8 Pages

syll101fa08sec41picsb

Course: PSYC 230, Spring 2010
School: Arizona
Rating:
 
 
 
 
 

Word Count: 3515

Document Preview

101 INDV Section 41: Structure of Mind & Behavior Fall Semester 2008 Instructor: Julie Feldman, Ph.D. Office: Psychology Building 444 Phone: 626-9682 Office Hours: Thursdays before class (10:00-12:00) or by appointment Email: julief@u.arizona.edu D2L course web site: http://d2l.arizona.edu Graduate Teaching Assistants: TA picture Office Loca tion & Offic e Hou rs Psych 111 Wednesdays 11:30-1:30...

Register Now

Unformatted Document Excerpt

Coursehero >> Arizona >> Arizona >> PSYC 230

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
101 INDV Section 41: Structure of Mind & Behavior Fall Semester 2008 Instructor: Julie Feldman, Ph.D. Office: Psychology Building 444 Phone: 626-9682 Office Hours: Thursdays before class (10:00-12:00) or by appointment Email: julief@u.arizona.edu D2L course web site: http://d2l.arizona.edu Graduate Teaching Assistants: TA picture Office Loca tion & Offic e Hou rs Psych 111 Wednesdays 11:30-1:30 Focella, Elizabeth TA grading pap ers wit h last na mes : A-Co Email focella@email.arizona.edu Hohman, Zachary Psych 135 Mondays 1:30-3:30 Cr-Hi zjhohman@email.arizona.edu Rossi, Filippo Psych 129 Mondays 9:30-11:30 Psych 121 Thursdays 1:55-3:55 Ho-M filippor@email.arizona.edu David Yokum N-Ti dyokum@email.arizona.edu ADDITIONAL GRADER for To-Z: SEAN IRVING (email: sirving@email.arizona.edu) Messages: Written messages can be placed in our mailboxes on the third floor of the psychology building (room 312) or via Email. Lectures: Tuesday and Thursday, 12:30-1:45, Social Sciences 100 Course Overview: I have four goals for this course. First, by the time you have completed this class, I want you to understand what psychology truly is, including all of the different areas that psychologists study. Although some of you may have a sense of what psychology is all about, many people think that all psychologists do is "help people" either through therapy or counseling. While it is true that therapy and counseling are part of psychology, they represent just the tip of the iceberg. Different types of psychologists study many different things, and my guess is that you will be surprised at some of the topics that fall under the heading of "psychology." Second, I want you to understand that psychology is a research science, and to realize that research psychologists test their assumptions using the scientific method (i.e., generating predictions, collecting data, and then seeing if the data supports or refutes the hypothesis). I hope to dispel some of the myths you might have about human behavior and to understand why psychology is more than "common sense." Third, although this class will be fast-paced, I do want it to be fun, enjoyable, and thought-provoking and I want us to have interesting conversations. Above all, I hope to get you to think about what youre reading and learning. Finally, I hope that you will find some part of this course relevant to your own lives. Although I can't promise that you'll gain any great insights, you will hopefully be armed with more knowledge about psychology than when you started. Class will cover the high points of the chapters, and will provide information beyond the content of the text. I will not go over all of the chapter contents. You will be responsible on tests for things covered in the text even if they are not mentioned in class. So please do the reading. I recognize the fact that you all have lives outside of this class, and have geared the assignments to what I hope is a reasonable, if slightly challenging level. If for some reason you have a problem, please come and talk to me. I am willing to work with you ahead of time to avoid problems before they occur; however, there tend to be fewer options available afterwards. Required Text: Wood, S. E., Wood, E. G., & Boyd, D. (2007). The world of psychology: Portable edition. Allyn & Bacon. One of the very nice features of this portable modular textbook is that it has a wonderful web site that contains an online learning tool mypsychlab that provides a text-specific ebook that matches the exact layout of the printed textbook (the access code is packaged with the purchase of the textbook). The ebook is broken down into major topics and contains multimedia icons in the margins that expand on the traditional textbook approach with videos, audio clips, interactive activities, and simulations designed to further illustrate key concepts and psychological principles. Also included is a customized study plan, generated from chapter pre-tests and post-tests that identifies areas of weakness and strength to help you focus your