sheet reports the assets, liabilities, and owner's equity of a business at a specific date. A statement of cash flows summarizes information about the cash inflows (receipts) and outflows (payments) for a specific period of time. a 9. Explain the career opportunities in accounting. Accounting offers many different jobs in fields such as public and private accounting, government, and forensic accounting. Accounting is a popular major because there are many different types of jobs, with unlimited potential for career advancement. TRUE-FALSE STATEMENTS 1. 2. Owners of business firms are the only people who need accounting information. Transactions that can be measured in dollars and cents are recorded in the financial information system. The hiring of a new company president is an economic event recorded by the financial information system. Management of a business enterprise is the major external user of information. Accounting communicates financial information about a business enterprise to both internal and external users. Accounting information is used only by external users with a financial interest in a business enterprise. Financial statements are the major means of communicating accounting information to interested parties. Bookkeeping and accounting are one and the same because the bookkeeping function includes the accounting process. 3. 4. 5. 6. 7. 8. Accounting in Action 9. 10. The origins of accounting are attributed to Luca Pacioli, a famous mathematician. 1-5 The study of accounting will be useful only if a student is interested in working for a profitoriented business firm. Private accountants are accountants who are not employees of business enterprises. The study of accounting is not useful for a business career unless your career objective is to become an accountant. A working knowledge of accounting is not relevant to a lawyer or an architect. Expressing an opinion as to the fairness of the information presented in financial statements is a service performed by CPAs. Accountants rely on a fundamental business concept—ethical behavior—in reporting financial information. The primary accounting standard-setting body in the United States is the International Accounting Standards Board. The Financial Accounting Standards Board is a part of the Securities and Exchange Commission. The Securities and Exchange Commission overseas U.S. financial markets and accounting standard-setting bodies. The cost and fair market value of an asset are the same at the time of acquisition and in all subsequent periods. Even though a partnership is not a separate legal entity, for accounting purposes the partnership affairs should be kept separate from the personal activities of the owners. A partnership must have more than one owner. The economic entity assumption requires that the activities of an entity be kept separate and distinct from the activities of its owner and all other economic entities. The monetary unit assumption states that transactions that can be measured in terms of money should be recorded in the accounting records. In order to possess future service potential, an asset must have physical substance. Owners' claims to total business assets take precedence over the claims of creditors because owners invest assets in the business and are liable for losses. The basic accounting equation states that Assets = Liabilities. Accountants record both internal and external transactions. Internal transactions do not affect the basic accounting equation because they are economic events that occur entirely within one company. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 1-6 29. Test Bank for Accounting Principles, Eighth Edition The purchase of store equipment for cash reduces the owner's equity by an equal amount. The purchase of office equipment on credit increases total assets and total liabilities. The primary purpose of the statement of cash flows is to provide information about the cash receipts and cash payments of a company during a period. Net income for the period is determined by subtracting total expenses and drawings from total revenues. 30. 31. 32. Additional True-False Questions 33. Identifying is the process of keeping a chronological diary of events measured in dollars and cents. Management consulting includes examining the financial statements of companies and expressing an opinion as to the fairness of their presentation. Accountants do not have to worry about issues of ethics. At the time an asset is acquired, cost and value should be the same. The monetary unit assumption requires that all dollar amounts be rounded to the nearest dollar. The basic accounting equation is in balance when the creditor and ownership claims against the business equal the assets. External transactions involve economic events between the company and some other enterprise or party. In the owner's equity statement, revenues are listed first, followed by expenses, and net income (or net loss). 34. 35. 36. 37. 38. 39. 40. Answers to True-False Statements Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. 1. 2. 3. 4. 5. 6. F T F F T F 7. 8. 9. 10. 11. 12. T F T F F F 13. 14. 15. 16. 17. 18. F T T F F T 19. 20. 21. 22. 23. 24. F T T T T F 25. 26. 27. 28. 29. 30. F F T F F T 31. 32. 33. 34. 35. 36. T F F F F T 37. 38. 39. 40. F T T F Accounting in Action 1-7 MULTIPLE CHOICE QUESTIONS 41. Accountants refer to an economic event as a a. purchase. b. sale. c. transaction. d. change in ownership. The process of recording transactions has become more efficient because a. fewer events can be quantified in financial terms. b. computers are used in processing business events. c. more people have been hired to record business transactions. d. business events are recorded only at the end of the year. Communication of economic events is the part of the accounting process that involves a. identifying economic events. b. quantifying transactions into dollars and cents. c. preparing accounting reports. d. recording and classifying information. Which of the following events cannot be quantified into dollars and cents and recorded as an accounting transaction? a. The appointment of a new CPA firm to perform an audit. b. The purchase of a new computer. c. The sale of store equipment. d. Payment of income taxes. The use of computers in recording business events a. has made the recording process more efficient. b. does not use the same principles as manual accounting systems. c. has greatly impacted the identification stage of the accounting process. d. is economical only for large businesses. The accounting process involves all of the following except a. identifying economic transactions that are relevant to the business. b. communicating financial information to users by preparing financial reports. c. recording nonquantifiable economic events. d. analyzing and interpreting financial reports. The accounting process is correctly sequenced as a. identification, communication, recording. b. recording, communication, identification. c. identification, recording, communication. d. communication, recording, identification. Which of the following techniques are not used by accountants to interpret and report financial information? a. Graphs b. Special memos for each class of external users c. Charts d. Ratios 42. 43. 44. 45. 46. 47. 48. 1-8 49. Test Bank for Accounting Principles, Eighth Edition Which of the following would not be considered an internal user of accounting data for the XYZ Company? a. President of the company b. Production manager c. Merchandise inventory clerk d. President of the employees' labor union Which of the following would not be considered an external user of accounting data for the XYZ Company? a. Internal Revenue Service Agent b. Management c. Creditors d. Customers Which of the following would not be considered internal users of accounting data for a company? a. The president of a company b. The controller of a company c. Creditors of a company d. Salesmen of the company Which of the following is an external user of accounting information? a. Labor unions b. Finance directors c. Company officers d. Managers Which one of the following is not an external user of accounting information? a. Regulatory agencies b. Customers c. Investors d. All of these are external users Bookkeeping differs from accounting in that bookkeeping primarily involves which part of the accounting process? a. Identification b. Communication c. Recording d. Analysis All of the following are services offered by public accountants except a. budgeting. b. auditing. c. tax planning. d. consulting. Which list below best describes the major services performed by public accountants? a. Bookkeeping, mergers, budgets b. Employee training, auditing, bookkeeping c. Auditing, taxation, management consulting d. Cost accounting, production scheduling, recruiting 50. 51. 52. 53. 54. a 55. a 56. Accounting in Action a 1-9 57. Preparing tax returns and engaging in tax planning is performed by a. public accountants only. b. private accountants only. c. both public and private accountants. d. IRS accountants only. A private accountant can perform many activities in a business organization but would not work in a. budgeting. b. accounting information systems. c. external auditing. d. tax accounting. The origins of accounting are generally attributed to the work of a. Christopher Columbus. b. Abner Doubleday. c. Luca Pacioli. d. Leonardo da Vinci. Financial accounting provides economic and financial information for all of the following except a. creditors. b. investors. c. managers. d. other external users. The final step in solving an ethical dilemma is to a. identify and analyze the principal elements in the situation. b. recognize an ethical situation. c. identify the alternatives and weigh the impact of each alternative on stakeholders. d. recognize the ethical issues involved. The first step in solving an ethical dilemma is to a. identify and analyze the principal elements in the situation. b. identify the alternatives. c. recognize an ethical situation and the ethical issues involved. d. weigh the impact of each alternative on various stakeholders. Ethics are the standards of conduct by which one's actions are judged as a. right or wrong. b. honest or dishonest. c. fair or unfair. d. all of these. Generally accepted accounting principles are a. income tax regulations of the Internal Revenue Service. b. standards that indicate how to report economic events. c. theories that are based on physical laws of the universe. d. principles that have been proven correct by academic researchers. a 58. 59. 60. 61. 62. 63. 64. 1 - 10 65. Test Bank for Accounting Principles, Eighth Edition The cost principle requires that when assets are acquired, they be recorded at a. appraisal value. b. exchange price paid. c. selling price. d. list price. The cost of an asset and its fair market value are a. never the same. b. the same when the asset is sold. c. irrelevant when the asset is used by the business in its operations. d. the same on the date of acquisition. The body of theory underlying accounting is not based on a. physical laws of nature. b. concepts. c. principles. d. definitions. The private sector organization involved in developing accounting principles is the a. Feasible Accounting Standards Body. b. Financial Accounting Studies Board. c. Financial Accounting Standards Board. d. Financial Auditors' Standards Body. The SEC and FASB are two organizations that are primarily responsible for establishing generally accepted accounting principles. It is true that a. they are both governmental agencies. b. the SEC is a private organization of accountants. c. the SEC often mandates guidelines when no accounting principles exist. d. the SEC and FASB rarely cooperate in developing accounting standards. GAAP stands for a. Generally Accepted Auditing Procedures. b. Generally Accepted Accounting Principles. c. Generally Accepted Auditing Principles. d. Generally Accepted Accounting Procedures. Which of the following is not a characteristic of the cost principle? a. Reliability b. Subjectivity c. Objectivity d. Verifiability The ACE Company has five plants nationwide that cost $100 million. The current market value of the plants is $500 million. The plants will be recorded and reported as assets at a. $100 million. b. $600 million. c. $400 million. d. $500 million. 