Register now to access 7 million high quality study materials (What's Course Hero?) Course Hero is the premier provider of high quality online educational resources. With millions of study documents, online tutors, digital flashcards and free courseware, Course Hero is helping students learn more efficiently and effectively. Whether you're interested in exploring new subjects or mastering key topics for your next exam, Course Hero has the tools you need to achieve your goals.
1 Page
Bio FINAL notes
Course: BIOL 1201, Fall 2010School: LSU
Rating:
Document Preview
Systems Control in Plants - Types of Plant Hormones - Examples of Hormone Function T ypes of Plant Hormones - Auxins: stem elongation, differentiation, dominance apical - Cytokinins: cell division, germination - Gibberellins: seed, bud, fruit development; plant elongation
Unformatted Document Excerpt
Coursehero >> Louisiana >> LSU >> BIOL 1201Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Systems Control in Plants - Types of Plant Hormones - Examples of Hormone Function T ypes of Plant Hormones - Auxins: stem elongation, differentiation, dominance apical - Cytokinins: cell division, germination - Gibberellins: seed, bud, fruit development; plant elongation
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more.
Course Hero has millions of course specific materials providing students with the best way to expand
their education.
Below is a small sample set of documents:
Below is a small sample set of documents:
LSU - BIOL - 1201
Biology 1201 - Test 1 Dr. Wischusen What is Science? h A body of knowledge i An approach to understanding nature * What do Scientists do? h Make observations i Attempt to discern patterns i Assume that the future is like the past Scientific Method Observa
LSU - BIOL - 1201
Biology Test 2 September 21, 2004 Other Movement into a cell -Vesicle-mediated transport -endocytosis -exocytosis *Not moving through a membrane* What difference does this make if it is moved through a membrane or not? -The material is not freely roaming
LSU - BIOL - 1201
BIOS NotesI. Chapter 1 a. What is Science? i. A body of knowledge, which helps us to understand nature. b. What do scientists do? i. Make observations ii. Attempt to discern patterns (which leads to a prediction) iii. Assume its like past (match in gas w
LSU - BIOL - 1201
Cell is the minimum organization of living matter CELL MEMBRANE MODELS (plasma membrane): - All cells have a thin outer covering - Plasma membrane or cell membrane - Early models inferred the structure from chemical and permeability properties of the memb
LSU - BIOL - 1201
CELL: minimum organization of living matter; smallest unit capable of independent living existence A) B) important unifying generalization in biology! multicellular species built from these common building blocksPROCARYOTIC VERSUS EUCARYOTIC Structures a
LSU - BIOL - 1201
Energy Transformations: 1. Cellular respiration (Figure 9.2): All organisms do cellular respiration - Breakdown glucose release energy then capture the energy in ATP o ADP +P +energy A TP (7.3 kcal/mole) endergonic reaction o Glucose +Oxygen CO2 + H2O + e
LSU - BIOL - 1201
Energy Transformations: 1. Cellular respiration (Figure 9.2): All organisms do cellular respiration - Breakdown glucose release energy then capture the energy in ATP o ADP +P +energy A TP (7.3 kcal/mole) endergonic reaction o Glucose +Oxygen CO2 + H2O + e
LSU - BIOL - 1201
Scientific Method What is Science? An approach to understanding nature; Output of the process is a body of knowledge Think of it as a process What do scientists do? Make observations directly or indirectly Attempt to discern patterns Think about patterns,
LSU - BIOL - 1201
Cell is the minimum organization of living matter CELL MEMBRANE MODELS (plasma membrane): - All cells have a thin outer covering - Plasma membrane or cell membrane - Early models inferred the structure from chemical and permeability properties of the memb
LSU - BIOL - 1201
20:36MendelianGeneticsQuestions AcellinG1ofthecellcyclehas12chromosomesinhomologouspairs.It undergoesMeiosis,duringMetaphaseIIeachcellwouldcontain6chromosomes withnopairs. Ifthefirstdivisionofmeiosisresultsinhaploidcellswhydotheseconddivision? Crossingo
LSU - BIOL - 1201