attention and efforts where theyre needed the most. D2l course web site: You can access the web site for the course at d2l.arizona.edu. Visit often. This will have the most up-to-date information about the course at all times. The web site contains an online version of this syllabus that will be updated should topics or readings be changed. It will also: Serve as the means for you to turn in your papers; your papers must be turned in via the web site; no paper copies will be accepted Provide up-to-date grade information & announcements Allow you to track your attendance points Post slides covered in lecture (not a substitute for lectures, but very useful to print in advance of lecture so that you do not need to write so much) Provide a link to the textbook web site (MyPsychlab), which contains several tools that will aid your studying Provide a link to the iClicker registration site Post study tips and study guides for exams Post additional information about the research participation requirement Provide a checklist to track course requirements and due dates Course Requirements: 1. Exams (220 points) There will be four exams: three during the semester (September 25, October 23 and November 25) and one during the scheduled Final Exam period (December 18 from 11:001:00). Exams will cover class lectures and required reading. All exams during the semester will consist of 30 multiple choice questions and will be worth 60 points. The final exam will be cumulative (with an emphasis on the most recently covered material) and will consist of 50 multiple choice questions worth 100 points. The exam on which you score lowest during the semester will not be counted towards your final grade. If you miss an exam during the semester, it will be treated as your lowest exam score. You must take the final exam, and it may not be dropped as your lowest exam. In order to do well on the tests, you should keep current on the readings and attend class. It is very easy to get behind on the readings; strive to have the readings completed prior to the class period for which they are assigned. I must also caution you against a strategy that I have been known to use all too often: procrastination. The textbook has many pages that you are required to read. I find that reading an entire chapter in a single sitting can be rather overwhelming. You would be best advised to read fewer pages more often. Cramming is an especially poor strategy for mastering the material you will need to know for the exams. Exam review sessions will be conducted by a TA outside of class. Appeal Procedure: If your answer to an exam question is marked incorrect, but you feel that it is correct, then you may write an appeal based on why you think your answer is correct. Please base your appeals on course material. Appeals need to be turned in within 1 week after the exam scores are posted. I will review your appeal, and if I think it justifies your answer, you will receive credit. If not, Ill explain why. 2. Assignments (60 points) To receive full credit, assignments MUST be turned in on or before the due date at the d2l web site dropbox on the blue navigation bar (except for the syllabus quiz see instructions below). Assignments turned in after that will lose 10% per day. No paper copies will be accepted. No emailed papers will be accepted. Syllabus Quiz (5 points) Due September 4 you will need to download and print the course syllabus to complete this assignment. To do this, go to d2l.arizona.edu, select Content from the blue navigation bar, and select Course syllabus under Course information. Print the syllabus, read it carefully, and use it to answer the quiz questions. When you are ready to take the quiz, select Quizzes on the blue navigation bar, then select Syllabus Quiz followed by Start Quiz. You have an hour to complete the quiz (there are 5 multiple-choice questions on the quiz worth 1 point each). Small projects: During this course you will complete 2 small projects (15 points each). The two projects will essentially be activities accompanied by a short paper. The papers will all be just 2 pages long (1 margins, double-spaced, 12-point font, with name and title of the assignment at the top). Because the papers are so short, they will be graded on clarity and succinctness. Keep in mind that it is often more difficult to fill up 2 really good pages than 10 pages of rambling. o Project #1: Personality Test (Due September 16) Find a popular media personality test in a magazine (e.g., Cosmopolitan, GQ) or on a web site (e.g., search for personality test). This test could be a serious test or a funny test. Take the test and address the following issues in your paper: What is the nature of the psychological