Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more.
Course Hero has millions of course specific materials providing students with the best way to expand
their education.
Below is a small sample set of documents:
Arizona - PSYC - 230
PSY230 Chapter 1 Notes1/25/2010Chapter 1 Learning OutcomesChapter 1: Introduction to StatisticsPowerPoint Lecture Slides1 2 3 4 51/21/2010 Knowkeystatisticalterms Knowkeymeasurementterms Knowkeyresearchterms Knowtheplaceofstatisticsinscience Unders
Arizona - PSYC - 230
2/3/2010Chapter 2 Learning Outcomes1 Understandfrequencydistribution Organizedataintoregularfrequencydistribution Organizedataintogroupedfrequencydistribution i Understanddatapresentedinatable Organizedataintofrequencydistributiongraphs Understanddatat
Arizona - PSYC - 230
Chapter 3Central Tendency Central tendency is the concept of developing or defining a SINGLE value that is representative of the distribution What is typical for a large population Not exact Accuracy dictated by the shape of the distributionThree Main
Arizona - PSYC - 230
Variability Chapter 4Variability Measure of the degree to which the scores in a distribution are spread out or clustered together clustered together Helps describe the distribution Measure of how well an individual score represents the distributionThre
Arizona - PSYC - 230
Chapter 5 Learning Outcomes 1 Chapter 5z-Scores: Location of Scores in a Distribution Understand z-score as location in distribution Transform X value into z-score Transform z-score into X value Describe effects of standardizing a distribution Transform
Arizona - PSYC - 230
PSY230 Formula Reminder/Review Sheet SS =X2( X ) N2df = n-1 Population Sample2=SS Ns2 =SS n 1=SS Ns=SS n 1M=NsM=s2 nz=M M=M 2t=NM sM=M s2 nFormula sheet comparing formulas for populations and samples Chapters 5-9
Arizona - PSYC - 230
PhoenixCollege SummerI2010SummerI2010ScheduleforIntroductiontoStatistics PSY230sections11992 MondayandWednesday,6:00pm8:35pmWeek Date 31May 2Jun 2 7Jun 9Jun 3 14Jun 16Jun 4 21Jun 23Jun 5 28Jun 30Jun 6 5Jul 7Jul 7 12Jul 14Jul 8 19Jul Day Mon Wed Mon Wed
Arizona - PSYC - 230
PHOENIX COLLEGE PSY230 section 11992: Introduction to Statistics Instructor: Jan Binder, M.A., M.Ed.Course Description: An introduction to basic concepts in descriptive and inferential statistics with emphasis upon application to psychology. Consideratio
Green River Community College - BIO - 160
Deep Ocean Currents (Global Conveyor Belt) Invisible to us terrestrial creatures, an underwater current circles the globe with a force 16 times as strong as all the world's rivers combined [source: NOAA: "Ocean"]. This deep-water current is known as thegl
University of Phoenix - ACC - 280
Axia College MaterialAppendix F Closing Entries and a Post-closing Trial BalanceJournalize Closing EntriesUse this template to journalize the closing entries for Goode Company at April 30, 2008.GOODE COMPANY Closing Entries at April 30, 2008DATEApr
McGill - EDKP - 261
Jennyfer Hamilton-Caron 260427411Wednesday, October 5, 2010Fetal growth, early postnatal growth and motor development in Pakistani infantsBy YB Cheung, PSF Yip and JPE Karlberg International Journal of Epidemiology 2001; 30(1): 66-74Published in Febru
Phoenix - CRT - 205
CRT 205: Capstone Checkpoint I believe that thinking critically will influence the way I read by attracting my focus to what it is the writer or author is saying or the message that they are trying to convey. It will aid in my writing by providing me the
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB200F Course Name: Intro to Biochemistry Paper: 1 (Practical) Date: 7 June 2002 No.of pages: 4 Marks: 117 Time: 3 Hours Venue: RW James A - p.m. Attachments: 2 pages & graph pap
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB200F Course Name: Intro to Biochemistry Paper: 2 (Theory) Date: 18 June 2002 No.of pages: 6 Marks: 120 Time: 3 Hours Venue: Zoo 1 - a.m. Attachments: 2 pages & graph paper ANSW
