1 Page

Module 6 CCC11

Course: MNG 500, Spring 2011
School: Amherst
Rating:
 
 
 
 
 

Word Count: 258

Document Preview

Curtis 1. Dad and Natalies grandmother are interested in investing $5,000 each in the new business venture. Curtis and Natalie are considering issuing them preferred shares. What would be the advantage of issuing them preferred stock instead of common? The biggest advantage of issuing preferred stock over common stock would be that preferred stockholders do not have voting ability. If Natalies business gave the...

Register Now

Unformatted Document Excerpt

Coursehero >> Massachusetts >> Amherst >> MNG 500

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Curtis 1. Dad and Natalies grandmother are interested in investing $5,000 each in the new business venture. Curtis and Natalie are considering issuing them preferred shares. What would be the advantage of issuing them preferred stock instead of common? The biggest advantage of issuing preferred stock over common stock would be that preferred stockholders do not have voting ability. If Natalies business gave the investors, Curtiss Dad and her Grandmother, preferred stock they would collect dividends from the business throughout its operational life but they would not have the ability to weigh in on issues that would normally involve stock holders. 2. What would be the advantages and disadvantages of issuing cumulative preferred? Advantages of cumulative preferred is stock the holder of the stock is given dividends for the year in which they are declared and also for previous years that have been missed. Disadvantages of cumulative preferred stock is that these dividends have to be paid before common stock dividends are paid. 3. Our lawyer sent us a bill for $750. When we talked the bill over with her, she said she would be willing to receive common stock in our corporation instead of cash. We would be happy to issue her stock, but were worried about accounting for this transaction. Can we do this? If so, how do we determine how many shares to give her? Giving common stock as a payment is a possibility. The cost of the common stock it is determined by fair market value then just equal the debt amount with common stock.
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Amherst - MNG - 500
Allen Brown Module 7 CCC 12 (A) Cash Flow: Operations Net Income Adjustments Cash Provided: Depreciation Loss on Sales Accounts Receivable Inventory Prepaid Expense Accounts Payable Taxes Salaries Interest Net Cash Provided Cash Flow: Investing Sales of C
Amherst - MNG - 500
Module One Allen Brown Accounting 250 Continuing Cookie Chronicle After investigating the different forms of business organization, Natalie Koebel decides to operate her business as a corporation, Cookie Creations Inc., and she begins the process of getti
Amherst - MNG - 500
(a)1. The mixers should be classified as inventory as Natalie will attempt to resale them. 2. A perpetual inventory system will provide better control over inventory because you are dealing with high-value items you should use this system. 3. You still n
Amherst - MNG - 500
(a)1. The mixers should be classified as inventory as Natalie will attempt to resale them. 2. A perpetual inventory system will provide better control over inventory because you are dealing with high-value items you should use this system. 3. You still n
Amherst - MNG - 500
(a) COST OF GOODS AVAILABLE FOR SALE Explanation Units Unit Cost Total Cost Beginning 3 $545.00 $1,635.00 Inventory Purchase 2 550.00 1,100.00 1 2 3 11 567.00 561.00 573.33 567.00 1,122.00 1,720.00 $6,144.00Date Feb. 1 Feb. 2 Mar. Purchase 2 Apr. 1 Purch
Amherst - MNG - 500
Prokaryotes and Eukaryotes1Running Head: Prokaryotes and EukaryotesAllen Brown BIO 100 Biology Concepts Module 2 Assignment 11/04/2009Prokaryotes and Eukaryotes2Prokaryotes are single-celled organisms, such as bacteria, and are roughly one micromete
Amherst - MNG - 500
Collaborative Learning Community: Mendelian Genetics Though data are collected by individuals, the group is responsible for submitting a single lab report. Members of a group who do not post their data to the CLC group page and do not contribute to the di
Amherst - MNG - 500
Title: Diffusion Purpose: The diffusion lab was designed to allow us, as students, to see how at different temperatures water molecules increase and decrease the rate in which they move. Procedure: i) Materials (1) Three large containers, such as pitchers
Amherst - MNG - 500
ENVIRONMENTAL FACTORS THAT AFFECT PLANT GROWTHMG Manual Reference Ch. 1, pp. 30 - 33Plant growth and distribution are limited by the environment. If any one environmental factor is less than ideal it will become a limiting factor in plant growth. Limiti
