13 Pages

Exam 2 notes!

Course: BIOL 1201, Fall 2010
School: LSU
Rating:
 
 
 
 
 

Word Count: 2159

Document Preview

is Cell the minimum organization of living matter CELL MEMBRANE MODELS (plasma membrane): - All cells have a thin outer covering - Plasma membrane or cell membrane - Early models inferred the structure from chemical and permeability properties of the membrane - Cell membrane made up of phospholipids - Permeable to ions, water Fluid-Mosaic Model 2 layers of phospholipids as before, but now exposed proteins in a...

Register Now

Unformatted Document Excerpt

Coursehero >> Louisiana >> LSU >> BIOL 1201

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
is Cell the minimum organization of living matter CELL MEMBRANE MODELS (plasma membrane): - All cells have a thin outer covering - Plasma membrane or cell membrane - Early models inferred the structure from chemical and permeability properties of the membrane - Cell membrane made up of phospholipids - Permeable to ions, water Fluid-Mosaic Model 2 layers of phospholipids as before, but now exposed proteins in a mosaic patterns, not a continuous layer pores bounded by protein as before fluidity: proteins and phospholipids can move (dynamic structure), evidence from hybrid cells - Phospholipid bilayer with a mosaic of associated proteins - Figure 7.7 Cell Coats: (not a separate entity from the cell membrane) glycocalyx composed of glycolipids, glycoproteins (short chain carbohydrates attached) - molecules that are part of the cell membrane - important feature for cell/cell recognition - Function: cell recognition Why do membranes exist ??? A) structural: need to keep contents of the cytoplasm inside of something; holds the cell together B) Functional properties: - Maintain concentrations of molecules and ions - Create free energy gradients - Orient molecules into functional complexes Biological Systems: (with membranes) Osmosis: net movement of water across (through) a semi-permeable membrane (ie permeable to water, but not to solutes) Relative Relationship: Which side does the water have the greatest free energy or is most concentrated? 1M sucrose OR Distilled water Distilled water In which direction will there be a net movement of water? Sodium chloride does dissociate in water, 1M Na+ & 1M Cl- (2 moles); NaCl has more material in solution, increasing the entropy of the water molecules making the water move from L to R 1M sucrose 1M NaCl Water permeable membrane In which direction will there be a net movement of water? To the RIGHT Equilibrium point would be 1.5 M on each side glucose 1M Sucrose 2M Glucose (1.5) 2.5 M 2M Sucrose 1M Glucose (1.5) 3.5 M After water movement the glucose goes to equilibrium point** Membrane permeable to H20 and Glucose Terminology of Solutions Relative to one another: Hyperosmotic/ hypertonic: more concentrated Isosmotic/ isotonic: Equal Concentrated Hypoosmotic/ hypotonic: less concentrated Clicker ?: A single celled freshwater organism, such as a Paramecium, is transferred to saltwater. Which of the following would happen The cell will shrink Clicker ? Water will ___ the cells of a fish living in fresh water because of the process of osmosis. MOVE INTO Factors involved in the permeability * size and shape of molecules - Really small molecules (like oxygen) will pass right through the membrance * solubility in lipids - Lipids are soluble in other lipids, non-polar things pass right through the membrane * net electric charge - typically not permeable through the cell membrane * chemical properties ------But water moves freely across the membrane-----* important to study the movement of water ** water is the universal solvent in biological systems What is the relationship between the cytoplasm of the cells that line the passageways of the lungs and the