Animal Cell SignalingChemical Signaling in Animals (at a distance) Two majors systems: Endocrine system: hormones secreted into the blood stream Nervous system: neurotransmitters secreted into the synapse (junction) between neurons Major differences: End
LSU - BIOL - 1201
1.AtomicStructure* Valence Electronegativity 2.Bonds* 3.Molarity* 4.pHandpOH* 5.Propertiesofwater 6.Functionalgroups* StructureandFunction 7.Biologicalmolecules* 8.Thermodynamics18:3318:33
LSU - BIOL - 1201
C licker: T ranslate the following mRNA, pay attention to the d i rectionality and the start codon: 3 AAAAUGAAGUCCCUGGGUAGG Met Gly P ro Begin at the 5 end How does DNA contain information? In the nucleotides What is information used for? Tells how to mak
LSU - BIOL - 1201
Scientific Method What is Science? An approach to understanding nature; Output of the process is a body of knowledge Think of it as a process What do scientists do? Make observations directly or indirectly Attempt to discern patterns Think about patterns,
LSU - BIOL - 1201
DIHYBRID CROSSES Mendel's Second Law, Principle of Independent Assortment:(non-homologous chromosomes) F2 results: phenotypes and genotypes (if on non-homologous chromosomes) seed form and seed color P round, yellow R/R Y/Y Genotypes R/R Y/Y gametes: F1 p
LSU - BIOL - 1201
Variations found in Mendelian Genetics: Incomplete Dominance Multiple Alleles Co-dominance Sex linkage Epistasis/Pleiotropy Polygenic inheritance Variations in Phenotypes Result in changes in ratios of offspring, but alleles are inherited in the same mann
LSU - BIOL - 1201
PLOIDY Chromosomes that carry genes for the same traits (eye color, hair color etc.) are the same length and have their centromere in the same location. These chromosomes are called homologues, or a homologous pair. Haploid diploid tetraploid. Homologous
LSU - BIOL - 1201
Meiosis 10.25.10 CLICKER: Human somatic cells contain between 7 and 14 picograms of DNA. A cell containing 14 picograms would most likely be in which stage/s of the cell cycle? G2, Prophase and Anaphase How many chromosomes are required to have one copy o
LSU - BIOL - 1201
Clicker: In a repressible operon the repressor protein is made in an _ shape (form) and _ bid to the operator preventing _? Inactive, does not, transcription Clicker: A cell in anaphase of mitosis will have how many chromosomes and how much DNA compared t
LSU - BIOL - 1201
Membranes16:20Cells Theminimumorganizationoflivingmatter. CELLMEMBRANEMODELS(plasmamembrane): Allcellshaveathinoutercovering. Plasmamembraneorcellmembrane Earlymodelsofcellmembranesinferredthatstructurefromchemicaland permeabilitypropertiesofthemembrane
LSU - BIOL - 1201
Biology8/25SCIENTIFIC METHOD: observation> generalization or model> predictions or hypothesis> test> (new set of) observations (The scientific method is inherently a circular process)17:57Once you go around the scientific method, the new observations f
LSU - BIOL - 1201
Youdecreasethe[OH]ofasolutionbyafactorof10,000whatisthechangeinpH ofthissolution?ThepHdecreasesby4pHunits. ORGANICMOLECULES:ComplexmoleculescontainingacarboncarbonbondA.CompositionlargelyC,O,H,N,(S,P)butespeciallyC B.Therearefourmajorclassesoforganicmol
LSU - BIOL - 1201
Clicker: If you begin with 1 molecule of Acetyl CoA how many oxidative level ATPs will be produced in a mitochondrion with only one hydrogen ion pump in the ETC (near the end) PHOTOSY NTHESIS: Summary Equation (low energy) 6CO2 + 12H2 0 + LIGHT 6O2 + C66H
LSU - BIOL - 1201
BIOL 1208 Writing Assignment 2 Results Worksheet These are to be written individually even if you worked in a group. Name: Rebecca Duca Group Members: Lab Topic: Temperature What is the null hypothesis? be specific No change in activity of the enzyme will
LSU - BIOL - 1201
October 11, 2008 Saturdays Review Session for Exam 2 You have a U tube where the left side is A and the right side is B with a permeable membrane separating the two sides of the tube. 1. A. U tubes membrane is permeable to water and urea 2 M Glucose 3M Su
LSU - BIOL - 1201
Clicker: The human dystophin gene contains 2.4 million base pairs with 79 exons, while the final (mature) mRNA transcribed from this gene is 14,000 base pairs. What percentage of the DNA is this gene actually codes for the protein? .5%Genetic Code mRNA n
Los Angeles City College - PHYSICS - 21
WhiteString Trial m 1 2 3 4 5 6 mew 0.01350 400 450 500 550 600logm2.54 2.6 2.65 2.7 2.74 2.78L216.5 227.5 242 254.5 262.25 141n4 4 4 4 4 2lambda LOGlambda v 108.25 2.03 113.75 2.06 121 2.08 127.25 2.1 131.13 2.12 141 2.15626.06 669.29 709.89 748