66. 67. 68. 69. 70. 71. 72. Accounting in Action 73. All of the following are advantages cost has over other valuations except that it a. is reliable. b. can be objectively measured. c. can be verified. d. is relevant. 1 - 11 74. The proprietorship form of business organization a. must have at least three owners in most states. b. represents the largest number of businesses in the United States. c. combines the records of the business with the personal records of the owner. d. is characterized by a legal distinction between the business as an economic unit and the owner. The economic entity assumption requires that the activities a. of different entities can be combined if all the entities are corporations. b. must be reported to the Securities and Exchange Commission. c. of a sole proprietorship cannot be distinguished from the personal economic events of its owners. d. of an entity be kept separate from the activities of its owner. A business organized as a corporation a. is not a separate legal entity in most states. b. requires that stockholders be personally liable for the debts of the business. c. is owned by its stockholders. d. terminates when one of its original stockholders dies. The partnership form of business organization a. is a separate legal entity. b. is a common form of organization for service-type businesses. c. enjoys an unlimited life. d. has limited liability. Which of the following is not an advantage of the corporate form of business organization? a. Limited liability of stockholders b. Transferability of ownership c. Unlimited personal liability for stockholders d. Unlimited life A small neighborhood barber shop that is operated by its owner would likely be organized as a a. joint venture. b. partnership. c. corporation. d. proprietorship. Joan and Sara met at law school and decide to start a small law practice after graduation. They agree to split revenues and expenses evenly. The most common form of business organization for a business such as this would be a a. joint venture. b. partnership. c. corporation. d. proprietorship. 75. 76. 77. 78. 79. 80. 1 - 12 81. Test Bank for Accounting Principles, Eighth Edition Which of the following is true regarding the corporate form of business organization? a. Corporations are the most prevalent form of business organization. b. Corporate businesses are generally smaller in size than partnerships and proprietorships. c. The revenues of corporations are greater than the combined revenues of partnerships and proprietorships. d. Corporations are separate legal entities organized exclusively under federal law. A basic assumption of accounting that requires activities of an entity be kept separate from the activities of its owner is referred to as the a. stand alone concept. b. monetary unit assumption. c. corporate form of ownership. d. economic entity assumption. Deb Smith is the proprietor (owner) of Smitty's, a retailer of athletic apparel. When recording the financial transactions of Smitty's, Deb does not record an entry for a car she purchased for personal use. Deb took out a personal loan to pay for the car. What accounting concept guides Deb's behavior in this situation? a. Pay back concept b. Economic entity assumption c. Cash basis concept d. Monetary unit assumption A basic assumption of accounting assumes that the dollar is a. unrelated to business transactions. b. a poor measure of economic activities. c. the common unit of measure for all business transactions. d. useless in measuring an economic event. The assumption that the unit of measure remains sufficiently constant over time is part of the a. economic entity assumption. b. cost principle. c. historical cost principle. d. monetary unit assumption. A business that enjoys limited liability is a a. proprietorship. b. partnership. c. corporation. d. sole proprietorship. A problem with the monetary unit assumption is that a. the dollar has not been stable over time. b. the dollar has been stable over time. c. the dollar is a common medium of exchange. d. it is impossible to account for international transactions. 82. 83. 84. 85. 86. 87. Accounting in Action 88. The common characteristic possessed by all assets is a. long life. b. great monetary value. c. tangible nature. d. future economic benefit. Owner's equity is best depicted by the following: a. Assets = Liabilities. b. Liabilities + Assets. c. Residual equity + Assets. d. Assets – Liabilities. The basic accounting equation may be expressed as a. Assets = Equities. b. Assets – Liabilities = Owner's Equity. c. Assets = Liabilities + Owner's Equity. d. all of these. Liabilities a. are future economic benefits. b. are existing debts and obligations. c. possess service potential. d. are things of value used by the business in its operation. Liabilities of a company would not include a. notes payable. b. accounts payable. c. wages payable. d. cash. Liabilities of a company are owed to a. debtors. b. benefactors. c. creditors. d. underwriters. Owner's equity can be described as a. creditorship claim on total assets. b. ownership claim on total assets. c. benefactor's claim on total assets. d. debtor claim on total assets. Owner's equity is often referred to as a. residual equity. b. leftovers. c. spoils. d. second equity. 1 - 13 89. 90. 91. 92. 93. 94. 95. 1 - 14 96. Test Bank for Accounting Principles, Eighth Edition When an owner withdraws cash or other assets from a business for personal use, these withdrawals are termed a. depletions. b. consumptions. c. drawings. d. a credit line. Capital is a. an owner's permanent investment in the business. b. equal to liabilities minus owner's equity. c. equal to assets minus owner's equity. d. equal to liabilities plus drawings. Revenues would not result from a. sale of merchandise. b. initial investment of cash by owner. c. performance of services. d. rental of property. Sources of increases to owner's equity are a. additional investments by owners. b. purchases of merchandise. c. withdrawals by the owner. d. expenses. The basic accounting equation cannot be restated as a. Assets – Liabilities = Owner's Equity. b. Assets – Owner's Equity = Liabilities. c. Owner's Equity + Liabilities = Assets. d. Assets + Liabilities = Owner's Equity. Owner's equity is decreased by all of the following except a. owner's investments. b. owner's withdrawals. c. expenses. d. owner's drawings. A net loss will result during a time period when a. liabilities exceed assets. b. drawings exceed investments. c. expenses exceed revenues. d. revenues exceed expenses. If total liabilities increased by $15,000 and owner’s equity increased by $5,000 during a period of time, then total assets must change by what amount and direction during that same period? a. $20,000 decrease b. $20,000 increase c. $25,000 increase d. $30,000 increase 97. 98. 99. 100. 101. 102. 103. Accounting in Action 104. 1 - 15 If total liabilities decreased by $15,000 and owner’s equity increased by $5,000 during a period of time, then total assets must change by what amount and direction during that same period? a. $20,000 increase b. $10,000 decrease c. $10,000 increase d. $15,000 decrease If total liabilities decreased by $25,000 and owner’s equity increased by $5,000 during a period of time, then total assets must change by what amount and direction during that same period? a. $20,000 decrease b. $20,000 increase c. $25,000 increase d. $30,000 increase If total liabilities decreased by $15,000 and owner’s equity decreased by $5,000 during a period of time, then total assets must change by what amount and direction during that same period? a. $20,000 increase b. $10,000 increase c. $20,000 decrease d. $10,000 decrease If total liabilities increased by $14,000 during a period of time and owner’s equity decreased by $6,000 during the same period, then the amount and direction (increase or decrease) of the period’s change in total assets is a(n) a. $14,000 increase. b. $20,000 increase. c. $8,000 decrease. d. $8,000 increase. The accounting equation for Goodboys Enterprises is as follows: Assets Liabilities Owner’s Equity $120,000 = $60,000 + $60,000 If Goodboys purchases office equipment on account for $12,000, the accounting equation will change to Assets Liabilties Owner’s Equity a. $120,000 = $60,000 + $60,000 b. $132,000 = $60,000 + $72,000 c. $132,000 = $66,000 + $66,000 d. $132,000 = $72,000 + $60,000 105. 106. 107. 108. 109. As of June 30, 2008, Houston Company has assets of $100,000 and owner’s equity of $5,000. What are the liabilities for Houston Company as of June 30, 2008? a. $85,000 b. $90,000 c. $95,000 d. $100,000 1 - 16 110. Test Bank for Accounting Principles, Eighth Edition Owner's equity is increased by a. drawings. b. revenues. c. expenses. d. liabilities. Owner's equity is decreased by a. assets. b. revenues. c. expenses. d. liabilities. If total liabilities increased by $4,000, then a. assets must have decreased by $4,000. b. owner's equity must have increased by $4,000. c. assets must have increased by $4,000, or owner's equity must have decreased by $4,000. d. assets and owner's equity each increased by $2,000. Collection of a $500 Accounts Receivable a. increases an asset $500; decreases an asset $500. b. increases an asset $500; decreases a liability $500. c. decreases a liability $500; increases owner's equity $500. d. decreases an asset $500; decreases a liability $500. Revenues are a. the cost of assets consumed during the period. b. gross increases in owner's equity resulting from business activities. c. the cost of services used during the period. d. actual or expected cash outflows. If an individual asset is increased, then a. there must be an equal decrease in a specific liability. b. there must be an equal decrease in owner's equity. c. there must be an equal decrease in another asset. d. none of these is possible. If services are rendered for credit, then a. assets will decrease. b. liabilities will increase. c. owner's equity will increase. d. liabilities will decrease. If expenses are paid in cash, then a. assets will increase. b. liabilities will decrease. c. owner's equity will increase. d. assets will decrease. 111. 112. 113. 114. 115. 116. 117. Accounting in Action 118. If an owner makes a withdrawal of cash from a proprietorship, then a. there has been a violation of accounting principles. b. owner's equity will increase. c. owner's equity will decrease. d. there will be a new liability showing the owner owes money to the business. If supplies that have been purchased are used in the course of business, then a. a liability will increase. b. an asset will increase. c. owner's equity will decrease. d. owner's equity will increase. 1 - 17 119. 