extracellular fluid? Normally: Cytoplasm hypotonic Cystic fibrosis: cytoplasm hypertonic Cystic Fibrosis - Lack CL- channel cell membrane - Genetic Disorder - Based on a faulty protein - Symptoms: salty skin, mucus build up in lungs, causes breathing problems and increased lung infections - Cause: non- functional Cl- ion transporter - What is the chloride ion channel in individuals with Cystic Fibrosis? Chloride ions are moving from high to low concentrated, this is a facilitated diffusion transport. - How does the movement of Cl- out of the epithelial cells cause the mucus in the lungs to be less viscous? - How does the non-functional CFTR transporter result in thick mucus? - Treatment: diet high in protein Mucus build up is a simple problem of cell membrane permeability Movement of Substances Across Membranes: A) Many substances can move by diffusion, since the membrane is permeable to them (simple sugars, amino acids, lipids) B) membrane is impermeable to many other substances (ions, complex sugars, proteins, other large molecules) How do these molecules move across the membrane ?? permeases (enzyme-like proteins) in membrane act as carriers. Diffusion: Movement of small molecules as a consequence of thermal agitation (thermal energy) * physical property of matter * seeming contradiction: mvt of a given molecule random, but the net effect can be non random - Figure 7.11 - Molecules diffuse independently - spontaneous process (doing downhill energetically) What force causes the net movement? **movement from a region of Hi free energy to a region of low free energy (or down a free energy gradient) G = H - TS Movement of Substances other than Water Diffusion: (molecules that are permeable) Small Molecules Lipid soluble molecules Permeases: (molecules that are not permeable or that move slowly) Large molecules Charged molecules Permeases: Membrane bound proteins that facilitate the movement of molecules across the membrane Categorized by energy use Passive, use no energy Active, use energy The functions of permeases can be broken down by the use of energy Facilitated Diffusion Selective, but passive - Moves molecules down their free energy (concentration gradient) - Protein Carrier - Protein channel Selective Figure (7.15) Active transport Selective, but active, (require energy imput) - Moves molecules against their free energy (concentration gradient) - Protein carrier - Selective and requires energy (usually ATP) - Figure 7.16 Figure 7.17 Active and passive transport Other Movement: though technically not through the membrane (EUCARYOTES ONLY) Vesicle-mediated Transport a) Endocytosismovement of material into the cytoplasm; cell engulfs object, that becomes membrane bound vesicle Phagocytosis : large object Pinocytosis : small object Receptor-mediated : a more selective version of pinocytosis b) Exocytosismovement of material out of the cytoplasm; membrane bound vesicles fuse with cell membrane and expel contents Cell Walls: composed of carbohydrates; separate entity from the cell - Plants, cellulose - Fungi, cellulose and chitin - Amino sugars - Bacteria, peptidoglycans (amino sugars, amino acids) Cell Adhesion: - Plants o Pectin (ripe fruit) o Lectin - Animals o Collagen - All proteins Glues: Junctions: - Plants plasmodesmata (figure 6.28) Animals tight junctions, intermediary junctions, desmosomes figure 6.32 gap junctions: similar to plasmodesmata (cytoplasmic connections) CELL TYPES: PROCARYOTIC EUCARYOTIC STRUCTURES WHAT THEY ARE WHAT ARE THEIR FUNCTIONS CELL: minimum organization of living matter; smallest unit capable of independent living existence A) B) important unifying generalization in biology! multicellular species built from these common building blocks PROCARYOTIC VERSUS EUCARYOTIC Structures and functions PROCARYOTES Cell structure *Nucleoid: *Ribosomes: *Flagella: *Mesosome: EUCARYOTES: Organelles: active structures, typically with specific functions Nucleus: Endoplasmic Reticulum: two types of ER rough ER smooth ER Golgi Apparatus: Lysosomes: Vacuoles and Vesicles: Membrane Movement: think in terms of the flow of membrane through the endomembrane system nuclear ER Golgi Lysosomes Cell Other Membrane Organelles Actin filaments, Intermediate Filaments, and Microtubules Ribosomes: Sites of protein synthesis Plastids: (plants only) Mitochondria (all eucaryotes) Energy Transformations: 1. Cellular respiration (Figure 9.2): All organisms do cellular respiration - Breakdown glucose release energy then capture the energy in ATP o ADP + P + energy ATP (7.3 kcal/mole) endergonic reaction o Glucose + Oxygen CO2 + H2O + energy (-686 kcal/mole) exergonic reaction 2. Photosynthesis *Both of these must occur in the cell; laws of thermodynamics Where and how is most of the ATP produced in your cells? Where: In the mitochondrion, ATP synthase (enzyme that synthesized ATP) How: Chemiosmosis or Oxidative Phosphorylation (Figure 6.17) Where does the energy required for ATP synthesis come from? Proton of hydrogen ion gradient Where does Hydrogen ion gradient come from? Active transport of hydrogen ions powered by the flow of electrons along the ETC (Electron transport chain); Involved redox reactions IMPORTANT REACTIONS AND MOLECULES: Redox Reactions: Figure 9.15 reduction: Addition of electrons or hydrogen to a molecule that adds energy (stores energy in reduced compounds) oxidation: Removal of electrons or hydrogen from a molecule reduing the energy (releases energy from reduced compounds **These reactions always occur together Energy Transporting Molecules: NAD NAD+ + 2H <------> NADH + H+ (NADox) (NADre) FAD FAD + 2H <------> FADH2 (FADox) (FADre) Local transport and the cells energy currency ATP (Adenosine Triphosphate) ADP + Pi --------------> ATP ( G = +7.3 Kcal/mole) Two mechanisms for phosphorylation 1) Substrate level Phosphorylation: 2) Oxidative Phosphorylation: CATABOLISM OF GLUCOSE: Summary equation: C6H12O6 + 6O2 ---------- 6CO2 + 6H2O G=-686 Kcal/mole oxidation of glucose: removal of electrons (hydrogen electrons, often w/protons H+) How Do you make ATP ATP Synthase The chemiosmotic gradient is both a concentration gradient and a voltage gradient . This results in a large free energy gradient Where do the reduced molecules come from? Kreb's Cycle (Citric Acid Cycle) Where does the pyruvic acid come from? Where does the Hydrogen ion gradient come from? - Active transport of hydrogen ions powered by the flow of electrons along with ETC (Electron Transport Chain) - Involved redox reactions - Figure 9.15 Clicker ?: In an atively respiring mitochondrion where would you expect to find the lowest pH? Intra- mitochondrial membrane space How does the flow of electrons provide energy to pump hydrogen ions? - Each transfer of electrons is downhill energetically - Figure 9.13 What happens to the electrons at the end of the ETC? - The electrons combine with oxygen and hydrogen ions and make water Where do the reduced NADH+ H+ and FADH2 come from? - Most of the NADH + H+ and all the FADH2 comes from the Krebs or citric Acid cycle. - Figure 9.11 Oxidative Level Phosphorylation - Uses the exergonic flow of electrons form the food (glucose) to oxygen to drive the endergonic synthesis of ATP - Chemiostasis Substrate Level Phosphorylation - Direct transfer of phosphate to ADP from an organic molecules with a high energy phosphate bond Where does the Acetyl- CoA come from? - The breakdown of pyruvic acid - Figure 9.10 Where does the pyruvic acid come from? - the breakdown of glucose (glycolysis) - figure 9.08 9-27 Clicker: Bears have a tissue known as brown fat. In these cells the mitochondria have a