Amherst - MNG - 500
Key aspects of fundraising: 1. Consider the cost- If you decide to make it a public fundraising event, think about cost,sponsorship, and participation. An example would be a car wash, which is a very common fundraiser for youth groups and clubs. Cost wou
Amherst - MNG - 500
LabAssignments Assignments1) Individual: Individual: Photosynthesis Lab a) The purpose of this laboratory exercise is to test the impact of light of different wavelengths on a plants ability to survive. This laboratory exercise requires preparation and s
Amherst - MNG - 500
Title: Osmosis Purpose: The Osmosis Lab was designed to allow us, as students, to view the transferring energy of molecules; by a raisin or grape increasing or decreasing in size depending on a strictly water solution or a water and salt mixed solution sh
Amherst - MNG - 500
Title: Diffusion Purpose: The diffusion lab was designed to allow us, as students, to see how at different temperatures water molecules increase and decrease the rate in which they move. Procedure: i) Materials (1) Three large containers, such as pitchers
Amherst - MNG - 500
Module 4 Concept Exercise: Solving Linear Equations and Inequalities ii) A bike shop rents mountain bikes for a $8.50 insurance charge plus $3.50 for each hour. For how many hours can a person rent a bike with $32.50. (1) Part A: Solve the above problem u
Amherst - MNG - 500
Delacroix1Running Head: DelacroixModule 6: Liberty Leading the People Allen Brown UNV 200 Grand Canyon University August 8th 2009Delacroix2Ferdinand Victor Eugene Delacroix (1798-1863), a French painter of romantic period known for his exuberant col
Amherst - MNG - 500
Title: Osmosis Purpose: The Osmosis Lab was designed to allow us, as students, to view the transferring energy of molecules; by a raisin or grape increasing or decreasing in size depending on a strictly water solution or a water and salt mixed solution sh
Amherst - MNG - 500
WILLIAM LLOYD GARRISON Running head: WILLIAM LLOYD GARRISON1Allen Brown February 19th 2010 HIS 103 American History Pre 1877WILLIAM LLOYD GARRISON William Lloyd Garrison You must be the change you want to see in your life. (About.com) This quote, from
Amherst - MNG - 500
Title: 1) Photosynthesis Lab 2) 3) Purpose: 4) 5) The purpose of this laboratory exercise is to test the impact of light of different wavelengths on a plants ability to survive. 6) 7) Procedure: 8) a) Materials 1. Clear, red, green, and blue transparent p
Amherst - MNG - 500
The Jurassic Zoo charges $28.00 for each adult admission and $12.00 for each child. The total bill for 254 people from a school trip was $3864.00. How many adults and how many children went to the zoo?28.00x+12.00y=3864.00 28.00(51)+12.00(203)=3864.00 51
Amherst - MNG - 500
MODULE ONERunning Head: MODULE ONE1Allen Brown Ethical and Legal Issues in Business BUS-340 Module One Exercise May 01, 2010MODULE ONE 1) Pringle v. Valdez (Chapter 1, Statutory Interpretation 1.)Brief: History On appeal, the court of appeals affirme
Amherst - MNG - 500
Module 21Running Head:Module 2Allen Brown Ethical and Legal Issues in Business BUS-340 Module Two Exercise May 05, 2010Module 2 1) Explorica Inc. v. EF Cultural Travel (Chapter 5, Question 9.) By definition A preliminary injunction is a court order m
Amherst - MNG - 500
Module 31Running Head: Module 3Allen Brown Ethical and Legal Issues in Business BUS-340 Module Three Exercise May 05, 2010Module 321) Stephen Gall v. McKeesport Municipal Utility (Chapter 9, Problem 9.) The Galls complaint should not be dismissed. U
Amherst - MNG - 500
M odule 41Running Head: Module 4Allen Brown Ethical and Legal Issues in Business BUS-340 Module Four Exercise May 19, 20101) Gianni Sport v. Gantos- [(Unconscionability) Chapter 15, Problem 10.]By definition Unconscionability is a contract is unconsc
Amherst - MNG - 500
Module 4: Topic and Objectives Illegality, Necessity of Writing, Rights of Third Parties, and Remedies for BreachesApply the requirements of Article 2 of the UCC to contracts for the sale of goods in commerce. Determine the legality of a contract clause.
Amherst - MNG - 500
Madoff and Enron1Running Head:Madoff and EnronAllen Brown Ethical and Legal Issues in Business BUS-340 Module Five Exercise May 29, 2010Madoff and Enron2Madoff and ENRON Bernard Madoff was a pioneer in market-making. A market-makeris a broker-deal
Amherst - MNG - 500
Ethical Elements of Marketing There are many ethical norms and practiced values which marketers attempt to practice as a principle in the marketing world. Accordingto the AMA, American Marketers Association, there are three principle norms in which marke
Amherst - MNG - 500