120. As of December 31, 2008, Anders Company has assets of $35,000 and owner's equity of $20,000. What are the liabilities for Anders Company as of December 31, 2008? a. $15,000 b. $10,000 c. $25,000 d. $20,000 Which of the following events is not a business transaction? a. Investment of cash by the owner b. Hired employees c. Incurred utility expenses for the month d. Earned revenue for services provided Net income results when a. Assets > Liabilities. b. Revenues = Expenses. c. Revenues > Expenses. d. Revenues < Expenses. Owner's capital at the end of the period is equal to a. owner's capital at the beginning of the period plus net income minus liabilities. b. owner's capital at the beginning of the period plus net income minus drawings. c. net income. d. assets plus liabilities. A balance sheet shows a. revenues, liabilities, and owner's equity. b. expenses, drawings, and owner's equity. c. revenues, expenses, and drawings. d. assets, liabilities, and owner's equity. An income statement a. summarizes the changes in owner's equity for a specific period of time. b. reports the changes in assets, liabilities, and owner's equity over a period of time. c. reports the assets, liabilities, and owner's equity at a specific date. d. presents the revenues and expenses for a specific period of time. 121. 122. 123. 124. 125. 1 - 18 126. Test Bank for Accounting Principles, Eighth Edition If the owner's equity account increases from the beginning of the year to the end of the year, then a. net income is less than owner drawings. b. a net loss is less than owner drawings. c. additional owner investments are less than net losses. d. net income is greater than owner drawings. Use the following information for questions 127–129. Jimmy's Car Repair Shop started the year with total assets of $270,000 and total liabilities of $180,000. During the year, the business recorded $450,000 in car repair revenues, $255,000 in expenses, and Jimmy withdrew $45,000. 127. Jimmy's Capital balance at the end of the year was a. $240,000. b. $225,000. c. $285,000. d. $195,000. The net income reported by Jimmy's Car Repair Shop for the year was a. $150,000. b. $195,000. c. $90,000. d. $405,000. Jimmy's Capital balance changed by what amount from the beginning of the year to the end of the year? a. $45,000 b. $195,000 c. $90,000 d. $150,000 The balance sheet is frequently referred to as a. an operating statement. b. the statement of financial position. c. the statement of cash flows. d. the statement of owner's equity. The primary purpose of the statement of cash flows is to report a. a company's investing transactions. b. a company's financing transactions. c. information about cash receipts and cash payments of a company. d. the net increase or decrease in cash. All of the financial statements are for a period of time except the a. income statement. b. owner's equity statement. c. balance sheet. d. statement of cash flows. 128. 129. 130. 131. 132. Accounting in Action 133. The ending owner's equity amount is shown on a. the balance sheet only. b. the owner's equity statement only. c. both the income statement and the owner's equity statement. d. both the balance sheet and the owner's equity statement. 1 - 19 134. Benson Company began the year with owner’s equity of $175,000. During the year, the company recorded revenues of $250,000, expenses of $190,000, and had owner drawings of $20,000. What was Benson’s owner’s equity at the end of the year? a. $255,000 b. $215,000 c. $405,000 d. $235,000 Ed Dexter began the Dexter Company by investing $20,000 of cash in the business. The company recorded revenues of $185,000, expenses of $160,000, and had owner drawings of $10,000. What was Dexter’s net income for the year? a. $15,000 b. $35,000 c. $25,000 d. $45,000 Jenner Company began the year with owner’s equity of $15,000. During the year, Jenner received additional owner investments of $21,000, recorded expenses of $60,000, and had owner drawings of $4,000. If Jenner’s ending owner’s equity was $46,000, what was the company’s revenue for the year? a. $70,000 b. $74,000 c. $91,000 d. $95,000 Janzen Company began the year with owner’s equity of $217,000. During the year, Janzen received additional owner investments of $294,000, recorded expenses of $840,000, and had owner drawings of $56,000. If Janzen’s ending owner’s equity was $531,000, what was the company’s revenue for the year? a. $860,000 b. $916,000 c. $1,154,000 d. $1,210,000 135. 136. 137. Use the following information for questions 138-139. Benny’s Repair Shop started the year with total assets of $100,000 and total liabilities of $80,000. During the year, the business recorded $210,000 in revenues, $110,000 in expenses, and owner drawings of $20,000. 138. Owner’s equity at the end of the year was a. $120,000. b. $100,000. c. $80,000. d. $90,000. 1 - 20 139. Test Bank for Accounting Principles, Eighth Edition The net income reported by Benny’s Repair Shop for the year was a. $80,000. b. $100,000. c. $60,000. d. $190,000. Use the following information for questions 140–141. Berwick Company compiled the following financial information as of December 31, 2008: Revenues Berwick, Capital (1/1/08) Equipment Expenses Cash Berwick, Drawings Supplies Accounts payable Accounts receivable 140. $140,000 105,000 40,000 125,000 35,000 10,000 5,000 20,000 15,000 Berwick’s assets on December 31, 2008 are a. $235,000. b. $170,000. c. $80,000. d $95,000. Berwick’s owner’s equity on December 31, 2008 is a. $105,000. b. $110,000. c. $80,000. d. $120,000. Ironton Company’s owner’s equity at the beginning of August 2008 was $300,000. During the month, the company earned net income of $60,000 and owner’s drawings were $20,000. At the end of August 2008, what is the balance in owner’s equity? a. $260,000 b. $300,000 c. $340,000 d. $380,000 On January 1, 2008, Jackson Company reported owner’s equity of $470,000. During the year, the owner withdrew cash of $20,000. At December 31, 2008, the balance in owner’s equity was $500,000. What amount of net income or net loss would the company report for 2008? a. Net income of $30,000 b. Net loss of $50,000 c. Net income of $10,000 d. Net income of $50,000 141. 142. 143. Accounting in Action Use the following information for questions 144–146. 1 - 21 Jenkins Catering started the year with total assets of $20,000 and total liabilities of $5,000. During the year, the business recorded $16,000 in catering revenues and $8,000 in expenses. Jenkins made an additional investment of $3,000 and withdrew cash of $5,000 during the year. 144. The owner’s equity at the end of the year was a. $21,000. b. $18,000. c. $8,000. d. $2,000. The net income reported by Jenkins Catering for the year was a. $16,000. b. $11,000. c. $8,000. d. $3,000. Owner’s equity changed by what amount from the beginning of the year to the end of the year? a. $15,000 b. $14,000 c. $6,000 d. $3,000 During the year 2008, Toronto Enterprises earned revenues of $45,000, had expenses of $25,000, purchased assets with a cost of $5,000 and had owner drawings of $3,000. Net income for the year is a. $45,000. b. $20,000. c. $17,000. d. $15,000. At October 1, Bennington Enterprises reported owner’s equity of $35,000. During October, no additional investments were made and the company earned net income of $4,000. If owner’s equity at October 31 totals $32,000, what amount of owner drawings were made during the month? a. $0 b. $1,000 c. $3,000 d. $7,000 At October 1, Bennington Enterprises reported owner’s equity of $35,000. During October, no additional investments were made and the company posted a net loss of $3,000. If owner’s equity at October 31 totals $32,000, what amount of owner drawings were made during the month? a. $0 b. $1,000 c. $3,000 d. $7,000 145. 146. 147. 148. 149. 1 - 22 150. Test Bank for Accounting Principles, Eighth Edition At October 1, Bennington Enterprises reported owner’s equity of $35,000. During October, the owner made additional investments of $2,000 and the company earned net income of $6,000. If owner’s equity at October 31 totals $40,000, what amount of owner drawings were made during the month? a. $0 b. $3,000 c. $4,000 d. $5,000 At October 1, Bennington Enterprises reported owner’s equity of $35,000. During October, the owner made additional investments of $5,000 and the company posted a net loss of $3,000. If owner’s equity at October 31 totals $35,000, what amount of owner drawings were made during the month? a. $0 b. $2,000 c. $3,000 d. $5,000 151. Additional Multiple Choice Questions 152. Which of the following is not part of the accounting process? a. Recording b. Identifying c. Financial decision making d. Communicating The first part of the accounting process is a. communicating. b. identifying. c. processing. d. recording. Keeping a systematic, chronological diary of events that are measured in dollars and cents is called a. communicating. b. identifying. c. processing. d. recording. Auditing is a. the examination of financial statements by a CPA in order to express an opinion on their fairness. b. a part of accounting that involves only recording of economic events. c. an area of accounting that involves such activities as cost accounting, budgeting, and accounting information systems. d. conducted by the Securities and Exchange Commission to ensure that registered financial statements are presented fairly. 153. 154. 155. Accounting in Action 156. Internal users of accounting information include all of the following except a. company officers. b. investors. c. marketing managers. d. production supervisors. 1 - 23 157. The organization(s) primarily responsible for establishing generally accepted accounting principles is(are) the a. b. c. d. FASB no yes no yes SEC no no yes yes 158. The primary accounting standard-setting body in the United States is the a. Financial Accounting Standards Board. b. International Accounting Standards Board. c. Internal Revenue Service. d. Securities and Exchange Commission. A proprietorship is a business a. owned by one person. b. owned by two or more persons. c. organized as a separate legal entity under state corporation law. d. owned by a governmental agency. A net loss will result during a time period when a. assets exceed liabilities. b. assets exceed owner's equity. c. expenses exceed revenues. d. revenues exceed expenses. The Ryder’s Uptown Grill received a bill of $400 from the Erml Advertising Agency. The owner, John Ryder, is postponing payment of the bill until a later date. The effect on specific items in the basic accounting equation is a. a decrease in Cash and an increase in Accounts Payable. b. a decrease in Cash and an increase in J. Ryder, Capital. c. an increase in Accounts Payable and a decrease in J. Ryder, Capital. d. a decrease in Accounts Payable and an increase in J. Ryder, Capital. James Company purchases $600 of equipment from Mundelein Inc. for cash. The effect on the components of the basic accounting equation of James Company is a. an increase in assets and liabilities. b. a decrease in assets and liabilities. c. no change in total assets. d. an increase in assets and a decrease in liabilities. 159. 160. 161. 162. 1 - 24 163. Test Bank for Accounting Principles, Eighth Edition Morreale Beaver Company buys a $12,000 van on credit. The transaction will affect the a. income statement only. b. balance sheet only. c. income statement and owner's equity statement only. d. income statement, owner's equity statement, and balance sheet. Answers to Multiple Choice Questions Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. Item Ans. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. a 55. a 56. a 57. a 58. c b c a a c c b d b c a d c a c c c 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. 73. 74. 75. 76. c c c c d b b d a c c b b a d b d c 77. 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94. b c d b c d b c d c a d d d b d c b 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 108. 109. 110. 111. 112. a c a b a d a c b b a c d d c b c c 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. 123. 124. 