special protein known as thermogenin. This is a facilitated diffusion channel for H+, with no associated ATP catalytic site. Based on the model of the mitochondria what will happen to the ATP production? How many molecules of ATP are produced from 1 molecule of glucose in the presence of oxygen? Figure 9.6 GL YCOL YSIS: FERMENT A TION: if no oxygen is present Fermentation as an alternative to most of this pathway What happens if there is no oxygen present? - IF there is no oxygen then nothing inside the mitochondrion can work, only glycolysis can work - In fermentation, take the pyruvic acid and turn it to lactic acid or ATP YIELD FROM GLUCOSE BREAKDOWN: 1) Single molecule: anaerobic aerobic Interconversion of Food Stuffs: Other Sugars and Carbohydrates: Lipids: Proteins: Clicker: If you begin with 1 molecule of Acetyl CoA how many oxidative level ATPs will be produced in a mitochondrion with only one hydrogen ion pump in the ETC (near the end) PHOTOSYNTHESIS: Summary Equation (low energy) 6CO2 + 12H2 0 + LIGHT 6O2 + C66H12O6 + 6H20 (high energy) - Convert 2 low energy molecules into a high energy molecule Clicker: What is the fate of oxygen in water? Becomes part of ? Figure 10.4 Reduction of CO2: redox reactions Photosynthetic Reactions: a long series of steps, several basic questions Fate of specific atoms? Two basic stage to photosythesis light dependent reactions (Light Reactions): Capture light energy in chemical energy light-independent reactions (Dark Reactions): Use the chemical energy to convert CO2 into glucose [Calvin Cycle] figure 10.5 Photosynthetic structures (Eucaryotes): takes place inside a chloroplasts Thylakoids granum stroma DARK REACTIONS: CALVIN-BENSON CYCLE Takes place in the stroma What are the inputs and outputs? - CO2, ATP, NADPH (inputs); Sugar (output) - figure 10.18 Where does the energy come from to drive these reactions? - Light Reactions (photosystems) - Cyclic and Non- cyclic photophosphorylation Photosystem: A collection of several hundred pigment molecules in the thylakoid membrane Figure 10.12; PHOTOSYSTEM 1: Composition: antenna pigments 200 molecules chlorophyll a and 50 b 50 molecules carotenoid 1 molecule special chlorophyll a (P700) reaction center pigments Why have so many different types of pigments as antenna pigments? All absorb different wave lengths of light; Figure 10.9; NON-CYCLIC PHOTOPHOSPHORYLATION: source of electrons for photosystem 2 H20 Photosystem 2 Cytochrome complex Photosystem 1 NADPH Calvin Cycle Inputs and Products to non-cyclic Inputs: Light, H20, ADP, NADP+ Outputs: Oxygen, ATP, NADPH + H+ CYCLIC PHOTOPHOSPHORYLATION Photosystem 1 Cytochrome complex Photosystem 2 Inputs and Products Inputs: Light, ADP Outputs: ATP SUMMARY OF ENERGY TRANSFORMATIONS: (This will not be covered in lecture) Catabolic Pathways: release stored energy 1) glycolysis 2) fermentation: anaerobic conditions 3) Citric Acid Cycle (in mitochondrial matrix) 4) Electron Transport Chain (in inner mitochondrial membrane) in procaryotes no mitochondria all processes take place in the cytoplasm or as part of the cell membrane Anabolic Pathways: store energy 1) photophosphorylation: oxygen as by product (in thylakoid membrane) 2) Calvin-Benson Cycle: production of G3P (in stroma) Similarities in Anabolic and Catabolic Pathways 1) similar molecules and pathways PGA, G3P, oxaloacetic acid, etc. Production of G3P leading to glucose 2) Membrane bound electron transport chains Step-wise release of energy 3) Extensive use of redox reactions 4) Energy transfer and storage molecules NAD or (NADP), FAD, ATP 5) Proton (H+) chemiosmotic gradient F1 complex (or ATP synthetase) phosphorylates ADP SUMMARY: Photosynthesis: H2O + CO2 stores energy (reduction) Cellular Respiration: C6H12O6 + O2 releases energy (oxidation) Photosynthesis and respiration questions:
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

LSU - BIOL - 1201
20:36MendelianGeneticsQuestions AcellinG1ofthecellcyclehas12chromosomesinhomologouspairs.It undergoesMeiosis,duringMetaphaseIIeachcellwouldcontain6chromosomes withnopairs. Ifthefirstdivisionofmeiosisresultsinhaploidcellswhydotheseconddivision? Crossingo
LSU - BIOL - 1201
Animal Cell SignalingChemical Signaling in Animals (at a distance) Two majors systems: Endocrine system: hormones secreted into the blood stream Nervous system: neurotransmitters secreted into the synapse (junction) between neurons Major differences: End
LSU - BIOL - 1201
1.AtomicStructure* Valence Electronegativity 2.Bonds* 3.Molarity* 4.pHandpOH* 5.Propertiesofwater 6.Functionalgroups* StructureandFunction 7.Biologicalmolecules* 8.Thermodynamics18:3318:33
LSU - BIOL - 1201
C licker: T ranslate the following mRNA, pay attention to the d i rectionality and the start codon: 3 AAAAUGAAGUCCCUGGGUAGG Met Gly P ro Begin at the 5 end How does DNA contain information? In the nucleotides What is information used for? Tells how to mak
LSU - BIOL - 1201
Scientific Method What is Science? An approach to understanding nature; Output of the process is a body of knowledge Think of it as a process What do scientists do? Make observations directly or indirectly Attempt to discern patterns Think about patterns,
LSU - BIOL - 1201
DIHYBRID CROSSES Mendel's Second Law, Principle of Independent Assortment:(non-homologous chromosomes) F2 results: phenotypes and genotypes (if on non-homologous chromosomes) seed form and seed color P round, yellow R/R Y/Y Genotypes R/R Y/Y gametes: F1 p
LSU - BIOL - 1201
Variations found in Mendelian Genetics: Incomplete Dominance Multiple Alleles Co-dominance Sex linkage Epistasis/Pleiotropy Polygenic inheritance Variations in Phenotypes Result in changes in ratios of offspring, but alleles are inherited in the same mann
LSU - BIOL - 1201
PLOIDY Chromosomes that carry genes for the same traits (eye color, hair color etc.) are the same length and have their centromere in the same location. These chromosomes are called homologues, or a homologous pair. Haploid diploid tetraploid. Homologous
LSU - BIOL - 1201
Meiosis 10.25.10 CLICKER: Human somatic cells contain between 7 and 14 picograms of DNA. A cell containing 14 picograms would most likely be in which stage/s of the cell cycle? G2, Prophase and Anaphase How many chromosomes are required to have one copy o
LSU - BIOL - 1201
Clicker: In a repressible operon the repressor protein is made in an _ shape (form) and _ bid to the operator preventing _? Inactive, does not, transcription Clicker: A cell in anaphase of mitosis will have how many chromosomes and how much DNA compared t
LSU - BIOL - 1201
Membranes16:20Cells Theminimumorganizationoflivingmatter. CELLMEMBRANEMODELS(plasmamembrane): Allcellshaveathinoutercovering. Plasmamembraneorcellmembrane Earlymodelsofcellmembranesinferredthatstructurefromchemicaland permeabilitypropertiesofthemembrane
LSU - BIOL - 1201
Biology8/25SCIENTIFIC METHOD: observation&gt; generalization or model&gt; predictions or hypothesis&gt; test&gt; (new set of) observations (The scientific method is inherently a circular process)17:57Once you go around the scientific method, the new observations f
LSU - BIOL - 1201
Youdecreasethe[OH]ofasolutionbyafactorof10,000whatisthechangeinpH ofthissolution?ThepHdecreasesby4pHunits. ORGANICMOLECULES:ComplexmoleculescontainingacarboncarbonbondA.CompositionlargelyC,O,H,N,(S,P)butespeciallyC B.Therearefourmajorclassesoforganicmol
LSU - BIOL - 1201
Clicker: If you begin with 1 molecule of Acetyl CoA how many oxidative level ATPs will be produced in a mitochondrion with only one hydrogen ion pump in the ETC (near the end) PHOTOSY NTHESIS: Summary Equation (low energy) 6CO2 + 12H2 0 + LIGHT 6O2 + C66H