issue? How does it relate to something covered in the course? Is it a credible test? Does it measure what it claims to? What the tests faults? Its strengths? Copy and paste the personality test at the end of your paper (you may have to type in the questions if you cant copy it from the web site). Project #2: Break a Social Norm (Due October 14) In our complex society, there are many social norms (e.g., dont chew with your mouth open, hold the door for others, face the front of the elevator). Some norms are explicit, while others are not. For this project your assignment is to break a social norm. Important: YOU CANNOT CAUSE INJURY TO ANYONE OR BREAK THE LAW!! However, find a norm and break it. Write about your experience: Page 1 should be a detailed description of your motivation. What norm did you pick? Why did you pick it? Where does this norm come from? What purpose does it serve? How did you learn about it? Page 2 should be a description of your experience in breaking the norm. What happened? What were peoples reactions? What was your reaction? How did you feel? How do you imagine others felt? o Written Assignment (25 points) Review a pop-psychology book (Due December 4) One goal of this course is to help you to become more critical consumers of how psychology is depicted in popular books, magazines, and newspaper articles. Some of these writings are excellent summaries of psychology today, while others have little to do with anything that has been discovered through psychological research. Your task is to select a book on a psychological topic that has been written for the general public. A suitable book can be found in the psychology section of most bookstores (e.g., self-help books like How to boost your self-esteem in 5 days or books about psychological disorders like ADHD in adults). Just browse these sections for a while until you find a book that looks interesting. Then, read your book and write a review of it. Your review should include: A summary of the main thesis of the book. assessment An of whether the thesis is supported or contradicted by research we covered in the course. Is this book based in psychological science? Explain your answer. Your paper should be 4-5 pages (1 margins, double-spaced, 12-point font, Times New Roman). Provide citations in the paper to all sources and an APA Style reference list at the end (examples are posted on the d2l web site). Generally, better grades on this assignment are given to students who go beyond the assigned readings for this course and find at least one or two empirical papers on the topic that have been published in psychological journals. 3. Attendance: Your attendance will be tracked using the clickers beginning September 2 (except on exam days). There are 24 class sessions remaining (including Sept 2). It is expected that you will attend at least 80% (19) of the remaining class lecture sessions, and you will receive 20 points (about 7% of your grade) for doing so. Students attending more than 50% but less than 80% (between 12 and 18) of the sessions will receive 10 points. Students failing to attend at least 50% of the sessions will receive zero points. So you need to miss no more than 5 class lecture sessions to get full attendance credit (20 points). If you miss two or fewer of the class sessions, you will receive 10 extra credit points. Attendance is counted on a given day only if you answer questions with your clicker throughout the lecture. Grading: Points toward the final grade will be counted as follows: 2/3 exams (lowest dropped), 60 points each Final Assignments Attendance Extra Credit 120 points 100 points 60 points 20 points (10 points) 300 points total Course grades will be based on total points earned at the end of the semester out of a possible 300 points. Grading will be based on percentages with guarantees. You must earn at least 180 points to pass (60% and a grade of D). 210 points (70%) or better guarantees a C. 240 points (80%) or better guarantees a B. 270 points (90%) or better guarantees an A. Grades for these point totals may be higher but will not be lower. A Final Note on Grading: Grades in this course will be based solely on the system discussed above. There wont be any possibility of doing extra reports, papers etc., to raise your grade. If you have trouble with the course material or arent doing as well on the exams as you think you should be, then be sure to seek help right away. I will make sure that I and all TAs devote tremendous energy to those students who plan ahead and use office hours for clarifying concepts and help with developing effective study habits, so please take advantage of this excellent opportunity. Participation & iClickers: In this class we