8 Pages

Assignment #8

Course: MNG 500, Spring 2011
School: Amherst
Rating:
 
 
 
 
 

Word Count: 1220

Document Preview

Ethics 1 Running Accounting Head: Accounting Ethics Allen Brown Ethical and Legal Issues in Business BUS-340 Module Eight Exercise June 18th 2010 Accounting Ethics With the growth and development of personal computers, or PCs, and software the fields of accounting and financial Accounting Ethics 2 reporting also grew. With such developments and vast expansion it would be very tempting and also very easy...

Register Now

Unformatted Document Excerpt

Coursehero >> Massachusetts >> Amherst >> MNG 500

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Ethics 1 Running Accounting Head: Accounting Ethics Allen Brown Ethical and Legal Issues in Business BUS-340 Module Eight Exercise June 18th 2010 Accounting Ethics With the growth and development of personal computers, or PCs, and software the fields of accounting and financial Accounting Ethics 2 reporting also grew. With such developments and vast expansion it would be very tempting and also very easy for accountants to cheat the system, the company, and their clients. CPAs must comply with ethical standards regardless of the task they are performing. It is to the sincere advantage of the accounting profession if in all fields of activities it exercises care to maintain scrupulously all professional and ethical standards competence, independence, integrity, and a professional attitude. (Costello, p. 5) These standards are enforceable to an extent under state laws; the idea that CPAs have such standards and responsibilities lends confidence to the public for the hire of their service. CPAs must avoid conflicts of interest; they must also avoid the appearance of conflicts. SEC director of enforcement stated, Forces of change such as escalating competition to obtain and hold on to auditing clients, and potential conflicts of interest as accountants offer a literal supermarket of nonaudit services, present new challenges to auditor independence. (Costello, p. 7) The principles of professional conduct are meant as guides when offering trades services and when conducting any service for their clients. The CPA's responsibility to the public is not only stated in their professional code, but is an inherent component of their existence and, most importantly, what differentiates public Accounting Ethics 3 accounting as a profession from merely a business or occupation. (Costello, p. 9) Public interest has been described as the collective well-being of the community; this community includes the government, employers, investors, creditors, and general businesses. The CPA's must take it upon themselves to own the principle concern for the public interest. The cornerstones of the guidance provided by these early bodies remain as today's foundation of ethical behavior: objectivity, integrity, trust, and, most importantly, independence. Independence is a condition of the mind; it is A professional CPA cannot also a condition of character. subordinate his professional judgment to the views of his client and must not have any interest in the outcome. Additionally, he must be free of any bias. This principle is so important that the independence in question must not only be independence in fact but also in appearance. (Costello, p. 15) Having unrelenting objectivity is necessary in the environments where clients have vested interest, specific opinion, and consistent analysis. A CPA must have the ability to maintain objectivity in the midst of any and all engagements to provide assurance for all clients. Todays environment is over populated with issues that are complicated. Public interest wants appropriate Accounting Ethics 4 action; the UAA, or Uniform Accountancy Act, addresses many of the significant issues of todays accounting world. The Uniform Accountancy Act (UAA) has been subtitled "Real World Regulation" to reflect that it very much takes into account not only what is occurring in today's environment but also puts forth a realistic set of responsibilities. The goals of the new Uniform Accountancy Act are to create an equal playing field in the delivery of services to the public, facilitate the mobility of the professional among states, respond to the marketplace, and, of course, protect the public The UAA also strives to create equality interest. among CPAs so that the public is no confused as to whether a CPA's conduct and practice all CPA's are under are regulatory authority. Therefore, that licensed and regulated, regardless of their field or place of employment, are equal before state of boards accountancy as long as they meet the basic criteria. (Costello, pp. 30,34) Ethics accounting corporations are a very important and have part a to great the foundation on can of all have profession in impact America. Unethical activity devastating consequences--such as the junk bond debacle and the savings and loan catastrophes. Traditionally, the accountant has Accounting Ethics 5 been placed in the role of watchdog; however, in today's business environment a trusted accountant can provide more by guiding business to live up to its own ethical standards and leading the way to increased profits, cost savings, and new business. (Costello, p. 21) public interest points for There are four main ethical and today; auditor independence, John Carey, commissions, business structure, and ownership. long-time executive secretary of the AICPA and respected author, suggests independence has three meanings. of not being subordinate," and he wrote, "First, in the sense "it means Second, honesty, in