125. 126. 127. 128. 129. 130. a b c c d c c a b c b d d d a b d b 131. 132. 133. 134. 135. 136. 137. 138. 139. 140. 141. 142. 143. 144. 145. 146. 147. 148. c c d b c b b b b d b c d a c c b d 149. 150. 151. 152. 153. 154. 155. 156. 157. 158. 159. 160. 161. 162. 163. a b b c b d a b d a a c c c b BRIEF EXERCISES BE 164 Match the following external users of financial accounting information with the type of decision that user will make with the information. a. b. c. d _______ _______ _______ _______ Creditor Investor Regulatory Agency Internal Revenue Service (1) Is the company operating within prescribed guidelines? (2) Is the company complying with tax laws? (3) Is the company able to pay its debts? (4) Is the company a good investment? Accounting in Action Solution 164 1. 2. 3. 4. c d a b (3 min.) 1 - 25 BE 165 Match the following terms and definitions. a. Accounts receivable b. Creditor _______ (1) Amounts due from customers _______ (2) Amounts owed to suppliers for goods and services purchased _______ (3) Amounts owed to bank _______ (4) Party to whom money is owed c. Accounts payable d. Note payable Solution 165 1. 2. 3. 4. a c d b (3 min.) BE 166 Indicate which of these items is an asset (A), liability (L) or owner’s equity (OE) account. _______ _______ _______ _______ (1) _______ Supplies (2) Klein, Drawing (3) Building (4) Note Payable (5) Taxes Payable Solution 166 1. 2. 3. 4. 5. (3 min.) Assets (A) Owner’s equity (OE) Asset (A) Liability (L) Liability (L) 1 - 26 BE 167 Test Bank for Accounting Principles, Eighth Edition Use the accounting equation to answer the following questions. 1. West Wind Sails Co. has total assets of $120,000 and total liabilities of $35,000. What is owner’s equity? 2. Mercy Family Center has total assets of $225,000 and owner’s equity of $105,000. What are total liabilities? 3. Cucina Med Restaurant has total liabilities of $40,000 and owner’s equity of $95,000. What are total assets? Solution 167 (5 min.) 1. $120,000 – $35,000 = $85,000 owner’s equity 2. $225,000 – $105,000 = $120,000 total liabilities 3. $40,000 + $95,000 = $135,000 total assets BE 168 Determine the missing items. Assets = Liabilities + Owner’s Equity $75,000 (b) $84,000 $52,000 $28,000 (c) (a) $34,000 $55,000 Solution 168 a. $23,000 b. $62,000 c. $29,000 (5 min.) BE 169 Classify each of these items as an asset (A), liability (L), or owner’s equity (OE). _____ 1. Accounts receivable _____ 2. Accounts payable _____ 3. Bonds, Capital _____ 4. Office supplies _____ 5. Utilities expense _____ 6. Cash _____ 7. Note payable _____ 8. Equipment Accounting in Action Solution 169 1. 2. 3. 4. A L OE A (5 min.) 5. 6. 7. 8. OE A L A 1 - 27 BE 170 Identify the impact on the accounting equation of each of the following transactions. 1. Purchase office supplies on account. 2. Paid secretary weekly salary. 3. Purchased office furniture for cash. 4. Received monthly utility bill to be paid at later time. Solution 170 1. 2. 3. 4. (5 min.) Increase assets and increase liabilities. Decrease assets and decrease owner’s equity. Increase assets and decrease assets. Increase liabilities and decrease owner’s equity. BE 171 Balance sheet amounts as of December 31, 2008 for Lesley’s Tutoring Service are listed below. Prepare a balance sheet in good form. Accounts Payable Accounts Receivable Cash Lesley, Capital $ 200 1,000 500 ? Solution 171 (5 min.) LESLEY’s TUTORING SERVICE Balance Sheet December 31, 2008 Assets Cash Accounts Receivable Total assets $ 500 1,000 $1,500 Liabilities and Owner’s Equity Accounts Payable Lesley, Capital Total liabilities and Owner’s equity $ 200 1,300 $1,500 1 - 28 BE 172 Test Bank for Accounting Principles, Eighth Edition Identify whether the following items would be reported on the income statement (IS) or balance sheet (BS). 1. 2. 3. 4. 5. Cash Service Revenue Notes Payable Interest Expense Accounts Receivable Solution 172 1. 2. 3. 4. 5. (3 min.) Balance Sheet (BS) Income Statement (IS) Balance Sheet (BS) Income Statement (IS) Balance Sheet (BS) BE 173 Use the following information to calculate for the year ended December 31, 2008 (a) net income (net loss), (b) ending owner’s equity, and (c) total assets. Supplies Operating expenses Accounts payable Accounts receivable Beginning Capital $ 1,000 12,000 9,000 3,000 5,000 Revenues Cash Drawings Notes payable Equipment $23,000 15,000 1,000 1,000 6,000 Solution 173 (a) $11,000 (5 min.) (b) $3,000 (c) $25,000 BE 174 Listed below in alphabetical order are the balance sheet items of Mowen Company at December 31, 2008. Prepare a balance sheet and include a complete heading. Accounts payable Accounts receivable Building Cash Mowen, Capital Office equipment $ 6,000 15,000 96,000 11,000 121,000 5,000 Accounting in Action Solution 174 (5 min.) MOWEN COMPANY Balance Sheet December 31, 2008 ASSETS Cash Accounts receivable Office equipment Building Total assets LIABILITIES AND OWNER’S EQUITY Liabilities Accounts payable Owner’s equity Mowen, Capital Total liabilities and owner’s equity $ 1 - 29 $ 11,000 15,000 5,000 96,000 $127,000 6,000 121,000 $127,000 EXERCISES Ex. 175 Below is a list of important abbreviations widely used in business. For each abbreviation give the full designation. 1. 2. 3. 4. 5. 6. CPA IRS FBI FASB GAAP SEC _____________________________________________ _____________________________________________ _____________________________________________ _____________________________________________ _____________________________________________ _____________________________________________ 1 - 30 Test Bank for Accounting Principles, Eighth Edition (5 min.) Solution 175 1. 2. 3. 4. 5. 6. Certified Public Accountant Internal Revenue Service Federal Bureau of Investigation Financial Accounting Standards Board Generally Accepted Accounting Principles Securities and Exchange Commission Ex. 176 Determine the missing amount for each of the following. Assets = Liabilities + Owner's Equity 1. (a) $50,000 $95,000 2. $125,000 (b) $85,000 3. $140,000 $65,000 (c) Solution 176 (5 min.) 1. (a) = $145,000 ($50,000 + $95,000) 2. (b) = $40,000 ($125,000 - $85,000) 3. (c) = $75,000 ($140,000 - $65,000) Ex. 177 For the items listed below, fill in the appropriate code letter to indicate whether the item is an asset, liability, or owner's equity item. Code Asset A Liability L Owner's Equity OE _____ 1. Rent Expense _____ 2. Office Equipment _____ 3. Accounts Payable _____ 4. Dan Pine, Capital _____ 5. Insurance Expense _____ _____ _____ _____ 6. Cash 7. Accounts Receivable 8. Dan Pine, Drawing 9. Service Revenue _____ 10. Notes Payable Solution 177 1. 2. 3. 4. 5. OE A L OE OE (5 min.) 6. 7. 8. 9. 10. A A OE OE L Accounting in Action Ex. 178 1 - 31 At the beginning of the year, Yates Company had total assets of $550,000 and total liabilities of $200,000. Answer the following questions viewing each situation as being independent of the others. (1) If total assets increased $200,000 during the year, and total liabilities decreased $75,000, what is the amount of owner's equity at the end of the year? (2) During the year, total liabilities increased $230,000 and owner's equity decreased $90,000. What is the amount of total assets at the end of the year? (3) If total assets decreased $40,000 and owner's equity increased $130,000 during the year, what is the amount of total liabilities at the end of the year? Solution 178 Beginning Change Ending (5 min.) Total Assets $550,000 200,000 $750,000 Total Assets $550,000 $690,000 (2) Total Assets $550,000 (40,000) $510,000 = Total Liabilities $200,000 (75,000) $125,000 Total Liabilities $200,000 230,000 $430,000 Total Liabilities $200,000 = $ 30,000 (3) + Owner's Equity – = $625,000 (1) Owner's Equity $350,000 (90,000) $260,000 Owner's Equity $350,000 130,000 $480,000 Beginning Change Ending + Beginning Change Ending Ex. 179 Jimmy's Carpet Cleaning has the following balance sheet items: Van Accounts Payable Cash Cleaning Supplies Accounts Receivable Identify which items are Notes Payable J. Fine, Capital J. Fine, Drawing Equipment (1) Assets (2) Liabilities (3) Owner's Equity Solution 179 (5 min.) (1) Assets—Van, Cash, Cleaning Supplies, Accounts Receivable, Equipment (2) Liabilities—Accounts Payable, Notes Payable (3) Owner's Equity— J. Fine, Capital, J. Fine, Drawing 1 - 32 Ex. 180 Test Bank for Accounting Principles, Eighth Edition On June 1, 2008, Gore Company prepared a balance sheet that shows the following: Assets (no cash)................................................................ $100,000 Liabilities............................................................................ 70,000 Owner's Equity................................................................... 30,000 Shortly thereafter, all of the assets were sold for cash. How would the balance sheet appear immediately after the sale of the assets for cash for each of the following cases? Cash Received for the Assets Cash A Cash B Cash C $110,000 100,000 90,000 Balances Immediately After Sale Assets – Liabilities = Owner's Equity $________ ________ ________ $________ ________ ________ $________ ________ ________ Solution 180 (5 min.) Balances Immediately After Sale Assets – Liabilities = Owner's Equity $110,000 $70,000 $40,000 100,000 70,000 30,000 90,000 70,000 20,000 Cash A Cash B Cash C Cash Received for the Assets $110,000 100,000 90,000 Ex. 181 At the beginning of 2008, Clemens Company had total assets of $550,000 and total liabilities of $330,000. Answer each of the following questions. 1. If total assets increased $60,000 and owner's equity decreased $90,000 during the year, determine the amount of total liabilities at the end of the year. 2. During the year, total liabilities decreased $75,000 and owner's equity increased $50,000. Compute the amount of total assets at the end of the year. 3. If total assets decreased $100,000 and total liabilities increased $55,000 during the year, determine the amount of owner's equity at the end of the year. Solution 181 (5 min.) 1. Ending Total Liabilities = ($550,000 + $60,000) – ($550,000 – $330,000 - $90,000) = $610,000 – $130,000 = $480,000 2. Ending Total Assets = ($330,000 – $75,000) + ($550,000 – $330,000 + $50,000) = $255,000 + $270,000 = $525,000 3. Ending Owner's Equity = ($550,000 – $100,000) – ($330,000 + $55,000) = $450,000 – $385,000 = $65,000 Accounting in Action Ex. 182 Compute the missing amount in each category of the accounting equation. (a) (b) (c) Assets $349,000 $223,000 $? Liabilities $? $ 79,000 $253,000 Owner's Equity $143,000 $? $325,000 1 - 33 Solution 182 (5 min.) (a) $206,000 ($349,000 – $143,000 = $206,000). (b) $144,000 ($223,000 – $79,000 = $144,000). (c) $578,000 ($253,000 + $325,000 = $578,000). Ex. 183 From the following list of selected accounts taken from the records of Grayson Clinic, identify those that would appear on the balance sheet. a. b. c. d. e. Meg Grayson, Capital Patient Revenue Land Wages Expense Notes Payable f. g. h. i. j. Accounts Payable Cash Rent Expense Medical Supplies Utilities Expense Solution 183 a, c, e, f, g, i (5 min.) Ex. 184 For each of the following, indicate whether the transaction affects revenue (R), expense (E), owner's drawing (D), owner's investment (I), or no effect on owner's equity (NOE). 1. 2. 3. 4. 5. Made an investment to start the business. Billed customers for services performed. Purchased equipment on account. Paid monthly rent. Withdrew cash for personal use. Solution 184 1. 2. 3. 4. 