LSU - BIOL - 1201
BIOL 1208 Writing Assignment 2 Results Worksheet These are to be written individually even if you worked in a group. Name: Rebecca Duca Group Members: Lab Topic: Temperature What is the null hypothesis? be specific No change in activity of the enzyme will
LSU - BIOL - 1201
October 11, 2008 Saturdays Review Session for Exam 2 You have a U tube where the left side is A and the right side is B with a permeable membrane separating the two sides of the tube. 1. A. U tubes membrane is permeable to water and urea 2 M Glucose 3M Su
LSU - BIOL - 1201
Clicker: The human dystophin gene contains 2.4 million base pairs with 79 exons, while the final (mature) mRNA transcribed from this gene is 14,000 base pairs. What percentage of the DNA is this gene actually codes for the protein? .5%Genetic Code mRNA n
Los Angeles City College - PHYSICS - 21
WhiteString Trial m 1 2 3 4 5 6 mew 0.01350 400 450 500 550 600logm2.54 2.6 2.65 2.7 2.74 2.78L216.5 227.5 242 254.5 262.25 141n4 4 4 4 4 2lambda LOGlambda v 108.25 2.03 113.75 2.06 121 2.08 127.25 2.1 131.13 2.12 141 2.15626.06 669.29 709.89 748
Georgia Tech - PSYCH - 1101
Psychology Final Exam NotesModule 49: Anxiety Disorders Generalized Anxiety Disorder: o Primarily found in women o Symptoms are no persistent and include jitters, agitation, sleep deprivation, difficulty in concentration o Generally victims were maltreat
LSU Eunice - AEROSPACE - 121
City University of Seattle - ECE - 313
16. Mean Square EstimationGiven some information that is related to an unknown quantity of interest, the problem is to obtain a good estimate for the unknown in terms of the observed data. Suppose X 1 , X 2 , , X n represent a sequence of random variable
Wisconsin Milwaukee - ECON - 564
Yolanda Beavers Marketing Management Simulation 21. As a result of this simulation, what did you personally learn about Promotionalconsiderations? As a result of this simulation, I learned that it is best to only promote what the target market wants and
CofC - ASTR - 130
Pictures for slide quiz Large Refracting telescope built in 1897 at the Yerkesobservatory near Chicago. In the book pg 135 Gemini North telescope example of aCassegrain telescope and its also a reflecting telescope pg 138 in the bookNewtonian telescope
HCCS - BIOL - 2401
The Central Nervous System - The Brain Self QuizPro: Manhal Chbat.1. The brain A) is the center of both motor and sensory processing. B) is the center of emotion, intellect, memory and behavior. C) is composed of trillions of neurons and thousands of ne
University of Phoenix - ACC - 225
Problem 4-5A Adams Construction Company Work Sheet End of 2005 Fiscal YearNOAccountUnadjusted Trial Balance Dr. Cr.Adjusted Trial Balance Adjustments Dr. Cr. Dr. 17500 3200 3900 Dr. 5700 Dr. 2300 Dr. 131000 8500 Cr. 33750 Dr. Cr.101 Cash 126 Supplies
Northern Virginia - CSCI - 524
FruitComputerproducestwotypesofcomputers:PearcomputersandApricotcomputers. Relevantdataaregivenbelow.Atotalof3000chipsand1200hoursoflaborareavailable. FormulateanIPtohelpFruitmaximizeprofits.Labor Pear Apricot 1hour 2hoursChips 2 5Equipmentcost $5000 $
SUNY Buffalo - CS - 531
a G 6 ` a a z 6 bw4yrdd@qhI iq rcfw_9 G6 ` b4yrdd@qh a a a irI Yq ` pE ` Bxqh ` n Hf V 3 m6 G E H Va 3p 1 E8 p ~68 6 8 1E m s ~ pE k p 1 E s kE g XrBiBrcfw_$BXlwx4m@6x534riUe4GenXqweBBl4Xe HR2UiRi74UiRUiUABE S4Xbx4x7bB4E)e@R4G@XGBcfw_sf G6 h 3Q G3 1 3
Wisconsin - PA - 850
Policy Transfer and Cross-National LearningJonathan Zeitlin PA 850 Week 6A key issue in international governance How and what can/should policy makers in different countries learn from each other? To what extent can/should policies and programs be tran
Wisconsin - PA - 850