will use remote transmitters to answer questions during lectures. You need to purchase an "iClicker" from the bookstore (a rebate for the clicker is included with the purchase of the textbook) and bring it to class every day (except exam days). Make sure to purchase the correct type of clicker (iClicker - Radio Frequency Classroom Response System). Attendance is counted on a given day only if you answer questions with your clicker throughout the lecture. You must register your iClicker at www.iclicker.com (type your university NetID into the Student ID box). Your NetID is the part of your email address before the @email.arizona.edu part. Use of an iClicker registered to another student is considered a violation of the Student Code of Conduct. All responses collected during class are being permanently recorded beginning September 2. If you register your iClicker after September 2, you will receive full back-credit for all responses collected. From this date forward, you will be asked several questions (3-7) throughout each class (except on exam days). Using iClicker will give you immediate feedback about your understanding of the material we are covering in class and will help guide your studying. Course Policies: Attendance and Participation: Class attendance has routinely been shown to be one of the best predictors of final grades, with students who attend frequently doing much better on the exams. Please be on time for class. Recurrent lateness disrupts the class and the flow of discussion. If you need to leave early, please sit in the back. Please do not talk or whisper to your neighbor consider writing short notes. Thank you for you cooperation. If you miss a class you are responsible for any material covered, announcements made, or assignments given. Feel free to ask questions and make comments during class. Your participation is helpful to the class and can provide me with feedback about how well I am communicating with you. Cell phones: Please turn off cell phones or other electronic devices that make sounds at the beginning of class. Plagiarism and cheating: I understand that there can be pressure for some students to cheat on exams or to plagiarize on their papers. The University of Arizona places a high value upon the integrity of its students. Any student found guilty of an act of academic misconduct (including, but not limited to, cheating, plagiarism, or using another students iClicker because they are absent) may be subject to having his or her grade reduced in the course, being placed on probation or suspended from the university, or being expelled from the university or a combination of these (please see the academic code of integrity and the student code of conduct; http://dos.web.arizona.edu/uapolicies) Plagiarism is taking quotes from the material you read or any other material (e.g., web site) without identifying the source. Key points: quote and cite others work and write original prose. Cheating includes copying someone elses exam answers. If you are unsure of whether something would constitute cheating or plagiarism, please ask the instructor or a TA. I assume all of you are bright students so do not jeopardize your academic careers. Students with special needs: Students requiring special accommodations for note-taking or testing should see the instructor at the beginning of the course or any time the need arises. Best wishes for an excellent semester! (see below for course outline/schedule & information about research requirement) Tentative Course Outline and Guidelines for Required Reading: Reading assignments are closely tied to the lecture schedule and should be completed before the class on the date listed. Date 8/26 8/28 9/2 9/4 9/9 9/11 9/16 9/18 9/23 9/25 9/30 10/2 10/7 10/9 10/14 10/16 10/21 10/23 10/28 10/30 11/4 11/6 11/11 11/13 11/18 11/20 11/25 11/27 12/2 12/4 12/9 12/18 Topic Schedule Introduction to psychology SURVEY Intro to iClicker & MyPsychlab & begin Personality Personality Theories Personality Assessment Psychological disorders Psychological disorders Therapies Therapies EXAM #1 GUEST SPEAKER Psychological science Psychological science Social Psychology Social Psychology Biology & Behavior Biology & Behavior EXAM #2 Sensation & Perception Sensation & Perception Sensation & Perception Learning VETERANS DAY NO CLASS!!! Learning Memory Memory EXAM #3 HAPPY THANKSGIVING!!! Child & adolescent development Child & adolescent development Wrap up & Review FINAL EXAM: 11:00-1:00 Chapters 1-3, 5,6, 9, 14-17 Chapter 6 Chapters 3, 5, 6 Chapter 9 WRITING ASSIGNMENT DUE Readings & Assignments Chapter 14 Syllabus quiz due Chapter 15 Project #1 due Chapter 16 Chapters 14-16 Chapter 1 Chapter 17 Project #2 due Chapter 2 Chapters 