5. (5 min.) Investment (I) Revenue (R) No effect (NOE) Expense (E) Drawing (D) 1 - 34 Ex. 185 Test Bank for Accounting Principles, Eighth Edition Presented below is a balance sheet for Jim Dixon Lawn Service at December 31, 2008. JIM DIXON LAWN SERVICE Balance Sheet December 31, 2008 Assets Cash Accounts receivable Supplies Equipment Total assets $13,000 6,000 9,000 11,000 $39,000 Liabilities and Owner's Equity Liabilities Accounts payable Notes payable Owner's equity Jim Dixon, Capital Total liabilities & owner’s equity $ 8,000 15,000 16,000 $39,000 The following additional data are available for the year which began on January 1: All expenses (excluding supplies expense) total $6,000. Supplies on January 1, were $11,000 and $5,000 of supplies were purchased during the year. Net income for the year was $8,000 and drawings were $6,000. Instructions Determine the following: (Show all computations.) 1. Supplies used during the year. 2. Total expenses for the year. 3. Service revenues for the year. 4. Jim Dixon's capital balance on January 1. Solution 185 (10 min.) $11,000 5,000 (9,000) $ 7,000 1. Computation of Supplies Used: Beginning Supplies, Jan. 1 Add: Purchases Less: Ending Supplies, Dec. 31 Equals: Supplies Used 2. Computation of Total Expenses: All Expenses (excluding supplies expense) Plus: Supplies Used Total Expenses 3. Computation of Revenues: Net Income Plus: Total Expenses Total Revenues 4. Computation of Dixon, Capital on January 1: Capital, December 31 Plus: Drawings Less: Net Income Capital, January 1 $ 6,000 7,000 $13,000 $ 8,000 13,000 $21,000 $16,000 6,000 (8,000) $14,000 Accounting in Action Ex. 186 1 - 35 Analyze the transactions of a business organized as a proprietorship described below and indicate their effect on the basic accounting equation. Use a plus sign (+) to indicate an increase and a minus sign (–) to indicate a decrease. Assets 1. Received cash for services rendered. 2. Purchased office equipment on credit. 3. Paid employees' salaries. _______ _______ _______ = Liabilities ______ ______ ______ ______ ______ ______ ______ ______ ______ ______ + Owner's Equity _______ _______ _______ _______ _______ _______ _______ _______ _______ _______ 4. Received cash from customer in payment on account. _______ 5. Paid telephone bill for the month. 6. Paid for office equipment purchased in transaction 2. 7. Purchased office supplies on credit. 8. Owner withdrew cash for personal expenses. 9. Obtained a loan from the bank. 10. Billed customers for services rendered. _______ _______ _______ _______ _______ _______ Solution 186 (10 min.) Assets = Liabilities + Owner's Equity + + – 1. Received cash for services rendered. 2. Purchased office equipment on credit. 3. Paid employees' salaries. 4. Received cash from customer in payment on account. 5. Paid telephone bill for the month. 6. Paid for office equipment purchased in transaction 2. 7. Purchased office supplies on credit. 8. Owner withdrew cash for personal expenses. 9. Obtained a loan from the bank. 10. Billed customers for services rendered. + + – +,– – – + – + + + – + – – + 1 - 36 Ex. 187 Test Bank for Accounting Principles, Eighth Edition For each of the following, indicate whether the transaction increased (+), decreased (-), or had no effect (NE) on assets, liabilities, and owner's equity using the following format. Assets = Liabilities + Owner's Equity 1. 2. 3. 4. 5. Made an investment to start the business. Billed customers for services performed. Purchased equipment on account. Withdrew cash for personal use. Paid for equipment purchased in 3. above. Solution 187 Assets 1. 2. 3. 4. 5. + + + – – (5 min.) = Liabilities NE NE + NE – + Owner's Equity + + NE – NE Ex. 188 Ron Benes decides to open a cleaning and laundry service near the local college campus that will operate as a sole proprietorship. Analyze the following transactions for the month of June in terms of their effect on the basic accounting equation. Record each transaction by increasing (+) or decreasing (–) the dollar amount of each item affected. Indicate the new balance of each item after a transaction is recorded. It is not necessary to identify the cause of changes in owner's equity. Transactions (1) Ron Benes invests $20,000 in cash to start a cleaning and laundry business on June 1. (2) Purchased laundry equipment for $5,000 paying $3,000 in cash and the remainder due in 30 days. (3) Purchased laundry supplies for $1,200 cash. (4) Received a bill from Campus News for $300 for advertising in the campus newspaper. (5) Cash receipts from customers for cleaning and laundry amounted to $1,500. (6) Paid salaries of $200 to student workers. (7) Billed the Tiger Football Team $200 for cleaning and laundry services. (8) Paid $300 to Campus News for advertising that was previously billed in Transaction 4. (9) Ron Benes withdrew $900 from the business for living expenses. (10) Incurred utility expenses for month on account, $400. Accounting in Action Ex. 188 (cont.) 1 - 37 TransAccounts Laundry Laundry Accounts R. Benes action Cash + Receivable + Supplies + Equipment = Payable + Capital (1) —————————————————————————————————————————— Balance (2) —————————————————————————————————————————— Balance (3) —————————————————————————————————————————— Balance (4) —————————————————————————————————————————— Balance (5) —————————————————————————————————————————— Balance (6) —————————————————————————————————————————— Balance (7) —————————————————————————————————————————— Balance (8) —————————————————————————————————————————— Balance (9) —————————————————————————————————————————— Balance (10) —————————————————————————————————————————— Totals Solution 188 (20 min.) TransAccounts Laundry Laundry Accounts R. Benes action Cash + Receivable + Supplies + Equipment = Payable + Capital (1) +$20,000 +$20,000 —————————————————————————————————————————— Balance $20,000 $20,000 (2) – 3,000 +$5,000 +$2,000 —————————————————————————————————————————— Balance $17,000 $5,000 $2,000 $20,000 (3) – 1,200 +$1,200 —————————————————————————————————————————— Balance $15,800 $1,200 $5,000 $2,000 $20,000 (4) + 300 – 300 1 - 38 Test Bank for Accounting Principles, Eighth Edition (cont.) Solution 188 TransAccounts Laundry Laundry Accounts R. Benes action Cash + Receivable + Supplies + Equipment = Payable + Capital —————————————————————————————————————————— Balance $15,800 $1,200 $5,000 $2,300 $19,700 (5) + 1,500 + 1,500 —————————————————————————————————————————— Balance $17,300 $1,200 $5,000 $2,300 $21,200 (6) – 200 – 200 —————————————————————————————————————————— Balance $17,100 $1,200 $5,000 $2,300 $21,000 (7) +$200 + 200 —————————————————————————————————————————— Balance $17,100 $200 $1,200 $5,000 $2,300 $21,200 (8) – 300 – 300 —————————————————————————————————————————— Balance $16,800 $200 $1,200 $5,000 $2,000 $21,200 (9) – 900 – 900 —————————————————————————————————————————— Balance $15,900 $200 $1,200 $5,000 $2,000 $20,300 (10) + 400 – 400 —————————————————————————————————————————— Totals $15,900 $200 $1,200 $5,000 $2,400 $19,900 Ex. 189 For each of the following, describe a transaction that will have the stated effect on the elements of the accounting equation. (a) Increase one asset and decrease another asset. (b) Increase an asset and increase a liability. (c) Decrease an asset and decrease a liability. (d) Increase an asset and increase owner's equity. (e) Increase one asset, decrease one asset, and increase a liability. Solution 189 (5 min.) (a) Receive cash from customers on account. Purchase supplies for cash. (b) Purchase supplies on account. Purchase equipment and signed a note payable. (c) Pay cash to reduce accounts payable. Pay cash to reduce a note payable. (d) Initial contribution by an owner. Additional contributions by an owner. Render services on account. (e) Buy equipment with a cash down payment with the remainder financed by a note payable. Accounting in Action Ex. 190 1 - 39 The following transactions represent part of the activities of Lyon Company for the first month of its existence. Indicate the effect of each transaction upon the total assets of the business by one of the following phrases: increased total assets, decreased total assets, or no change in total assets. (a) The owner invested cash to start the business. (b) Purchased a computer for cash. (c) Purchased office equipment with money borrowed from the bank. (d) Paid the first month's utility bill. (e) Collected an accounts receivable. (f) Owner withdrew cash from the business. Solution 190 (a) (b) (c) (d) (e) (f) (5 min.) Increased total assets. No change in total assets. Increased total assets. Decreased total assets. No change in total assets. Decreased total assets. Ex. 191 Selected transactions for Barden Company are listed below. List the number of the transaction and then describe the effect of each transaction on assets, liabilities, and owner's equity. Sample: Made initial cash investment in the business. The answer would be—Increase in assets and increase in owner's equity. 1. 2. 3. 4. 5. 6. 7. 8. 9. Paid monthly utility bill. Purchased new display case for cash. Paid cash for repair work on security system. Billed customers for services performed. Received cash from customers billed in 4. Withdrew cash for owner's personal use. Incurred advertising expenses on account. Paid monthly rent. Received cash from customers when service was rendered. Solution 191 1. 2. 3. 4. 5. 6. 7. 8. 9. (5 min.) Decrease in assets and decrease in owner's equity. No net change in assets. Decrease in assets and decrease in owner's equity. Increase in assets and increase in owner's equity. No net change in assets. Decrease in assets and decrease in owner's equity. Increase in liabilities and decrease in owner's equity. Decrease in assets and decrease in owner's equity. Increase in assets and increase in owner's equity. 1 - 40 Ex. 192 Test Bank for Accounting Principles, Eighth Edition A service proprietorship shows five transactions summarized below. The effect of each transaction on the accounting equation is shown, and also the new balance of each item in the equation. For each transaction (a) to (e) write an explanation of the nature of the transaction. Accounts EquipAccounts Cash + Rec. + ment + Land + Building = Payable + Capital —————————————————————————————————————————— $5,000 $6,500 $10,000 $7,500 $50,000 $3,000 $76,000 a) –2,000 –2,000 3,000 6,500 10,000 7,500 50,000 1,000 76,000 – 1,000 b) +1,000 4,000 5,500 10,000 7,500 50,000 1,000 76,000 c) + 5,000 +5,000 4,000 5,500 15,000 7,500 50,000 6,000 76,000 d) +2,500 + 2,500 6,500 5,500 15,000 7,500 50,000 6,000 78,500 e) +3,000 + 3,000 $6,500 $8,500 $15,000 $7,500 $50,000 $6,000 $81,500 Solution 192 (a) (b) (c) (d) (e) (5 min.) Paid cash to creditors. Received cash from customers on account. Bought equipment on account. Additional investment by owner or services rendered to customers for cash. Services rendered on account. Ex. 193 There are ten transactions listed below. Match the transactions that have the identical effect on the accounting equation. You should end up with 5 matches. a. b. c. d. e. f. g. h. i. j. Receive cash from customers on account. Initial cash contribution by an owner. Pay cash to reduce an accounts payable. Purchase supplies for cash. Pay cash to reduce a notes payable. Purchase supplies on account. Additional cash contribution by an owner. Purchase equipment with a note payable. Pay utilities with cash. Owner withdraws money from the business for personal use. Accounting in Action Solution 193 Match #1 #2 #3 #4 #5 = = = = = (10 min.) a, d c, e f, h b, g i, j 1 - 41 Ex. 194 Prepare an income statement, an owner's equity statement, and a balance sheet for the dental practice of Ted Terner, DDS, from the items listed below for the month of September. Ted Terner, Capital, September 1 Accounts payable Equipment Service revenue Ted Terner, Drawings Dental supplies expense Cash Utilities expense Dental supplies Salaries expense Accounts receivable Rent expense $42,000 7,000 30,000 25,000 6,000 3,500 6,000 700 2,800 9,000 14,000 2,000 TED TERNER, DDS Income Statement For the Month Ended September 30, 2008 —————————————————————————————————————————— Revenues $ Expenses Total expenses $ $ $ Net income $ TED TERNER, DDS Owner's Equity Statement For the Month Ended September 30, 2008 —————————————————————————————————————————— Ted Terner, Capital, September 1 $ Add: $ Less: $ 1 - 42 Ex. 194 Test Bank for Accounting Principles, Eighth Edition (cont.) TED TERNER, DDS Balance Sheet September 30, 2008 —————————————————————————————————————————— Assets $ Total assets $ Liabilities and Owner's Equity Liabilities $ Owner's Equity Total liabilities and owner's equity $ $ Solution 194 (15 min.) TED TERNER, DDS Income Statement For the Month Ended September 30, 2008 —————————————————————————————————————————— Revenues Service revenue .............................................................................. $25,000 Expenses Salaries expense............................................................................. $9,000 Dental supplies expense ................................................................. 