Employee Monitoring Employee Monitoring1Allen Brown Ethical and Legal Issues in Business BUS-340 Module Seven Exercise June 11, 2010Employee Monitoring Employee Monitoring It is important for an employer to know that their employees are doing a good jo
Amherst - MNG - 500
Accounting Ethics1Running Head: Accounting EthicsAllen Brown Ethical and Legal Issues in Business BUS-340 Module Eight Exercise June 18th 2010Accounting Ethics With the growth and development of personal computers, or PCs, and software the fields of a
Amherst - MNG - 500
DQ 1: Due by ThursdayHowaretheFederalDistrictCourts,theFederalCourtsofAppeal,andtheU.S.SupremeCourtdifferent?How aretheysimilar?Whatroledothevariouscourtsplayinmakingorinterpretinglawthatappliestobusinesses, employeesofthosefirms,andforresolvingorprevent
Amherst - MNG - 500
DQ #1 Due by Thursday Can an individual enter into a contract without being aware of it and still be bound by its terms? Why or why not? Cite an example of a voidable and nonvoidable contract. A contract would not be enforceable if a person entered one un
Amherst - MNG - 500
Do you think supporting non-competition clauses in employment agreements is good public policy? Why or why not? Provide an example that supports your position. In some cases non-competitive clauses protect both the employer and the employee. Non-competiti
Amherst - MNG - 500
How is ethics and ethical behavior apparent in corporate culture? What is the relationship between law, values, and ethical behavior? How do these work in unison to ensure business success? Are there times when law, values, and ethical behavior may not wo
Amherst - MNG - 500
Thursday Why has marketing continuously been a focus of concern in regard to both the legal and ethical representation of companies? Do you think this concern is warranted? Why or why not?Companies want to be marketed in a way which truly represents the
Amherst - MNG - 500
What are the implications of conflicts of interest and how do they impact corporations? Using the Sarbanes-Oxley Act of 2002, give an example of a potential conflict of interest that could arise in business, and your recommendation for how that conflict o
Amherst - MNG - 500
DQ #1 Due by Thursday When an employee learns of apparent illegal conduct by his/her employer, does the employee have an ethical duty to become a whistleblower? Why or why not? How should a company regulate ethical conduct within the organization? I belie
Amherst - MNG - 500
Whatarethebenefitsoffilingalawsuitasaclassaction?Arethereanydisadvantages?Giveanexampleto supportyouranswer.Aclassactionisaproceduraldevicewithinthelegalsystemthatpermitsoneormorepersonstosueasrepresentativeofalargegroupof peopleinterestedinthematteratis
Amherst - MNG - 500
Give an example of one government employee law that you think people may take advantage of and how people take advantage of it. I believe that the most abused employee law is workers compensation because both sides take advantages and cut corners. The two
Amherst - MNG - 500
MGT420 ORGANIZATIONAL BEHAVIOR AND MANAGEMENT CLC: GROUP PROJECT AGREEMENTCLC Course Information Course Name/Section Number: MGT420 Organizational Behavior and Management Justin Barclay Instructors Name: June 21, 2010 Start Date of the Course: CLC Member
Amherst - MNG - 500
Ethical Marketing Running Head: Ethical Marketing1Allen Brown Ethical and Legal Issues in Business BUS-340 Module Six Exercise June 05, 2010Ethical Marketing Ethical Elements of Marketing2There are many ethical norms and practiced values which market
Amherst - MNG - 500
Individual: Reading Genes Refer to the following nucleic acid: 5- ATGCTATCATTGACCTTGAGTTATTAA 3 1) Is this a strand of DNA or RNA? How do you know?It is DNA since there is thymine (T) not uracil (U) in the sequence 2) If DNA, what is the complementary st
Amherst - MNG - 500
Native American Culture Running Head: Native American Culture1Allen Brown January 9, 2010 Native American CultureNative American Culture2Historians believe that Native Americans came to this continent around, anywhere from 12,000 to 60,000 years ago.
Amherst - MNG - 500
Cortez1Running Head: CortezAllen Brown History Pre 1877 January 17th 2010Cortez2Before the Spaniards came to Mexico there were many premonitions which casted a vision of the coming disaster, these visions were not enough to prevent the impending ove
Amherst - MNG - 500
Colonies1Running head: ColoniesAllen Brown January 23, 2010 Religions Affect on ColoniesColonies2American colonies developed in order to escape the tyranny in which the people were facing under the rule of a God appointed king. In England the king w
Amherst - MNG - 500
Revolution1Running head: RevolutionAllen Brown January 28th 2010 HIS 103 US History Pre 1877Revolution Causes of a Revolution2The Seven Years War was fought mainly on the European continent between Great Britain and France. The battles foughtin Nor