1, 17, 2 Chapter 3 Chapter 5 Departmental research participation requirement (A more detailed description of the Research Participation Requirement is available at D2L) Participating in experiments: The research participation requirement is meant to provide students with an opportunity to experience psychological research firsthand and to benefit from the ongoing research within our department. Most students enrolled in INDV101 fulfill this requirement by spending 4.5 hours participating as subjects in ongoing research projects. This is a departmental requirement, failure to complete the full 9 experimental credits will automatically result in a grade of "I" (incomplete). To remove the "incomplete" students will need to complete the experimental credits during the following semester. The incomplete will turn into a failing grade (E) at the end of one year. http://experiments.psychology.arizona.edu How do I sign up for an experiment? 1. First step is to create an account Go to http://experiments.psychology.arizona.edu Click on the link that reads: Request an account here Complete the form using your University email user name (NetID) (The part of your email address before the @email.arizona.edu part) Once you request your account your password will be mailed to you at your University email account 2. The second step is to log onto the account you created using the password emailed to you 3. You can use this account to sign up for experiments, find out information about experiments and experimenters, and check your credits earned If you have questions please feel free to ask your TA or your instructor What happens if I do not show up for an experiment? Failure to show up for an experiment that you have signed up for will result in the deduction of credits from your total. You will be deducted the number of credits the experiment was worth. If this happens, you will need to make up the missed credits. If you contact the experiment leader at least one hour prior to the experiment and provide a reasonable excuse for your absence, credit will not be deducted. If you cannot notify the experimenter before the experiment, you have 48 hours to email an excuse to the experimenter. How do I cancel an appointment? 1. You can cancel participation up to 2 hours before the scheduled time by using the web site. 2. You can cancel participation up to 1 hour before the scheduled time by phoning the experimenter or by phoning 621-7448, or by emailing the experimenter. What happens if I show up on time but there is no experimenter? If you show up for an experiment on time and it is canceled without warning, you are entitled to one credit for having shown up. In this instance, send an email to the experimenter or contact the Psychology Department Office, Room 312 in the Psychology Building. How can I find the Psychology Building? The Psychology Building is located across the mall from the Main Library. Not participating in experiments: Very few students prefer to meet this requirement by writing a "journal article review" paper (3-5 pages in length). If you choose to write the journal article paper, rather than participate in research studies, you will need to submit a copy of the article you intend to discuss and an outline of your journal article review paper by the date of the second exam October 23, 2008
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Arizona - PSYC - 230
PSY230 Chapter 1 Notes1/25/2010Chapter 1 Learning OutcomesChapter 1: Introduction to StatisticsPowerPoint Lecture Slides1 2 3 4 51/21/2010 Knowkeystatisticalterms Knowkeymeasurementterms Knowkeyresearchterms Knowtheplaceofstatisticsinscience Unders
Arizona - PSYC - 230
2/3/2010Chapter 2 Learning Outcomes1 Understandfrequencydistribution Organizedataintoregularfrequencydistribution Organizedataintogroupedfrequencydistribution i Understanddatapresentedinatable Organizedataintofrequencydistributiongraphs Understanddatat
Arizona - PSYC - 230
Chapter 3Central Tendency Central tendency is the concept of developing or defining a SINGLE value that is representative of the distribution What is typical for a large population Not exact Accuracy dictated by the shape of the distributionThree Main
Arizona - PSYC - 230
Variability Chapter 4Variability Measure of the degree to which the scores in a distribution are spread out or clustered together clustered together Helps describe the distribution Measure of how well an individual score represents the distributionThre
Arizona - PSYC - 230
Arizona - PSYC - 230
Chapter 5 Learning Outcomes 1 Chapter 5z-Scores: Location of Scores in a Distribution Understand z-score as location in distribution Transform X value into z-score Transform z-score into X value Describe effects of standardizing a distribution Transform