Georgia Tech - PSYCH - 1101
Psychology Final Exam NotesModule 49: Anxiety Disorders Generalized Anxiety Disorder: o Primarily found in women o Symptoms are no persistent and include jitters, agitation, sleep deprivation, difficulty in concentration o Generally victims were maltreat
LSU Eunice - AEROSPACE - 121
City University of Seattle - ECE - 313
16. Mean Square EstimationGiven some information that is related to an unknown quantity of interest, the problem is to obtain a good estimate for the unknown in terms of the observed data. Suppose X 1 , X 2 , , X n represent a sequence of random variable
Wisconsin Milwaukee - ECON - 564
Yolanda Beavers Marketing Management Simulation 21. As a result of this simulation, what did you personally learn about Promotionalconsiderations? As a result of this simulation, I learned that it is best to only promote what the target market wants and
CofC - ASTR - 130
Pictures for slide quiz Large Refracting telescope built in 1897 at the Yerkesobservatory near Chicago. In the book pg 135 Gemini North telescope example of aCassegrain telescope and its also a reflecting telescope pg 138 in the bookNewtonian telescope
HCCS - BIOL - 2401
The Central Nervous System - The Brain Self QuizPro: Manhal Chbat.1. The brain A) is the center of both motor and sensory processing. B) is the center of emotion, intellect, memory and behavior. C) is composed of trillions of neurons and thousands of ne
University of Phoenix - ACC - 225
Problem 4-5A Adams Construction Company Work Sheet End of 2005 Fiscal YearNOAccountUnadjusted Trial Balance Dr. Cr.Adjusted Trial Balance Adjustments Dr. Cr. Dr. 17500 3200 3900 Dr. 5700 Dr. 2300 Dr. 131000 8500 Cr. 33750 Dr. Cr.101 Cash 126 Supplies
Northern Virginia - CSCI - 524
FruitComputerproducestwotypesofcomputers:PearcomputersandApricotcomputers. Relevantdataaregivenbelow.Atotalof3000chipsand1200hoursoflaborareavailable. FormulateanIPtohelpFruitmaximizeprofits.Labor Pear Apricot 1hour 2hoursChips 2 5Equipmentcost $5000 $
SUNY Buffalo - CS - 531
a G 6 ` a a z 6 bw4yrdd@qhI iq rcfw_9 G6 ` b4yrdd@qh a a a irI Yq ` pE ` Bxqh ` n Hf V 3 m6 G E H Va 3p 1 E8 p ~68 6 8 1E m s ~ pE k p 1 E s kE g XrBiBrcfw_$BXlwx4m@6x534riUe4GenXqweBBl4Xe HR2UiRi74UiRUiUABE S4Xbx4x7bB4E)e@R4G@XGBcfw_sf G6 h 3Q G3 1 3
Wisconsin - PA - 850
Policy Transfer and Cross-National LearningJonathan Zeitlin PA 850 Week 6A key issue in international governance How and what can/should policy makers in different countries learn from each other? To what extent can/should policies and programs be tran
Wisconsin - PA - 850
Globalization and the Challenge of GovernanceJonathan Zeitlin PA 850 Week 7A. What Is Globalization? A highly contested concept Interdependence/internationalization vs. globalization/denationalization Growing mutual sensitivity/vulnerability of nation
Wisconsin - PA - 850
The Pieces of Global GovernanceJonathan Zeitlin PA 850 Week 8A. The Challenges of Global Governance An increasing need for global governance? Globalization/denationalization Intensified international interdependence Mutual sensitivity/vulnerability
Wisconsin - PA - 850
PUBLIC AFFAIRS 850 INTERNATIONAL GOVERNANCEFall 2009 T 1:20-3:20 Microbial Sciences Building 1510 Professor Jonathan Zeitlin jzeitlin@wisc.edu 319 Ingraham 265-6640 (o)Course Description This a core foundation course for the Masters in International Pub
Pikes Peak - MAN - 240
2010Pepsi Case StudyPresented by: Denice Arcilla Anne Campbell Valarie Escalon Jennifer Layfield Catherine Myers12/9/2010Section 1: Summary Pepsis history started back in 1898 when a pharmacist, Caleb Bradham, created a carbonated drink he named Pepsi
Simon Fraser - CMPT - 110
CMPT 110-D100Spring 2010Assignment #1Part 1 (60%)In this assignment, you will create a windows application with 1 form window, 4 labels, 2 text boxes, 1 list box, and 8 buttons. What each button will do when it is clicked is described in the following
Dhaka College - CSE - CSE-313
The Pumping LemmaLemma: (Pumping Lemma) If L is a regular language, then there exists a positive integer p (the pumping length) such that every string s L, |s| p, can be partitioned into three pieces, s = xyz , such that the following conditions hold: |y
Simon Fraser - CMPT - 125