3,500 Rent expense .................................................................................. 2,000 Utilities expense .............................................................................. 700 Total expenses .......................................................................... 15,200 Net income ................................................................................ $ 9,800 TED TERNER, DDS Owner's Equity Statement For the Month Ended September 30, 2008 Ted Terner, Capital, September 1......................................................... Add: Net income.................................................................................... Less: Drawings...................................................................................... Ted Terner, Capital, September 30....................................................... $42,000 9,800 51,800 6,000 $45,800 Accounting in Action Solution 194 (cont.) 1 - 43 TED TERNER, DDS Balance Sheet September 30, 2008 —————————————————————————————————————————— Assets Cash....................................................................................................... $ 6,000 Accounts receivable............................................................................... 14,000 Dental supplies ...................................................................................... 2,800 Equipment.............................................................................................. 30,000 Total assets...................................................................................... $52,800 Liabilities and Owner's Equity Liabilities Accounts payable............................................................................. Owner's Equity Ted Terner, Capital .......................................................................... Total liabilities and owner's equity.................................................... $ 7,000 45,800 $52,800 Ex. 195 Indicate whether the following items would appear on the balance sheet (BS), income statement (IS), or owner's equity statement (OE). 1. 2. 3. 4. 5. 6. Advertising expense Accounts receivable Jones, drawing Rent revenue Salaries payable Supplies Solution 195 (5 min.) 4. Income statement (IS) 5. Balance sheet (BS) 6. Balance sheet (BS) 1. Income statement (IS) 2. Balance sheet (BS) 3. Owner's equity statement (OE) Ex. 196 Listed below in alphabetical order are the balance sheet items of Hoyle Company at December 31, 2008. Prepare a balance sheet and include a complete heading. Accounts Payable Accounts Receivable Building Cash Joe Hoyle, Capital Land Office Equipment $ 14,000 15,000 46,000 17,000 120,000 52,000 4,000 1 - 44 Test Bank for Accounting Principles, Eighth Edition (5 min.) HOYLE COMPANY Balance Sheet December 31, 2008 ASSETS Solution 196 Cash Accounts receivable Office equipment Building Land Total assets LIABILITIES Accounts payable OWNER'S EQUITY Joe Hoyle, Capital Total liabilities and owner's equity $ 17,000 15,000 4,000 46,000 52,000 $134,000 $ 14,000 120,000 $134,000 Ex. 197 One item is omitted in each of the following summaries of balance sheet and income statement data for three different sole proprietorships, X, Y, and Z. Determine the amounts of the missing items, identifying each proprietorship by letter. Proprietorship X Y Z Beginning of the Year: Assets $380,000 $150,000 $199,000 Liabilities 250,000 105,000 168,000 End of the Year: Assets 450,000 185,000 195,000 Liabilities 280,000 95,000 169,000 During the Year: Additional Investment by the owner ? 79,000 80,000 Withdrawals by the owner Revenue Expenses 90,000 195,000 170,000 83,000 ? 113,000 ? 187,000 175,000 Solution 197 (10 min.) $130,000 105,000 25,000 260,000 90,000 $170,000 Proprietorship X ($105,000) Beginning Capital balance ($380,000 – $250,000) Additional investments ($260,000 – $130,000 – $25,000) Net income for year ($195,000 – $170,000) Less withdrawals Ending Capital balance ($450,000 – $280,000) Accounting in Action Solution 197 (cont.) $ 45,000 79,000 49,000 173,000 83,000 $ 90,000 1 - 45 Proprietorship Y ($162,000) Beginning Capital balance ($150,000 – $105,000) Additional investments Net income for year [Revenues = $162,000 ($113,000 + $49,000)] Less withdrawals Ending Capital balance ($185,000 – $95,000) Proprietorship Z ($97,000) Beginning Capital balance ($199,000 – $168,000) Additional investments Net income for year ($187,000 – $175,000) Less withdrawals ($123,000 – $26,000) Ending Capital balance ($195,000 – $169,000) $ 31,000 80,000 12,000 123,000 97,000 $ 26,000 Ex. 198 Indicate in the space provided by each item whether it would appear on the Income Statement (IS), Balance Sheet (BS), or Owner's Equity Statement (OE): a. ____ b. ____ c. ____ Service Revenue Utilities Expense Cash Accounts Payable Office Supplies Wage Expense g. h. i. j. k. l. ____ Accounts Receivable ____ Gray, Capital (ending) ____ Equipment ____ Advertising Expense ____ Gray, Drawing ____ Notes Payable d. ____ e. ____ f. ____ Solution 198 a. IS b. IS c. BS d. BS e. BS f. IS (5 min.) g. h. i. j. k. l. BS OE, BS BS IS OE BS 1 - 46 Ex. 199 Test Bank for Accounting Principles, Eighth Edition Don Harder was reviewing his business activities at the end of the year (2008) and decided to prepare an Owner's Equity Statement. At the beginning of the year his assets were $500,000 and his liabilities were $200,000. At the end of the year the assets had grown to $950,000 but liabilities had also increased to $350,000. The net income for the year was $420,000. Don had withdrawn $120,000 during the year for his personal use. Prepare an Owner's Equity Statement in good form. Solution 199 (5 min.) DON HARDER Owner's Equity Statement For the Year Ended 2008 D. Harder, Beginning Capital Add: Net Income Less: Drawings D. Harder, Ending Capital $300,000 420,000 720,000 120,000 $600,000 Ex. 200 At September 1, the balance sheet accounts for Debbie’s Restaurant were as follows: Accounts Payable Accounts Receivable Building Cash Furniture $ 3,800 1,600 68,000 10,000 18,700 Land Debbie, Capital Notes Payable Supplies $33,000 ? 48,000 6,600 The following transactions occurred during the next two days: Debbie invested an additional $22,000 cash in the business. The accounts payable were paid in full. (No payment was made on the notes payable.) Instructions Prepare a balance sheet at September 3, 2008. Accounting in Action Solution 200 (10 min.) DEBBIE'S RESTAURANT Balance Sheet September 3, 2008 ASSETS Cash Accounts receivable Supplies Furniture Building Land Total assets LIABILITIES Accounts payable Notes payable OWNER'S EQUITY Debbie, Capital Total liabilities and owner's equity Cash ($10,000 + $22,000 – $3,800) = $28,200 Accounts Payable ($3,800 – $3,800) = $0 Debbie, Capital: Beginning balance ($137,900 – $51,800) Additional investment Ending balance $ 1 - 47 $ 28,200 1,600 6,600 18,700 68,000 33,000 $156,100 -048,000 108,100 $156,100 $ 86,100 22,000 $108,100 Ex. 201 Presented below are balance sheet items for Higgins Company at December 31, 2008. Accounts payable Accounts receivable Cash Equipment Higgins, capital Notes payable Compute each of the following: 1. Total assets. 2. Total liabilities. $35,000 36,000 27,000 52,000 30,000 50,000 Solution 201 (5 min.) 1. Total assets = $115,000 ($36,000 + $27,000 + $52,000) 2. Total liabilities = $85,000 ($35,000 + $50,000) 1 - 48 Test Bank for Accounting Principles, Eighth Edition COMPLETION STATEMENTS 202. Accounting is an information system that identifies, _____________, and _____________ the economic events of an organization. The mere recording of economic events is called ______________, and is just one part of the _______________ process. The three major services rendered by a certified public accountant are ______________, ________________, and management ________________. Accountants who are employees of business enterprises are referred to as ________________ accountants. A common set of standards that provides guidelines to accountants and indicates how to report economic events is called _________________. The ________________ principle states that assets should be recorded at the value exchanged at the time the asset is acquired. The _________________ assumption requires that the activities of an entity be kept separate from the activities of its owner. The residual claim on total assets of a business is known as ________________ and is equal to total assets minus total liabilities. Drawings ________________ owner's equity but are not expenses. The ________________ reports the assets, liabilities, and owner's equity of a business enterprise at a specific date. 203. 204. 205. 206. 207. 208. 209. 210. 211. Answers to Completion Statements 202. 203. 204. 205. 206. records, communicates bookkeeping, accounting auditing, taxation, consulting private (or managerial) generally accepted accounting principles 207. 208. 209. 210. 211. cost economic entity owner's equity reduce balance sheet Accounting in Action 1 - 49 MATCHING 212. Match the items below by entering the appropriate code letter in the space provided. A. B. C. D. E. ____ ____ ____ ____ ____ ____ ____ ____ ____ CPA Budgeting SEC Proprietorship Economic Entity Assumption F. G. H. I. J. Corporation Assets Equities Expenses Transaction 1. Activities of an entity must be kept separate from its owner’s activities. 2. Consumed assets or services. 3. Ownership is limited to one person. 4. Offers expert accounting service to the general public. 5. Creditor and ownership claims against the assets of the business. 6. A separate legal entity under state laws. 7. Government agency that can mandate accounting rules. 8. Quantifying goals and objectives. 9. Future economic benefits. ____ 10. Economic events recorded by accountants. Answers to Matching 1. 2. 3. 4. 5. E I D A H 6. 7. 8. 9. 