Arizona - PSYC - 230
PSY230 Formula Reminder/Review Sheet SS =X2( X ) N2df = n-1 Population Sample2=SS Ns2 =SS n 1=SS Ns=SS n 1M=NsM=s2 nz=M M=M 2t=NM sM=M s2 nFormula sheet comparing formulas for populations and samples Chapters 5-9
Arizona - PSYC - 230
PhoenixCollege SummerI2010SummerI2010ScheduleforIntroductiontoStatistics PSY230sections11992 MondayandWednesday,6:00pm8:35pmWeek Date 31May 2Jun 2 7Jun 9Jun 3 14Jun 16Jun 4 21Jun 23Jun 5 28Jun 30Jun 6 5Jul 7Jul 7 12Jul 14Jul 8 19Jul Day Mon Wed Mon Wed
Arizona - PSYC - 230
PHOENIX COLLEGE PSY230 section 11992: Introduction to Statistics Instructor: Jan Binder, M.A., M.Ed.Course Description: An introduction to basic concepts in descriptive and inferential statistics with emphasis upon application to psychology. Consideratio
Green River Community College - BIO - 160
Deep Ocean Currents (Global Conveyor Belt) Invisible to us terrestrial creatures, an underwater current circles the globe with a force 16 times as strong as all the world's rivers combined [source: NOAA: "Ocean"]. This deep-water current is known as thegl
University of Phoenix - ACC - 280
Axia College MaterialAppendix F Closing Entries and a Post-closing Trial BalanceJournalize Closing EntriesUse this template to journalize the closing entries for Goode Company at April 30, 2008.GOODE COMPANY Closing Entries at April 30, 2008DATEApr
McGill - EDKP - 261
Jennyfer Hamilton-Caron 260427411Wednesday, October 5, 2010Fetal growth, early postnatal growth and motor development in Pakistani infantsBy YB Cheung, PSF Yip and JPE Karlberg International Journal of Epidemiology 2001; 30(1): 66-74Published in Febru
Phoenix - CRT - 205
CRT 205: Capstone Checkpoint I believe that thinking critically will influence the way I read by attracting my focus to what it is the writer or author is saying or the message that they are trying to convey. It will aid in my writing by providing me the
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB200F Course Name: Intro to Biochemistry Paper: 1 (Practical) Date: 7 June 2002 No.of pages: 4 Marks: 117 Time: 3 Hours Venue: RW James A - p.m. Attachments: 2 pages & graph pap
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB200F Course Name: Intro to Biochemistry Paper: 2 (Theory) Date: 18 June 2002 No.of pages: 6 Marks: 120 Time: 3 Hours Venue: Zoo 1 - a.m. Attachments: 2 pages & graph paper ANSW
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB200F Course Name: Intro to Biochemistry Paper: 1 (Practical) Date: 6 June 2003 No.of pages: 5 Marks: 104 Time: 3 Hours Venue: SC 2 - p.m. Attachments: 2 pages & graph paper ANS
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB200F Course Name: Intro to Biochemistry Paper: 1 Date: 10 June 2005 No.of pages: 14 Marks:130 Time: 3 Hours Venue: DO 1 - 09h00 Attachments: 2 pages & graph paper ANSWER ALL TH
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB201S Paper: 1 No.of pages: 12 Time: 3 Hours Course Name: Molecular Biology & Physiological Biochemistry Date: 31 October 2005 Marks: 129 Venue: DO1 Time: 14h00ANSWER ALL THE Q
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB201S Deferred Paper: 1 No.of pages: 10 Time: 3 Hours 1 x Data sheet attached Course Name: Molecular Biology & Physiological Biochemistry Date: 25 Jan 2006 p.m. Marks: 136 Venue
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB201S Paper: (Practical) No.of pages: 3 Marks: 82 Course Name: Molecular Biology & Physiological Biochemistry Date: 20 October 2005 Time: 09h00 11.00 am (2 Hours) Venue: NSLTAN
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB2001S Paper: 1 (Theory) No.of pages: 14 Time: 3 Hours Additional: Graph paper and Data Sheet Course Name: Molecular Biology & Physiological Biochemistry Date: 2 Nov 2007 @ 17h0
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB2014F Paper: 1 (Theory) No.of pages: 11 Time: 3 Hours Attachment: 2 pages data sheet Course Name: Molecular Components of Cells Date: 5 June 2008 Marks: 120 Venue: LS 2A Time:
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB2014F Course Name: Macromolecules Test 2 May 2008(Total = 60 marks) (note that multiple choice questions will be subjected to negative marking) SECTION A (40 marks) Dr J Rodri
Alabama - BLY - 440
Chapter 10What are the structure and chemistry of nit rogeneous bases?oKnow how to draw all 5 What are nucleosides? Structure and chem. Of nucleotides What are nucleic acids What are the different classes of nucleic acids Are nucleic acids susceptibl
Alabama - BLY - 440
Name_ CHEM 431/531 - Biochemistry I/Exam III/November 06, 2006Part I: Hemoglobin and Cooperativity- Answer ONLY 4 out of the 8 questions.1. Why is it advantageous for hemoglobin to have allosteric properties? Hemoglobin binds oxygen in a positive cooper