ComputersCMPT 125: Lecture 1: Understanding the ComputerTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University January 3, 2009 A computer performs 2 basic functions: 1. executes a sequence of instructions (program) 2. stor
Simon Fraser - CMPT - 125
Brief History of JavaCMPT 125: Lecture 2 Introduction to JavaTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University January 3, 2009 Java was developed by James Gosling and his team at Sun Computers in the early 1990s. Orig
Simon Fraser - CMPT - 125
Character StringsCMPT 125: Lecture 3 Data and ExpressionsTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University January 3, 2009 A character string is an object in Java, dened by the class String. Because they are used so f
Simon Fraser - CMPT - 125
Flow of ControlCMPT 125: Lecture 4 Conditionals and LoopsTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University January 17, 2009 The order in which statements are executed is called the ow of control. Unless otherwise spec
Simon Fraser - CMPT - 125
PackagesCMPT 126: Lecture 5 Using Classes and ObjectsTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University October 4, 2007 Java is supported by a standard class library, one that we can build upon rather than doing everyt
Simon Fraser - CMPT - 125
Array ElementsCMPT 126: Lecture 6 ArraysTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University September 25, 2007 An array is a construct used to group and organize data. By using an array, we dont have to declare separate
Simon Fraser - CMPT - 125
SortingCMPT 126: Lecture 8 Sorting and Searching (9.4 and 9.5)Tamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University October 16, 2007 Sorting is the process of arranging a list of items in a well-dened order. Eg: alphabeti
Simon Fraser - CMPT - 125
RecursionCMPT 126: Lecture 10 RecursionTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University October 25, 2007 Recursion is the process of dening something in terms of itself. Andrew Plotkin (interactive ction writer, aka
Simon Fraser - CMPT - 125
Collections and Data StructuresCMPT 126: Lecture 11 Collections: Abstract Data Types and Dynamic Representation (Chapt. 12)Tamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University October 30, 2007 A data structure is any pro
Simon Fraser - CMPT - 125
Software Development ActivitiesCMPT 126: Lecture 8 Object-Oriented DesignTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University November 13, 2007 When the code for your programs starts getting big, with numerous .java les,
Simon Fraser - CMPT - 125
Deriving SubclassesCMPT 126: Lecture 9 InheritanceTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University November 15, 2007 A class establishes the characteristics and behaviors of an object but reserves no memory space for
Simon Fraser - CMPT - 125
PolymorphismCMPT 126: Lecture 10 PolymorphismTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University November 20, 2007 Polymorphism means having many forms. How does this related to object oriented programming? Consider the
Simon Fraser - CMPT - 125
Exception HandlingCMPT 126: Lecture 11 ExceptionsTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University November 22, 2007 Certain problems is a Java program may generate exceptions or errors. An exception is an object that
Simon Fraser - CMPT - 125
Primitive data typesCMPT 126: ReviewTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University November 28, 2007 Primitive data types consists of Integers (byte, short, int, long) Floating Points (float, double) Characters (ch
Simon Fraser - CMPT - 125
$ % & ' % ( ! " ! # ) , - '.$ - '/+ ) ' - & - & & ) * + )0& - ) * 1 2) 3 * ) $ 4 ' & '$ / /& /- /! ! $ ( $3 * 0$ 0 -3 / - ) - 7 4 ! % ;/
Simon Fraser - CMPT - 125
& ' ( ) ) , - *+ ,! *+ ! " # # $ % ' ( ) ) . / $ * & . * . ! ,&0 , * . 1 & ! , !& & 0,! ) . ! . ,* & 0, 2, ' * & 0, , ! 3 ,* , ! 4, 0 & !& 0, - . !& 0, . , ) 05 !& . 6
Simon Fraser - CMPT - 125
$ %& ' ( $ ' ( $ )* ! "! # & ' ( +,- ,/ + % *% ,- 0 )*( ) * . ( % *% &! ' ( $)* * 1 ( . *% ! 0 * &23* * $* ( $ . %! $( $ ! 6 ), 4 1)* 4 . %)* . % * ' )5% * ( % % $ . 3 $*$)* % % 0 >? & : ( * ' ( + ,- 89
Simon Fraser - CMPT - 125
& '( )* ' ' &./ ! " " #$#% ($ + ,(-)* ' ' 0 1 2 ' * ' '##3 & 2 1 2 4* 5 ' 1 *' & #)* ' ' 1 # * & ' *1 * # '6( & ' * '3 )* ' ' )* ' '7! ,! ,!3 )* ' ' &