Globalization and the Challenge of GovernanceJonathan Zeitlin PA 850 Week 7A. What Is Globalization? A highly contested concept Interdependence/internationalization vs. globalization/denationalization Growing mutual sensitivity/vulnerability of nation
Wisconsin - PA - 850
The Pieces of Global GovernanceJonathan Zeitlin PA 850 Week 8A. The Challenges of Global Governance An increasing need for global governance? Globalization/denationalization Intensified international interdependence Mutual sensitivity/vulnerability
Wisconsin - PA - 850
PUBLIC AFFAIRS 850 INTERNATIONAL GOVERNANCEFall 2009 T 1:20-3:20 Microbial Sciences Building 1510 Professor Jonathan Zeitlin jzeitlin@wisc.edu 319 Ingraham 265-6640 (o)Course Description This a core foundation course for the Masters in International Pub
Pikes Peak - MAN - 240
2010Pepsi Case StudyPresented by: Denice Arcilla Anne Campbell Valarie Escalon Jennifer Layfield Catherine Myers12/9/2010Section 1: Summary Pepsis history started back in 1898 when a pharmacist, Caleb Bradham, created a carbonated drink he named Pepsi
Simon Fraser - CMPT - 110
CMPT 110-D100Spring 2010Assignment #1Part 1 (60%)In this assignment, you will create a windows application with 1 form window, 4 labels, 2 text boxes, 1 list box, and 8 buttons. What each button will do when it is clicked is described in the following
Dhaka College - CSE - CSE-313
The Pumping LemmaLemma: (Pumping Lemma) If L is a regular language, then there exists a positive integer p (the pumping length) such that every string s L, |s| p, can be partitioned into three pieces, s = xyz , such that the following conditions hold: |y
Simon Fraser - CMPT - 125
ComputersCMPT 125: Lecture 1: Understanding the ComputerTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University January 3, 2009 A computer performs 2 basic functions: 1. executes a sequence of instructions (program) 2. stor
Simon Fraser - CMPT - 125
Brief History of JavaCMPT 125: Lecture 2 Introduction to JavaTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University January 3, 2009 Java was developed by James Gosling and his team at Sun Computers in the early 1990s. Orig
Simon Fraser - CMPT - 125
Character StringsCMPT 125: Lecture 3 Data and ExpressionsTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University January 3, 2009 A character string is an object in Java, dened by the class String. Because they are used so f
Simon Fraser - CMPT - 125
Flow of ControlCMPT 125: Lecture 4 Conditionals and LoopsTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University January 17, 2009 The order in which statements are executed is called the ow of control. Unless otherwise spec
Simon Fraser - CMPT - 125
PackagesCMPT 126: Lecture 5 Using Classes and ObjectsTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University October 4, 2007 Java is supported by a standard class library, one that we can build upon rather than doing everyt
Simon Fraser - CMPT - 125
Array ElementsCMPT 126: Lecture 6 ArraysTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University September 25, 2007 An array is a construct used to group and organize data. By using an array, we dont have to declare separate
Simon Fraser - CMPT - 125
SortingCMPT 126: Lecture 8 Sorting and Searching (9.4 and 9.5)Tamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University October 16, 2007 Sorting is the process of arranging a list of items in a well-dened order. Eg: alphabeti
Simon Fraser - CMPT - 125
RecursionCMPT 126: Lecture 10 RecursionTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University October 25, 2007 Recursion is the process of dening something in terms of itself. Andrew Plotkin (interactive ction writer, aka
Simon Fraser - CMPT - 125
Collections and Data StructuresCMPT 126: Lecture 11 Collections: Abstract Data Types and Dynamic Representation (Chapt. 12)Tamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University October 30, 2007 A data structure is any pro