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB200F Course Name: Intro to Biochemistry Paper: 1 (Practical) Date: 6 June 2003 No.of pages: 5 Marks: 104 Time: 3 Hours Venue: SC 2 - p.m. Attachments: 2 pages & graph paper ANS
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB200F Course Name: Intro to Biochemistry Paper: 1 Date: 10 June 2005 No.of pages: 14 Marks:130 Time: 3 Hours Venue: DO 1 - 09h00 Attachments: 2 pages & graph paper ANSWER ALL TH
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB201S Paper: 1 No.of pages: 12 Time: 3 Hours Course Name: Molecular Biology & Physiological Biochemistry Date: 31 October 2005 Marks: 129 Venue: DO1 Time: 14h00ANSWER ALL THE Q
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB201S Deferred Paper: 1 No.of pages: 10 Time: 3 Hours 1 x Data sheet attached Course Name: Molecular Biology & Physiological Biochemistry Date: 25 Jan 2006 p.m. Marks: 136 Venue
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB201S Paper: (Practical) No.of pages: 3 Marks: 82 Course Name: Molecular Biology & Physiological Biochemistry Date: 20 October 2005 Time: 09h00 11.00 am (2 Hours) Venue: NSLTAN
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB2001S Paper: 1 (Theory) No.of pages: 14 Time: 3 Hours Additional: Graph paper and Data Sheet Course Name: Molecular Biology & Physiological Biochemistry Date: 2 Nov 2007 @ 17h0
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB2014F Paper: 1 (Theory) No.of pages: 11 Time: 3 Hours Attachment: 2 pages data sheet Course Name: Molecular Components of Cells Date: 5 June 2008 Marks: 120 Venue: LS 2A Time:
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology Course Code: MCB2014F Course Name: Macromolecules Test 2 May 2008(Total = 60 marks) (note that multiple choice questions will be subjected to negative marking) SECTION A (40 marks) Dr J Rodri
Alabama - BLY - 440
Chapter 10What are the structure and chemistry of nit rogeneous bases?oKnow how to draw all 5 What are nucleosides? Structure and chem. Of nucleotides What are nucleic acids What are the different classes of nucleic acids Are nucleic acids susceptibl
Alabama - BLY - 440
Name_ CHEM 431/531 - Biochemistry I/Exam III/November 06, 2006Part I: Hemoglobin and Cooperativity- Answer ONLY 4 out of the 8 questions.1. Why is it advantageous for hemoglobin to have allosteric properties? Hemoglobin binds oxygen in a positive cooper
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology MCB200F : Introduction to Biochemistry Paper 1 Time: 3 hours June 2001 Marks: 89ANSWER ALL THE QUESTIONS In the interest of economy please write on both sides of the exam script Please answer
Alabama - BLY - 440
University of Cape Town Department of Molecular & Cell Biology MCB200F : Introduction to Biochemistry Paper 2 Time: 3 hours June 2001 Marks: 139ANSWER ALL THE QUESTIONS In the interest of economy please write on both sides of the exam script Please answe
Alabama - BLY - 440
Chapter 3: Nucleotides, Nucleic Acids, and Genetic InformationMatchingA) B) C) D) E) F) G) H) I) J) K) L) diploid phosphodiester probe pyrimidine introns cloning transformed exons ampicillin autoradiography chain-terminator purine1. Cytosine, uracil, a
Alabama - BLY - 440
Chapter 4: Amino AcidsMatchingA) B) C) D) E) F) G) H) I) J) K) L) M) uncharged deprotonated three b-amino group two C-terminus lysine racemic mixture zero protonated isoleucine tryptophan phenylalanine1. When a peptide bond is formed, an _ reacts with
Alabama - BLY - 440
Chapter 5: Proteins: Primary StructureMatchingA) B) C) D) E) F) G) H) I) J) K) L) M) electrophoresis hydrophobic enzyme-linked immunosorbent assay three-dimensional shape N-terminal amino acid negative charge nucleases chromophore foaming high level exp
Alabama - BLY - 440
Chapter 6: Proteins: Three-Dimensional StructureMatchingFor questions 1-10: A) tertiary structure B) keratin C) molecular chaperone D) hydropathy value E) cis F) trans G) forbidden conformation H) regular secondary structure I) collagen J) peptide group