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology MCB200F : Introduction to Biochemistry Paper 1 Time: 3 hours June 2001 Marks: 89ANSWER ALL THE QUESTIONS In the interest of economy please write on both sides of the exam script Please answer
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology MCB200F : Introduction to Biochemistry Paper 2 Time: 3 hours June 2001 Marks: 139ANSWER ALL THE QUESTIONS In the interest of economy please write on both sides of the exam script Please answe
Alabama - BLY - 440
Chapter 3: Nucleotides, Nucleic Acids, and Genetic InformationMatchingA) B) C) D) E) F) G) H) I) J) K) L) diploid phosphodiester probe pyrimidine introns cloning transformed exons ampicillin autoradiography chain-terminator purine1. Cytosine, uracil, a
Alabama - BLY - 440
Chapter 4: Amino AcidsMatchingA) B) C) D) E) F) G) H) I) J) K) L) M) uncharged deprotonated three b-amino group two C-terminus lysine racemic mixture zero protonated isoleucine tryptophan phenylalanine1. When a peptide bond is formed, an _ reacts with
Alabama - BLY - 440
Chapter 5: Proteins: Primary StructureMatchingA) B) C) D) E) F) G) H) I) J) K) L) M) electrophoresis hydrophobic enzyme-linked immunosorbent assay three-dimensional shape N-terminal amino acid negative charge nucleases chromophore foaming high level exp
Alabama - BLY - 440
Chapter 6: Proteins: Three-Dimensional StructureMatchingFor questions 1-10: A) tertiary structure B) keratin C) molecular chaperone D) hydropathy value E) cis F) trans G) forbidden conformation H) regular secondary structure I) collagen J) peptide group
Alabama - BLY - 440
Chapter 9: Lipids and Biological MembranesMatchingA) B) C) D) E) F) G) H) I) J) K) L) M) amphiphilic vitamin D arachidonic acid phosphatidylethanolamine steroid gangliosides phosphatidylserine glycerophospholipids sphingomyelin cholesterol triacylglycer
Alabama - BLY - 440
Membrane TransportMatchingA) B) C) D) E) F) G) H) I) J) K) L) porins gap junctions symporter active ion channel secondary active channel-forming carrier passive-mediated uniporter simple diffusion anti-ion transport1. _ ionophores are transporters that
Alabama - BLY - 440
Chapter 11: Enzyme CatalysisMatchingA) B) C) D) E) F) G) H) I) J) K) L) M) N) high deprotonated protonated least resistance motion rate-determining leaving group short peptides amino acid low coenzymes concerted acid-base orient oxidoreductase1. For ef
Alabama - BLY - 440
Chapter 12: Enzyme Kinetics, Inhibition and ControlMatchingA) B) C) D) E) F) G) H) I) J) K) L) M) isozymes substrate binding rate constant Ping Pong bimolecular ES complex large KD mixed inhibition unimolecular [A]2 competitive inhibition phosphorylatio
Alabama - BLY - 440
Chapter 2Water: The Medium of LifeChapter 2 Water: The Medium of Life 1. Properties of water that render it so suited to its role as a medium of life include all EXCEPT: a. Unrivaled ability to form hydrogen bonds. b. Unusually high dielectric constant
South Alabama - BLY - 302
BLY302 GENETICS!FALL 2010POPULATION GENETICS PROBLEMS 1. Voles (Microtus ochrogaster) were trapped in old elds in southern Indiana and were genotyped for a transferrin locus. The following numbers of genotypes were recorded, where TE and TF represent di
South Alabama - BLY - 302
B LYjO2 G ENETICSFALL2 O1OPOPULATIONENETICS ROBLEMS G P 1. V oles( Microtus chrogaster)eret rappedn o ldf ieldsi n s outhernndiana ndw ere w i l o a genotyped a t ransferrin l ocus.T hef ollowing umbers f g enotypes erer ecorded, n w f or o whereI EandI
South Alabama - BLY - 302
BLY302 GENETICS!FALL 2010POPULATION GENETICS PROBLEM SET 2 1. Given population genotype frequencies A1A1 = 0.14, A1A2 = 0.40, and A2A2 = 0.46, what is the frequency of the A1 allele in the population? Assuming no selection, random genetic drift, migrati
South Alabama - BLY - 302
BLY302 GENETICS !FALL 2010QUANTITATIVE GENETICS PROBLEM-SOLVING 1. A dark-red strain and a white strain of wheat are crossed and produce an intermediate, medium-red F1. When the F1 plants are interbred, an F2 generation is produced in a ratio of 1 dark-
South Alabama - BLY - 302
.:1,4-q-+-"np+\ ' p*t?"tu)s+nts aJ 5 S s Jtr? :; rScfw_1 lr-# p*T scfw_ -|.0\'l tYv:-t.,+-4)" u.rsYa)2 + riA l \ allitIwvLot / | 4r'7 / \Vot/t 4t /t b ltrbLI7T @L4# -,rv l .-4Jl3 t ' rl l -A p i cfw_ t ,o"^-o-"id * US r P-VM ? vl-g'a,
South Alabama - BLY - 302
Transcription problem solving key (Problem 1)Transcription problem solving key (Problem 2)antisense DNA3 - CCGCTACCCGTTATTTGGCCCGGTCATTCG - 5antisense 3 C sense 5 G 5 G 3 CG C C G T A A U A T U A C G G C C G G C A T U A C G G C T A A U G C C G C G G
South Alabama - BLY - 302