10. F C B G J 1 - 50 Test Bank for Accounting Principles, Eighth Edition SHORT-ANSWER ESSAY QUESTIONS S-A E 213 The accounting profession provides many career opportunities for individuals. Identify the major fields that exist in accounting and comment on the major functions performed by individuals in each of these areas. Solution 213 The major fields that exist in accounting are in the areas of (1) public accounting, (2) private accounting, and (3) not-for-profit accounting. In public accounting, an accountant may practice as: (1) an auditor who examines the financial statements of companies and expresses an opinion as to the fairness of presentation; (2) a tax specialist who gives tax advice, prepares tax returns, and represents clients before governmental agencies; and (3) a management accountant who engages in the development of accounting and computer systems and the design of organizational systems. Private (managerial) accountants perform many different activities within a company. Private accountants may be involved in: cost accounting, budgeting, general financial accounting, accounting information systems, and tax accounting. S-A E 214 The framework used to record and summarize the economic activities of a business enterprise is referred to as the accounting equation. State the basic accounting equation and define its major components. How are business transactions and financial statements related to the accounting equation? Solution 214 The basic accounting equation is expressed as follows: Assets = Liabilities + Owner's Equity Assets are defined as resources owned by the business. Liabilities are creditorship claims against the assets of the business; or simply put, liabilities are existing debts and obligations. Owner's equity is the ownership claim on the total assets of the business; it is equal to total assets minus total liabilities. Business transactions are economic events and activities that affect the elements of the basic accounting equation; that is, transactions cause increases or decreases in the assets, liabilities, and owner's equity. The financial statements report the results and effects of transactions on the business' assets, liabilities, and owner's equity. The balance sheet is a summary expression of the basic accounting equation. Accounting in Action S-A E 215 Your friend, James, made this comment: My major is biology and I plan to research for cures for major illnesses. Thus, I have no need to study accounting. What is your response to James? 1 - 51 Solution 215 James, you are entering a dynamic profession and you have the opportunity to make important contributions to society. While science will be your profession and major concern, you will not be able to escape the need to understand accounting. Accounting staff and professionals will always be available to assist you. Here are some areas that will directly affect you: As a manager, you will need to review accounting information (both internal and external) and make decisions. Budgets will be an important part of your research activities. As an employee, you will be concerned about the financial information of your employer. Thus, you will need to be able to read the company’s financial statements. Also, as an investor, you will be interested in the financial statements of other companies. You will probably not be a preparer of the financial statements, but you do need an understanding of how they are prepared. You also need a good understanding of how to interpret the information on the financial statements. S-A E 216 The information needs of a specific user of financial accounting information depends upon the kinds of decisions that user makes. Identify the major users of accounting information and discuss what questions financial accounting information answers for each group of users. Solution 216 The major users of accounting information are internal users and external users. Internal users are those who manage the business. External users are those outside the business who have either a present or potential financial interest. Financial accounting information may answer the following questions for internal users: 1. Is cash sufficient to pay our debts? 2. Can we afford to give employee pay raises this year? 3. What is the cost of manufacturing each unit of product? 4. Which product line is the most profitable? Questions answered by financial accounting information for external users include: 1. Is the company earning satisfactory income? 2. How does the company compare in size and profitability with competitors? 3. Will the company be able to pay its debts as they come due? 1 - 52 Test Bank for Accounting Principles, Eighth Edition (Ethics) S-A E 217 Sam Dryer owns and operates Sam's Burgers, a small fast food store, located at the edge of City College campus in Newton, Ohio. After several very profitable years, Sam's Burgers began to have problems. Most of the problems were related to Sam's expansion of the eating area in the restaurant without corresponding increases in the food preparation area. Sam does not have the cash or financial backing to expand further. He has therefore decided to sell his business. Jerry Finney is interested in purchasing the business. However, he is located in another city and is unfamiliar with Newton. He has asked Sam why he is selling Sam's Burgers. Sam replies that his elderly mother requires extra care, and that his brother needs help in his manufacturing business. Both are true, but neither is his primary reason for selling. Sam reasons that Jerry should not have asked him anyway, since profitable businesses don't come up for sale. Required: 1. Identify the stakeholders in this situation. 2. Did Sam act ethically in not revealing fully his reasons for selling the business? Why or why not? Solution 217 1. The stakeholders include Sam Dryer Jerry Finney Newton, Ohio students of City College City College persons financing the purchase of Sam's Burgers 2. Sam did not act ethically in not revealing fully his reasons for selling the business. Students might be of the opinion that a purchaser should investigate a business before purchasing it, rather than relying entirely on the seller's assertions. However, students should realize that Sam should have said something about his problems. He might ethically be allowed to put these in the best possible light, perhaps, but failure to disclose them at all is certainly unethical. This is especially true, since family concerns might well cause someone to sell a business that is otherwise doing well. Sam has shown an intent to deceive that is unethical, and might be actionable in court as well. S-A E 218 (Communication) Sue Havens is a friend of yours from high school. She decided to become a beautician after leaving high school, rather than to attend college. She recently opened her own shop, and has contracted her services to a local hospital. She is paid a monthly fee for her services, and receives a small gratuity from each of the patients. She has just received her first set of financial statements from her accountant. She is quite upset. The statements show a cash balance of $3,600 at the end of the month, but a net income of only $500. She has written you a letter, asking you whether such a situation is possible, or whether she should find another accountant. Accounting in Action S-A E 218 (cont.) 1 - 53 Required: Write a short letter to your friend. Use proper form. Answer her question completely, but briefly. Solution 218 Answers will vary. The instructor's requirements concerning proper form should be followed. The letter may be either business or personal. As a minimum, the letter should be in a recognizable form, and proper grammar and spelling should be used. Neat erasures and corrections might be allowed. A suggested personal letter follows: 1245 Lily Lane Buena Vista, AR 77661 (Date) Dear Sue, Congratulations on opening your business! I am sure you will do well, combining your creative genius with your talent for serving others. You asked about your financial statements. Of course, you realize that I am just an accounting student, but I do know that it is possible to have a large cash balance and little net income. You may have had expenses that were not paid in cash yet. These expenses reduce your income, but not your cash. I think that you should discuss the statements with the accountant who prepared them. He or she will be in the best position to explain the results. Thanks for the question. It really made me think. Sincerely, (signature)

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Abu Dhabi University - ACCOUNTING - 1234
A PPENDIX CTIME VALUE OF MONEYSUMMARY OF QUESTIONS BY STUDY OBJECTIVES AND BLOOMS TAXONOMYItem 1. 2. 11. 12. 13. 14. 15. 16. 17. 18. 48. 49. 50. 62. SO 1 1 2 2 2 2 2 3 3 3 3 3 3 1 BT K K K C C AP AP AP AP C AP AP AP K Item 3. 4. 19. 20. 21. 22. 23. 24.
UCLA - LS - ls 4
1/5/10 50% 40% 30% 20% 10% 0%In this imaginary graph, red are batting averages for baseball players using a wooden bat, green are for players using a metal bat. Would you recommend that a new player use a wood or metal bat. 1. Wood 2. Metal 3. Dont know
UCLA - LS 4 - ls 4
Chromosomes - rst reported 1882 (after Mendel) # chromosomes/nucleus in a species is constant. human, 46; corn, 10; fruit y, 8 2 pairs of arms - members of a pair are equal in size longitudinal - 2 identical units, called chromatidsIn the fruit y8 chrom
UCLA - LS 4 - ls 4
Drosophila melanogaster Short life cycle - 12 days Many progeny Easy to grow in laboratoriesCalvin Bridges, an undergraduate dishwasher, discovered a white-eyed fly (normal flies have red eyes) in one of the fly bottles he was about to washKaryotypesca
UCLA - LS 4 - ls 4
1/13/10Sex Determination 1. Sex chromosomes humans; silkworms - presence of Y chromosome Drosophila; nematodes - X to autosome ratio 2. Ploidy (in bees, males are haploid, females diploid) 3. Environment - Bonellia; a sea worm. Larvae are sexually undiff
UCLA - LS 4 - ls 4
1/18/10Hemophilia X-linked disease1. 2. 3. 4.X-linked traits appear more frequently in males. Mutation and trait never pass from father to son. Affected male always passes mutation to daughters, who serve as carriers who pass the trait to 1/2 of their
UCLA - LS 4 - ls 4
1/20/10Hypothesis. You have two plants that are both heterozygous for a single gene displaying a simple dominant/recessive relationship. To test this hypothesis you cross the two plants together and count progeny. Imagine 4 different outcomes, which expe
UCLA - LS 4 - ls 4
1/25/10Tet resistance Auxotroph revertant Bacteriophage resistancePetri dish 5 bacteria 12 hours107 bacteria12 hours107 bacteria12 hoursE. Coli (107 tets and 7 tetr)Media + tet11/25/10107 bacteriaarg- E. coliComplete mediaMinimal media107 b
UCLA - LS 4 - ls 4
1/27/1011/27/10Hfr met+ thi+ pur+ strs X F- met- thi- pur- strr Interrupted matings indicate that met enters the recipient last. Plate progeny on media to select for met+ recombinants. What media would you plate the mated bacteria on? 1. minimal + meth
UCLA - LS 4 - ls 4
2/1/10ra- X rb- 94% large 6% small1Host Range Mutants h+ (wild type) can grow on E. colis but not on E. colir. h can grow on both E. colis and E. colir.212/1/10Recombination in phage +- +r h Xr hPhenotype Clear and small Cloudy and large Cloudy a
UCLA - LS 4 - ls 4
2/3/10Lwoff concludes that; 1. lysogenic bacteria contain a noninfective structure, the prophage. 2. the prophage can turn into an infective phage and that no new phage particle is required for this. 3. In a small percentage of lysogenic bacteria, the pr
UCLA - LS 4 - ls 4
2/8/10AI J KBCDEFGHWhich rII deletion can recombine with which rII point mutation to give WT? Which rII deletion can recombine with which rII deletion to give WT?123456 789+ + +The 5 deletion mutations are used to map a point mutation.A
UCLA - LS 4 - ls 4
2/10/10Fig. 8.3DNARNAPROTEINTRANSCRIPTION RNA differs from DNA: 1. Single stranded 2. Ribose sugar 3. U instead of a TAGGCTAGCTAG TCCGATCGATCAGGCUAGCUAGTranscription goes 5 to 3.3 MAJOR TYPES OF RNA. 1. mRNA: code for protein 2. rRNA: ribosomes 3
UCLA - LS 4 - ls 4
2/14/10UUAUGUCUACUUUAGUUCCUCAUCGUGGGGCAUAGUAC MetSerThrLeuValProHisArgGlyAlaSTOP Missense Mutation UUAUGUCUACUUUAGUUACUCAUCGUGGGGCAUAGUAC MetSerThrLeuValThrHisArgGlyAlaSTOP UUAUGUCUACUUUAGUUCCUCAUCGUCGGGCAUAGUAC MetSerThrLeuValProHisArgArgAlaSTOP Nonsens
UCLA - LS 4 - ls 4
2/17/10IPTG: -galactoside isopropyl-d-thiogalactosideCan bind to Lac repressor =&gt; can induce lac operon Can not be cleaved by -galactosidase =&gt; constant concentration of inducer Commonly used inducer in the lab.-gal Protein Bacterial Protein12/17/10