Alabama - BLY - 440
Chapter 9: Lipids and Biological MembranesMatchingA) B) C) D) E) F) G) H) I) J) K) L) M) amphiphilic vitamin D arachidonic acid phosphatidylethanolamine steroid gangliosides phosphatidylserine glycerophospholipids sphingomyelin cholesterol triacylglycer
Alabama - BLY - 440
Membrane TransportMatchingA) B) C) D) E) F) G) H) I) J) K) L) porins gap junctions symporter active ion channel secondary active channel-forming carrier passive-mediated uniporter simple diffusion anti-ion transport1. _ ionophores are transporters that
Alabama - BLY - 440
Chapter 11: Enzyme CatalysisMatchingA) B) C) D) E) F) G) H) I) J) K) L) M) N) high deprotonated protonated least resistance motion rate-determining leaving group short peptides amino acid low coenzymes concerted acid-base orient oxidoreductase1. For ef
Alabama - BLY - 440
Chapter 12: Enzyme Kinetics, Inhibition and ControlMatchingA) B) C) D) E) F) G) H) I) J) K) L) M) isozymes substrate binding rate constant Ping Pong bimolecular ES complex large KD mixed inhibition unimolecular [A]2 competitive inhibition phosphorylatio
Alabama - BLY - 440
Chapter 2Water: The Medium of LifeChapter 2 Water: The Medium of Life 1. Properties of water that render it so suited to its role as a medium of life include all EXCEPT: a. Unrivaled ability to form hydrogen bonds. b. Unusually high dielectric constant
South Alabama - BLY - 302
BLY302 GENETICS!FALL 2010POPULATION GENETICS PROBLEMS 1. Voles (Microtus ochrogaster) were trapped in old elds in southern Indiana and were genotyped for a transferrin locus. The following numbers of genotypes were recorded, where TE and TF represent di
South Alabama - BLY - 302
B LYjO2 G ENETICSFALL2 O1OPOPULATIONENETICS ROBLEMS G P 1. V oles( Microtus chrogaster)eret rappedn o ldf ieldsi n s outhernndiana ndw ere w i l o a genotyped a t ransferrin l ocus.T hef ollowing umbers f g enotypes erer ecorded, n w f or o whereI EandI
South Alabama - BLY - 302
BLY302 GENETICS!FALL 2010POPULATION GENETICS PROBLEM SET 2 1. Given population genotype frequencies A1A1 = 0.14, A1A2 = 0.40, and A2A2 = 0.46, what is the frequency of the A1 allele in the population? Assuming no selection, random genetic drift, migrati
South Alabama - BLY - 302
BLY302 GENETICS !FALL 2010QUANTITATIVE GENETICS PROBLEM-SOLVING 1. A dark-red strain and a white strain of wheat are crossed and produce an intermediate, medium-red F1. When the F1 plants are interbred, an F2 generation is produced in a ratio of 1 dark-
South Alabama - BLY - 302
.:1,4-q-+-"np+\ ' p*t?"tu)s+nts aJ 5 S s Jtr? :; rScfw_1 lr-# p*T scfw_ -|.0\'l tYv:-t.,+-4)" u.rsYa)2 + riA l \ allitIwvLot / | 4r'7 / \Vot/t 4t /t b ltrbLI7T @L4# -,rv l .-4Jl3 t ' rl l -A p i cfw_ t ,o"^-o-"id * US r P-VM ? vl-g'a,
South Alabama - BLY - 302
Transcription problem solving key (Problem 1)Transcription problem solving key (Problem 2)antisense DNA3 - CCGCTACCCGTTATTTGGCCCGGTCATTCG - 5antisense 3 C sense 5 G 5 G 3 CG C C G T A A U A T U A C G G C C G G C A T U A C G G C T A A U G C C G C G G
South Alabama - BLY - 302
BLY 302!Fall 2010PROBLEM SOLVING: DNA REPLICATION / TRANSCRIPTION / TRANSLATION 1. Use the attached codon dictionary to complete the following table. Assume that reading is from left to right and that the columns represent transcriptional and translatio
South Alabama - BLY - 302
BLY302FALL 2010PRACTICE PROBLEMS FOR EXAM 2 Q1 If the recombination frequency between genes (A) and (B) is 5.3%, what is the distance between the genes in map units on the linkage map?Q2 Assume that the coefficient of coincidence (CC) for a map distanc
South Alabama - BLY - 302
BLY302FALL 2010PRACTICE PROBLEMS FOR EXAM 2 Q1 If the recombination frequency between genes (A) and (B) is 5.3%, what is the distance between the genes in map units on the linkage map? ANSWER: This recombination frequency is small, which indicates these