Amherst - MNG - 500
Parliament Acts1Running head: Parliament ActsAllen Brown January 27th 2010 History 103 American History Pre 1877Parliament Acts Road to the Revolution After the Seven Years War the British were in a bad way, suffering financially from the great econom
Amherst - MNG - 500
A r t icles of the Confederation1Running Head: Articles of the ConfederationAllen Brown February 3rd 2010 History 103 US History Pre 1877Articles of the Confederation In Witness whereof we have hereunto set our hands in Congress, done at Philadelphia
Amherst - MNG - 500
Federalist and Republicans Running Head: Federalist and Republicans1Allen Brown February 5th 2010 HIS 103 US History Pre 1877Federalist and Republicans Federalist and Republicans The differences between Thomas Jefferson, founder of the Republican Party
Amherst - MNG - 500
1800-18501Running head: 1800-1850Allen Brown February 13 2010 HIS 103 American History Pre 18771800-18502Effects on Social Change: 1800-1850 From 1800 to 1850 several events occurred which shaped the face of American culture and society. These event
Amherst - MNG - 500
JEFFERSON AND JACKSON Running head: JEFFERSON AND JACKSON1Allen Brown February 11th 2010 American History Pre 1877 HIS 103JEFFERSON AND JACKSON The early presidents of the United States of America faced many obstacles; establishing a new country and fi
Amherst - MNG - 500
KING COTTON1Running head:KING COTTONAllen Brown February 18th 2010 HIS 103 American History Pre 1877KING COTTON King Cotton Seeking a life line to keep pace with the vastly growing industries of the north the southern states turned to cotton and they
Amherst - MNG - 500
PRE CIVIL WAR SOCIETY1Running head: PRE CIVIL WAR SOCIETYAllen Brown February 19th 2010 HIS 103 American History Pre 1877PRE CIVIL WAR SOCIETY2Pre Civil War Society In the years prior to the Civil War several big changes occurred which advanced the
Amherst - MNG - 500
CAUSES OF THE CIVIL WAR Running head: CAUSES OF THE CIVIL WAR1Allen Brown February 27th 2010 HIS 103 American History Pre 1877 Causes of the Civil War Beginning in the late 1700s and early 1800s the division between the northern states and the southern
Amherst - MNG - 500
Factors Effecting DevelopmentVirginiaNew EnglandPoliticalPromoted the idea of slavery as a way of growth. Government was based heavily on working economy.Wanted to limit slavery to the states in which it was already occurring. Government was based he
Amherst - MNG - 500
RADICAL REPUBLICANS1Running head: RADICAL REPUBLICANSAllen Brown February 27, 2010 HIS 103 American History Pre 1877 Radical Republicans The post Civil War reconstruction plan of the Radical Republicans was vastly different than the plan of the Preside
Amherst - MNG - 500
The Pueblo revolt was the result of un-trust on the behalf of the Natives and the lack of understanding by the Spanish settlers who were pressing there on agenda. The Natives were never very accepting of the Spanish settlers, which was a fair assessment c
Amherst - MNG - 500
WILLIAM LLOYD GARRISON Running head: WILLIAM LLOYD GARRISON1Allen Brown February 19th 2010 HIS 103 American History Pre 1877WILLIAM LLOYD GARRISON William Lloyd Garrison You must be the change you want to see in your life. (About.com) This quote, from
Amherst - MNG - 500
Postmodernism1Running Head: PostmodernismPostmodernism Allen Brown UNV 200 Grand Canyon University August 21th 2009 Electronic communication and information processing technology permits information to be both more densely concentrated in virtual space
Amherst - MNG - 500
The Abolitionist Movement [I will write my research paper on the Abolitionist Movement because I am interested in learning more about the people and steps that were taken to abolish slavery. I have always wondered how overtime something that was widely ac
Amherst - MNG - 500
1. How does an understanding of management and organizational behavior lead to organizational effectiveness and efficiency? Why is the study of historical management theories important today?Organizational Behavior is the study of individuals and their b
Amherst - MNG - 500
1. What are Geert Hofstede's dimensions of national culture and GLOBE patterns of cultural differences? Using any one of Hofstedes or the GLOBE dimensions, provide a practical example that demonstrates cultural relativism and cultural universalism? Hofste
Amherst - MNG - 500
1) Visit the following Web sites and complete the self assessments:Learning Styles http:/www.engr.ncsu.edu/learningstyles/ilsweb.html Take the Emotional Intelligence, Terminal Values, and Instrumental Values Assessment http:/bcs.wiley.com/he-bcs/Books? a