Simon Fraser - CMPT - 125
Software Development ActivitiesCMPT 126: Lecture 8 Object-Oriented DesignTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University November 13, 2007 When the code for your programs starts getting big, with numerous .java les,
Simon Fraser - CMPT - 125
Deriving SubclassesCMPT 126: Lecture 9 InheritanceTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University November 15, 2007 A class establishes the characteristics and behaviors of an object but reserves no memory space for
Simon Fraser - CMPT - 125
PolymorphismCMPT 126: Lecture 10 PolymorphismTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University November 20, 2007 Polymorphism means having many forms. How does this related to object oriented programming? Consider the
Simon Fraser - CMPT - 125
Exception HandlingCMPT 126: Lecture 11 ExceptionsTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University November 22, 2007 Certain problems is a Java program may generate exceptions or errors. An exception is an object that
Simon Fraser - CMPT - 125
Primitive data typesCMPT 126: ReviewTamara Smyth, tamaras@cs.sfu.ca School of Computing Science, Simon Fraser University November 28, 2007 Primitive data types consists of Integers (byte, short, int, long) Floating Points (float, double) Characters (ch
Simon Fraser - CMPT - 125
$ % &amp; ' % ( ! &quot; ! # ) , - '.$ - '/+ ) ' - &amp; - &amp; &amp; ) * + )0&amp; - ) * 1 2) 3 * ) $ 4 ' &amp; '$ / /&amp; /- /! ! $ ( $3 * 0$ 0 -3 / - ) - 7 4 ! % ;/
Simon Fraser - CMPT - 125
&amp; ' ( ) ) , - *+ ,! *+ ! &quot; # # $ % ' ( ) ) . / $ * &amp; . * . ! ,&amp;0 , * . 1 &amp; ! , !&amp; &amp; 0,! ) . ! . ,* &amp; 0, 2, ' * &amp; 0, , ! 3 ,* , ! 4, 0 &amp; !&amp; 0, - . !&amp; 0, . , ) 05 !&amp; . 6
Simon Fraser - CMPT - 125
$ %&amp; ' ( $ ' ( $ )* ! &quot;! # &amp; ' ( +,- ,/ + % *% ,- 0 )*( ) * . ( % *% &amp;! ' ( $)* * 1 ( . *% ! 0 * &amp;23* * $* ( $ . %! $( $ ! 6 ), 4 1)* 4 . %)* . % * ' )5% * ( % % $ . 3 $*$)* % % 0 &gt;? &amp; : ( * ' ( + ,- 89
Simon Fraser - CMPT - 125
&amp; '( )* ' ' &amp;./ ! &quot; &quot; #$#% ($ + ,(-)* ' ' 0 1 2 ' * ' '##3 &amp; 2 1 2 4* 5 ' 1 *' &amp; #)* ' ' 1 # * &amp; ' *1 * # '6( &amp; ' * '3 )* ' ' )* ' '7! ,! ,!3 )* ' ' &amp;
Simon Fraser - CMPT - 125
$% () *)+, '( *( '&amp; $&amp; ' -$ .$ ! ! &quot;# $# ' %/+01 2* 3' ,%* 34 ) 3' 5 * 2 6 1 3(7 ,3 ' , 9, ' , $ ' ( 8 ( # ' 2 %/:* ! ;* , * ( * , 9 ' &lt; %, * 2 3 * * ' ) * * * 2* $'0 = 3' , 9$= &gt;? 3' 1 9 @A $=
Simon Fraser - CMPT - 125
%)*+ ,)+ %&quot;)% #).*- /01 * # #* % !&quot; # $ % &amp; &amp;# ' (# #+ ++ &amp;-%! '%,)23 #%#&quot; 4),)-* % 5. 6 .3 0!- % 7# ,)- ! 6 00#%6 # ,- % #! )- 3 6 # 8 0!+ /7 &quot;0 9 : %*!&quot; &amp;%; .3 &quot;8+ &quot; .% *- ) 8+ &quot; .% % #6 )- % *# ,)-' * ,)&quot;)%# 136 #).* &lt; &quot;)%# 13 62,)- &lt; )!0-*
Simon Fraser - CMPT - 125
!&quot; # $%&amp;' ( %&amp;'' !)%$* &quot;+ #&amp;, - - &quot; &amp;, - .- /'0 ,1 2 .' ' /' ,1 .3 ' 4 4 + 5 4+ 1 ' &quot; &quot; 6 + 7 + % + ! &quot; 8 - 4 4 9:/' 5 4 6 /'!4 ' 4 = &lt; &quot; 8 6 8 &quot; + 4 9 1+ &quot; ' &gt; + /' 5 ' 8 - + /' 8 ' + 46 - ?4 @ 8 A 5 + + 7 ' 5
Simon Fraser - MATH - 152
Section5.1May11 10 11:36PMChapter 5 Page 1Chapter 5 Page 2
Simon Fraser - MATH - 152
Chapter 5 Page 3Chapter 5 Page 4
Simon Fraser - MATH - 152
Section5.2May1110 10:52PMChapter 5 Page 1Chapter 5 Page 2Chapter 5 Page 3Chapter 5 Page 4Chapter 5 Page 5
Simon Fraser - MATH - 152
Chapter 5 Page 6Chapter 5 Page 7Section5.3May14 10 3:43PMChapter 5 Page 1Chapter 5 Page 2Chapter 5 Page 3
Simon Fraser - MATH - 152
Chapter 5 Page 3Chapter 5 Page 4Section5.4May1410 3:47PMChapter 5 Page 1Chapter 5 Page 2Chapter 5 Page 3
Simon Fraser - MATH - 152
Chapter 5 Page 4Section5.5May14 10 3:49PMChapter 5 Page 1Chapter 5 Page 2Chapter 5 Page 3Chapter 5 Page 4