South Alabama - BLY - 302
BLY302!FALL 2010LINKAGE PROBLEM SOLVING PROBLEM SOLVING. Solve the following problem, answering all associated questions. Use the following blank space for your calculations (18 pts total; 3 pts per question). Consider a three-point testcross involving
South Alabama - BLY - 302
South Alabama - BLY - 302
BLY302 FALL 2010 - PRACTICE PROBLEMS FOR EXAM 11. Honey bees have a haplo-diploid sex determination system where females develop from a fertilized egg (they are diploid, having one allele from the female queen and 1 allele from the male) and males develo
South Alabama - BLY - 302
South Alabama - BLY - 302
i * |ll NlZaUlY\J PW)fb 8ff3s P fax iG " oOfC @ r) w @(9/-*i\cCCxgg Lc'hx C c Q- x C ; 9Cc "h X * *a.-\1 a -%ac-cfw_r3:l 3', t l: |a f t g - " * . , t c - lu ' ^ : a -il.Luun ^ u1nul, : |,"'"*tJoa@ C"\ x e 9.t:I^ 'dr"*Lzh;-,- o-tc*1,*t+@k
South Alabama - BLY - 302
BLY302FALL 2010PROBLEM SOLVING: MENDELIAN GENETICS SET 2 1. In rabbits, C = agouti coat color, cch = chinchilla, ch = Himalayan, and c = albino. The four alleles constitute a multiple allelic series. The agouti C is dominant to the other three, c is rec
South Alabama - BLY - 302
BLY302 GeneticsFALL 2010PROBLEM SOLVING: MENDELIAN GENETICS 1. In tomatoes, red fruit color is dominant to yellow. Suppose a tomato plant homozygous for red is crossed with one homozygous for yellow. Determine the appearance of: a. the F1 tomatoes b. th
Alabama - BLY - 440
Chapter 1: Introduction to the Chemistry of LifeMatchingA) B) C) D) E) F) G) H) I) J) K) L) M) Phylogenetic q/T Carbon H H TS halobacteria equilibrium entropy flux polymers G[ note: prime remains but apostrophe removed] thermophiles Nitrogen1. The most
UCSD - ECE - 35
ECE35 Winter 2011: Course OutlineWeek 1: Basic Circuit Concepts and Analysis Course goals and structure Charge, current, voltage, resistors, power and energy Circuit structure (nodes & elements, active / passive) Ideal voltage and current sources Voltage
Keller Graduate School of Management - FIN - 515
Gurmeet Chadha Homework Chapter 22 22-2 The main two reasons companies hold cash is for transactions and compensating to banks for providing loans and services. To maintain an effective and efficient business operations firms have to have cash balances to
Indian Institute of Technology, Roorkee - GEOL - 1
2010Geology&GeophysicsinOilExplorationMahmoud Sroor Geology&GeophysicsinOilExploration ContentsIntroduction.3 Chapter 1: Sedimentary Rocks .4 Chapter 2: Depositional Environments 14 Chapter 3: Structural Geology .18 Chapter 4: Petroleum Geology .2
Phoenix - RES - 341
week 5 E-Text . 12.48 In the following regression, X = weekly pay, Y = income tax withheld, and n = 35 McDonalds employees. (a) Write the fitted regression equation. (b) State the degrees of freedom for a two-tailed test for zero slope, and use Appendix D
DeVry Chicago - BIS - 115
[ Type the company name] [ Type the company name]11/17/2010XYZ Corporation Charitable Trust123 Adams Street Pittsburgh, PA 15697Dan Reed 901 North Street Pittsburgh, PA 15697Dear Dan Thank you for your generous donation to the XYZ Corporation Charita
USC - ANTH - 200
A nth 200g Midterm 1 Key Fall 2010 1. sympatric 2. mutation 3. biogeography, embryology Also accept for full credit (1 pt each): Fossil record, anatomy, morphology, paleontology Also accept for pa rtial credit (0.5 pt): geology, Malthus resource limi ting
USC - ANTH - 200
Anth26310/13Notes15:30 Race,Representation,andRealityTV(TerrionsLecture) Why? Popularmediaasanimportantsiteofintervention Hall:Themediaconstructforusadefinitionofwhatrace[andgender]is,what meaningtheimageryofracecarries,andwhattheproblemofrace[andgende
USC - ANTH - 200
Natalie Del Favero Anth 200 L ab A nnual Editions: Art icles 21, 23, 24, 25, 26, 27 21. I wonder how Johansons find resonated in the scientific community of his time? Were his contemporaries jealous of his quick discovery? Johanson was very lucky to stumb