UCLA - LS 4 - ls 4
Restric(on/Modica(on100%100%K12(P1) 0.002%K12100%K12(P1)encodesenzymesthatmethylateDNAandcutnon methylatedDNA. HOSTCONTROLLEDRESTRICTIONMODIFICATIONOF.CH3cytosine5methylcytosineRestriction EndonucleasesOver 200 restriction enzymes have been iso
UCLA - LS 4 - ls 4
MstII site is CCTNAGGprobeIn this case, the RFLP does not cause the D mutation, but is linked to the D locus.Hemophilia - X-linked diseaseWhat are the genotypes of the family members?Hemophilia - X-linked diseaseH YH hH -H Yh YH -7 kb 5 kbSou
UCLA - LS 4 - ls 4
REVERSE GENETICSTRANSGENIC MICEGrowth Hormone- made in small amounts in specialized cells located in the anterior pituitary gland. The following constructs were injected: metallothionein promoter-rat growth hormone. M.P. RGH protein rat growth hormone p
UCLA - LS 4 - ls 4
MN blood group frequencies MM MN NN Total 119 76 13 208 p(M) = [(119 + 119 + 76]/ 2 x 208 = .755 q(N) = [(13 + 13 + 76]/2 x 208 = .245 If in HWE expect: MM p2 (.755)2 x (208) = 118.6 MN 2pq 2(.755)(.245) x (208) = 76.9 NN q2 (.245)2 x (208) = 12.5X-linke
UCLA - LS 4 - ls 4
91Fig. 9.17CopyrightTheMcGrawHillCompanies, Inc.Permissionrequiredtoreproduceor displayFig. 9.1792CopyrightTheMcGrawHillCompanies, Inc.Permissionrequiredtoreproduceor displayAutomatedDNAsequencing Fig. 9.18 a93CopyrightTheMcGrawHillCompanies, Inc
UCLA - LS 4 - ls 4
CancerCancerDeaths Es-matednumberofnewcancercasesanddeathsintheUnitedStatesin1997.Cancer: A cell growth disorder resulting from an alteration in genes (mutations) that lead to deregulated (transformed) cell growth. CANCER IS A GENETIC DISEASE Transform
UCLA - LS 4 - ls 4
1 Question 1. Note that the female is the heterogametic sex.22. PedigreeThe following pedigree concerns a very rare human disorder that causes premature puberty in males.1 24567891011121314151617Which mode(s) of inheritance can explain
UCLA - LS 4 - ls 4
1LS 4 Example Midterm 1 questions INTRODUCTORY GENETICS21. Mitosis/MeiosisWe consider an organism with three pairs of chromosomes: the sex chromosomes X and Y, and the pairs of autosomal chromosomes 1 and 2. The female is the heterogametic sex. The st
UCLA - LS 4 - ls 4
Name_LS 4 INTRODUCTORY GENETICS MIDTERM II practice problemsName_ 1 The following cross is done in the Pea plant. P F1 AAbb x AAbb AaBbThese F1 progeny are then testcrossed as follows: AaBb x aabb The A and B alleles are dominant and the a and b allele
UCLA - LS 4 - ls 4
Name_LS 4 INTRODUCTORY GENETICS MIDTERM II practice problemsName_ 1 The following cross is done in the Pea plant. P F1 AAbb x AAbb AaBbThese F1 progeny are then testcrossed as follows: AaBb x aabb The A and B alleles are dominant and the a and b allele
UCLA - LS 4 - ls 4
Q. 1Correct answers in bold . coli ( wild type) . coli ( ts cI) . coli ( ts cII) . coli ( ts N) . coli ( ts cro) . coli ( ts cI, ts cII) . coli ( ts cI, ts N) . coli ( ts cII; ts N) grow at 40C lyse at 40C grow at 40C grow at 40C grow at 40C lyse at 40C
UCLA - LS 4 - ls 4
NAMELS 4 INTRODUCTORY GENETICS MIDTERM III Practice ProblemsNAMEQ. 1 (14 points)Below are listed E. coli strains that are lysogenic for bacteriophage . Each strain has a prophage that contains a ts mutation (or two ts mutations). All strains of E. col
U. Houston - CHEE - 2331
CHEE 2331 Chemical Processes Energy and Energy Balances Chapter 7, pages 313-333Department of Chemical and Biomolecular Engineering EngineeringWhat is energy?The ability to do workEnergy units (F-L)Mechanical Metric Engineering S.I. erg ft-lbf J Ther
U. Houston - BIOL - 1362
1QuestionsonCH1720ToBeCoveredDuringLectureorinExam2Review1. Carryoutthefollowingtranscriptionandtranslationproblem: 2. 3. 4. Puttheeventsthatentaileukaryotictranscriptionandtranslationinchronologicalorder: A)PremRNAisprocessedandspecificsequencesareremo
U. Houston - BIOL - 1362
1B ? 1ASamespeciesordifferentspecies?2A ? 2BSpeciationPopulationof aspeciesMicroevolutionary ForcesPopulationevolves; adaptation Howdo SpeciesForm? Speciation(processofaspeciessplittinginto2more species)bridgesmicroevolutionwithmacroevolution. Bio
U. Houston - BIOL - 1362
Microevolution Microevolution: heritablegeneticchangesthatoccurina population. Naturalselectionactsonindividuals,butpopulationsarethesmallest unitsthatcanevolve. Instudyingmicroevolution,oneanalyzesvariationinnatural populations&amp;determineshow/whytheseva
U. Houston - BIOL - 1362
Onymacris unguicularis, the head standing beetle Namibia Atlantic ocean 1of350,000beetlespecies Hastypicalbeetletraits:pairofwings;6legs;hardexterior Possessesitsownuniquebehavior Priorexample illustratesthefeaturesofalllife:sharedtraits; variation;feat
U. Houston - BIOL - 1362
AnswerstoQuestionsonCH2226ToBeCoveredDuringLectureorinExam3Review1. DuringdroughtyearsontheGalapagos,small,easilyeatenseedsbecomerare,leavingmostlylarge,hard casedseedsthatonlybirdswithlargebeakscaneat.Ifadroughtpersistsforseveralyears,whatshould oneexpe
U. Houston - BIOL - 1362
AnswerstoLectureQuestionsfromWeekof12510 I.Whataretheproductsofmitosis? 1. Howmanycellsareproducedattheendofasinglemitoticdivision? Twocellsareproducedattheendofasinglemitoticdivision. 2. Howmanydifferentkindsofcellsareproducedattheendofasinglemitoticdiv
U. Houston - BIOL - 1362
PhylogenyAsnakeorlizardspecies? Understandingofevolutionaryrelationships(phylogeny)allows onetocomparetraitsofrelated speciestoanswersuchquestions. Constructingphylogeniesoccurs viasystematics classifying organisms&amp;determining evolutionaryrelationships.
U. Houston - BIOL - 1362
BIOTECHNOLOGY PROBLEM1Using the following mammalian DNA sequence and the restriction enzyme, Taq I, find the restriction sites and indicate where the cuts occur. Taq I : 5 T*CGA 3 3 A GC*T 5ABCDECT*CGATTAT*CGAACCTTCAT*CGATT*CGAGCCTTCG GAGC*TAATAGC
U. Houston - BIOL - 1362
AnswerstoLectureQuestionsfrom22210&amp;22410Lectures(QuestionnumbersbelowmatchthoseintheVNETdocument, 1362CH1720Questionstobecoveredduringlecture)1. Carryoutthefollowingtranscriptionandtranslationproblem: 4. E.coliisculturedonagrowthmediumcontainingbotht
U. Houston - BIOL - 1362
Protein Synthesis WorksheetDetermine the amino acid sequence for a polypeptide coded for by the following mRNA transcript:3-T A G G C T A C G G A C T G A A A T T C A T C T T A G A A A T - 5 5-A U C C G A U G C C U G A C U U U A A G U A G A A U C U U U A
U. Houston - BIOL - 1362
AnswerstoRemainingQuestionsfromdocumentQuestionsonCH1720ToBe CoveredDuringLecture 14. Ifaresearcherwaslookingtoclonethegeneforaspecificliverenzyme,itwouldbemostefficient andlogicaltofirstsearchin: A. alivercellandpickitoutwithapairoftweezers. B. ahumanli
U. Houston - BIOL - 1362
1)OnecaninferfromtheCentralDogma,thatdifferentRNAmoleculesarenecessaryinordertosynthesizeDNA fromasequenceofaminoacids(i.e.,protein). A)True B)False Answer:B 2)Inagene,thepresenceofapromoterisrequired A)fortranscriptiontooccur. B)fortranslationtooccur. C)
U. Houston - BIOL - 1362
MboI (2 sites) *GATCThe MboI enzyme will not cut at the ends even though the *GATC is present at both ends. The MboI enzyme cannot properly bind when the target sequence is at these locations. I would not expect you to know this and I would not give you
U. Houston - BIOL - 1362
AnswerstoLectureQuestionsfrom3310Lecture(QuestionnumbersbelowmatchthoseintheVNETdocument, 1362CH1720Questionstobecoveredduringlecture)10. AfterthetransformationstepinaDNAcloningexperiment,oneusuallyfirstscreensforcloneswith antibioticresistance.Whatdoes
U. Houston - BIOL - 1362
1Answer Key: Replication, Transcription, Translation WorksheetExercise A. DNA structure You were given this DNA sequence: 3 TACGGCATT 5; the complete double stranded sequence would look like this (use complimentary base pairing, remember to label ends c
U. Houston - BIOL - 1362
EXAM 1 REVIEW (CH 12 16; Sadava Text: CH 9-11) ALSO: Be familiar with Key Terms for CH 12-16 and go over document titled CH 12-16 Questions to Think About CHAPTER 12 (The Cell Cycle) 1) Cell division &amp; its roles in different organisms; Prokaryote v. Eukar
U. Houston - BIOL - 1362
U. Houston - BIOL - 1362
U. Houston - BIOL - 1362
BASIC QUESTIONS: GENE EXPRESSIONAnswers are not posted to questions 1-19. This is intended more as a study tool; as you review your notes, write out the answers to these questions below. 1. How does information flow in a cell ? 2. What contribution did B
U. Houston - BIOL - 1362
U. Houston - BIOL - 1362
BIOTECHNOLOGY PROBLEM1Using the following mammalian DNA sequence and the restriction enzyme, Taq I, find the restriction sites and indicate where the cuts occur. Taq I : 5 T*CGA 3 3 A GC*T 55 3 CT CGATTATCGAACCTTCAT CGATTCGAGCCTTCG GAGCTAATAGCTTGGAAGTA
U. Houston - BIOL - 1362
U. Houston - BIOL - 1362
1 Assume that a bacterial plasmid carries the gene for resistance to the antibiotic kanamycin. Using the restriction enzyme A, you open the plasmid and insert a segment of a biologically important gene isolated from a mouse. The gene was excised from the
U. Houston - BIOL - 1362
ProkaryoticGenes&amp;RegulationReCapRegulatory genePromoterOperatorABCRepressorproteinBindstooperatorblocking transcription.Proteins(enzymes)of pathwayOperon:Type Functionofgenes inoperon RepressorActive (notranscription) RepressorInactive (transcr
U. Houston - BIOL - 1362
PagestoReadforBiology,Campbell&amp;Reece,8thedition:CH2226 Note:makesuretoviewanyfigures&amp;tablesreferencedinthetext. CH22(Darwin&amp;Modification) o Readpages450466 CH23(EvolutionofPopulations) o Readpages468484 CH24(OriginofSpecies) o Readpages487501;willnotcove
U. Houston - BIOL - 1362
PagestoReadfor Life,TheScienceofBiology,Sadava,etal,8thedition:CH2123&amp;25 Note:makesuretoviewanyfigures&amp;tablesreferencedinthetext. CH21(HistoryofLifeonEarth) o Readpp.465467(materialonfossils) CH22(MechanismsofEvolution) o Readpp.486504;recallgenes&amp;enviro
U. Houston - BIOL - 1362
1362Exam1Distribution&amp;Curve300 250 200 150 100 50 0 &lt;30 30to 40to 50to 60to 70to 80to 90to 100+ 49 79 39 59 69 89 99AVG=69MED =70 &gt;86.45=A &gt;74.49=B &gt;62.52=C &gt;50.56=D
U. Houston - BIOL - 1362
The following is an exam given in 2006; it is intended to be an example of the type &amp; style of questions given on an exam. Using this as your primary study material for the Spring 2009 exam 1 would be a mistake. BIOL 1362 Exam 1 from Spring 2006 CH 11 1.
U. Houston - BIOL - 1362
Key Terms: CH 22 26 (Sadava text: CH 21-23 &amp; 25) Evolution Natural theology Scala naturae Theory of Use &amp; Dis-use Adaptation Population Species Artificial selection Decent with modification Natural selection Differential reproductive success Heritable var
U. Houston - BIOL - 1362
Name _Mitosis and MeiosisBefore you begin, save this Lab Report Template on your computer as LastNameAPBIOMitosis For this lab you will need to access the Mitosis Virtual Microscope (http:/www.jdenuno.com/PDFfiles/Mitosis.pdf) and the Meiosis Virtual Mi
U. Houston - BIOL - 1362
1Population Genetics 1. What are the genotypic frequencies in a population composed of the following 312 AA, 361 Aa, 242 aa individuals? Total # of individuals in population = 312 + 361 + 242 = 915 Frequency of AA = 312/915 = 0.34 Frequency of Aa = 361/9
U. Houston - BIOL - 1362
1 UNIT THREE: GENETICS C hapter Chapter Sixteen: The Molecular Basis of Inheritance (Text from Biology, 6th Edition, by Campbell and Reece)The Molecular Basis of Inheritance (Chapter Sixteen)DNA AS THE GENETIC MATERIAL The The Search for the Genetic Mat
U. Houston - BIOL - 1362
1 UNIT THREE: GENETICS Chapter Fifteen: The Chromosomal Basis of Inheritance C hapter (Text from Biology, 6th Edition, by Campbell and Reece)The Chromosomal Basis of Inheritance (Chapter Fifteen)RELATING MENDELISM TO CHROMOSOMES Mendelian Mendelian Inhe