BLY 302!Fall 2010PROBLEM SOLVING: DNA REPLICATION / TRANSCRIPTION / TRANSLATION 1. Use the attached codon dictionary to complete the following table. Assume that reading is from left to right and that the columns represent transcriptional and translatio
South Alabama - BLY - 302
BLY302FALL 2010PRACTICE PROBLEMS FOR EXAM 2 Q1 If the recombination frequency between genes (A) and (B) is 5.3%, what is the distance between the genes in map units on the linkage map?Q2 Assume that the coefficient of coincidence (CC) for a map distanc
South Alabama - BLY - 302
BLY302FALL 2010PRACTICE PROBLEMS FOR EXAM 2 Q1 If the recombination frequency between genes (A) and (B) is 5.3%, what is the distance between the genes in map units on the linkage map? ANSWER: This recombination frequency is small, which indicates these
South Alabama - BLY - 302
BLY302!FALL 2010LINKAGE PROBLEM SOLVING PROBLEM SOLVING. Solve the following problem, answering all associated questions. Use the following blank space for your calculations (18 pts total; 3 pts per question). Consider a three-point testcross involving
South Alabama - BLY - 302
South Alabama - BLY - 302
BLY302 FALL 2010 - PRACTICE PROBLEMS FOR EXAM 11. Honey bees have a haplo-diploid sex determination system where females develop from a fertilized egg (they are diploid, having one allele from the female queen and 1 allele from the male) and males develo
South Alabama - BLY - 302
South Alabama - BLY - 302
i * |ll NlZaUlY\J PW)fb 8ff3s P fax iG " oOfC @ r) w @(9/-*i\cCCxgg Lc'hx C c Q- x C ; 9Cc "h X * *a.-\1 a -%ac-cfw_r3:l 3', t l: |a f t g - " * . , t c - lu ' ^ : a -il.Luun ^ u1nul, : |,"'"*tJoa@ C"\ x e 9.t:I^ 'dr"*Lzh;-,- o-tc*1,*t+@k
South Alabama - BLY - 302
BLY302FALL 2010PROBLEM SOLVING: MENDELIAN GENETICS SET 2 1. In rabbits, C = agouti coat color, cch = chinchilla, ch = Himalayan, and c = albino. The four alleles constitute a multiple allelic series. The agouti C is dominant to the other three, c is rec
South Alabama - BLY - 302
BLY302 GeneticsFALL 2010PROBLEM SOLVING: MENDELIAN GENETICS 1. In tomatoes, red fruit color is dominant to yellow. Suppose a tomato plant homozygous for red is crossed with one homozygous for yellow. Determine the appearance of: a. the F1 tomatoes b. th
Alabama - BLY - 440
Chapter 1: Introduction to the Chemistry of LifeMatchingA) B) C) D) E) F) G) H) I) J) K) L) M) Phylogenetic q/T Carbon H H TS halobacteria equilibrium entropy flux polymers G[ note: prime remains but apostrophe removed] thermophiles Nitrogen1. The most
UCSD - ECE - 35
ECE35 Winter 2011: Course OutlineWeek 1: Basic Circuit Concepts and Analysis Course goals and structure Charge, current, voltage, resistors, power and energy Circuit structure (nodes & elements, active / passive) Ideal voltage and current sources Voltage
Keller Graduate School of Management - FIN - 515
Gurmeet Chadha Homework Chapter 22 22-2 The main two reasons companies hold cash is for transactions and compensating to banks for providing loans and services. To maintain an effective and efficient business operations firms have to have cash balances to
Indian Institute of Technology, Roorkee - GEOL - 1
2010Geology&GeophysicsinOilExplorationMahmoud Sroor Geology&GeophysicsinOilExploration ContentsIntroduction.3 Chapter 1: Sedimentary Rocks .4 Chapter 2: Depositional Environments 14 Chapter 3: Structural Geology .18 Chapter 4: Petroleum Geology .2
Phoenix - RES - 341
week 5 E-Text . 12.48 In the following regression, X = weekly pay, Y = income tax withheld, and n = 35 McDonalds employees. (a) Write the fitted regression equation. (b) State the degrees of freedom for a two-tailed test for zero slope, and use Appendix D
DeVry Chicago - BIS - 115
[ Type the company name] [ Type the company name]11/17/2010XYZ Corporation Charitable Trust123 Adams Street Pittsburgh, PA 15697Dan Reed 901 North Street Pittsburgh, PA 15697Dear Dan Thank you for your generous donation to the XYZ Corporation Charita
USC - ANTH - 200
A nth 200g Midterm 1 Key Fall 2010 1. sympatric 2. mutation 3. biogeography, embryology Also accept for full credit (1 pt each): Fossil record, anatomy, morphology, paleontology Also accept for pa rtial credit (0.5 pt): geology, Malthus resource limi ting
USC - ANTH - 200
Anth26310/13Notes15:30 Race,Representation,andRealityTV(TerrionsLecture) Why? Popularmediaasanimportantsiteofintervention Hall:Themediaconstructforusadefinitionofwhatrace[andgender]is,what meaningtheimageryofracecarries,andwhattheproblemofrace[andgende
USC - ANTH - 200
Natalie Del Favero Anth 200 L ab A nnual Editions: Art icles 21, 23, 24, 25, 26, 27 21. I wonder how Johansons find resonated in the scientific community of his time? Were his contemporaries jealous of his quick discovery? Johanson was very lucky to stumb