the integrity, objectivity, responsibility. narrower sense in which it is used in connection with auditing and expression of opinions on financial statements, independence means avoidance of any relationship which would be likely, even subconsciously, to impair the CPAs objective as auditor. Third, it means avoidance of relationships which to a reasonable observer would suggest a conflict of interest." (Costello, p. 39) For accounting principles to be meaningful, the top auditors in the accounting world have to practice firm ethical principles. There is no coincidence that the large controlled frauds are always through the top firms; they want a clean audit opinion by a firm who is respectable, thus the top firms. There are three main reasons the top audit firms have been venerable to manipulation. First, it only takes one bad audit partner to Accounting Ethics 6 create a disaster. In the S&L debacle, one office, Arthur Young and Company's Dallas office, produced clean opinions for many of the worst control frauds in Texas. Second, there is an "agency" problem. outweighs While any the gain audit the firm's firm interest make in its reputation overlooking might from securities fraud by its client, the same may not be true of individual audit partners. They are under enormous pressure from their firms to bring in clients. Firms want to see their top audit partners as heroes, not villains. Third, there is a variant of "Gresham's law" at work. Gresham's law deals with hyperinflation. It observes that "bad money drives good money out of circulation." Bad accounting can drive good accounting out of circulation. (Black) In the world of accounting it is easy to be steered the wrong way, to go down the path of quick riches; fudge a number one way or another once, twice, three times, and you eventually lose count. measure The American dream is to be successful, many people by bank accounts, houses, and materialistic success possessions; for those people taking a bribe or changing a few numbers may be a little easier or perhaps justifiable. The need for ethics in accounting is huge, it goes for all businesses, but in accounting it is so easy to pull off and possibly get away with. For the major accounting firms to have ethical bases is not enough anymore; these firms are so venerable a system of Accounting Ethics 7 checks and balances such as our governments may be needed so that the accounting firms are accounted for. Accounting Ethics 8 Works Cited Black, W. (n.d.). Santa Clara University. Retrieved Junr 15, 2010, from Link Between Moral and Market Values: http://www.scu.edu/ethics/publications/ethicalperspectives/ accountingethics.html Costello, D. A. (n.d.). ACCOUNTING, ETHICS AND THE PUBLIC INTEREST. Retrieved June 15, 2010, from Saxe Lectures in Accounting: http://newman.baruch.cuny.edu/digital/saxe/saxe_1999/costel lo_1999.htm
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Amherst - MNG - 500
DQ 1: Due by ThursdayHowaretheFederalDistrictCourts,theFederalCourtsofAppeal,andtheU.S.SupremeCourtdifferent?How aretheysimilar?Whatroledothevariouscourtsplayinmakingorinterpretinglawthatappliestobusinesses, employeesofthosefirms,andforresolvingorprevent
Amherst - MNG - 500
DQ #1 Due by Thursday Can an individual enter into a contract without being aware of it and still be bound by its terms? Why or why not? Cite an example of a voidable and nonvoidable contract. A contract would not be enforceable if a person entered one un
Amherst - MNG - 500
Do you think supporting non-competition clauses in employment agreements is good public policy? Why or why not? Provide an example that supports your position. In some cases non-competitive clauses protect both the employer and the employee. Non-competiti
Amherst - MNG - 500
How is ethics and ethical behavior apparent in corporate culture? What is the relationship between law, values, and ethical behavior? How do these work in unison to ensure business success? Are there times when law, values, and ethical behavior may not wo
Amherst - MNG - 500
Thursday Why has marketing continuously been a focus of concern in regard to both the legal and ethical representation of companies? Do you think this concern is warranted? Why or why not?Companies want to be marketed in a way which truly represents the
Amherst - MNG - 500
What are the implications of conflicts of interest and how do they impact corporations? Using the Sarbanes-Oxley Act of 2002, give an example of a potential conflict of interest that could arise in business, and your recommendation for how that conflict o
Amherst - MNG - 500
DQ #1 Due by Thursday When an employee learns of apparent illegal conduct by his/her employer, does the employee have an ethical duty to become a whistleblower? Why or why not? How should a company regulate ethical conduct within the organization? I belie
Amherst - MNG - 500
Whatarethebenefitsoffilingalawsuitasaclassaction?Arethereanydisadvantages?Giveanexampleto supportyouranswer.Aclassactionisaproceduraldevicewithinthelegalsystemthatpermitsoneormorepersonstosueasrepresentativeofalargegroupof peopleinterestedinthematteratis
Amherst - MNG - 500
Give an example of one government employee law that you think people may take advantage of and how people take advantage of it. I believe that the most abused employee law is workers compensation because both sides take advantages and cut corners. The two
Amherst - MNG - 500
MGT420 ORGANIZATIONAL BEHAVIOR AND MANAGEMENT CLC: GROUP PROJECT AGREEMENTCLC Course Information Course Name/Section Number: MGT420 Organizational Behavior and Management Justin Barclay Instructors Name: June 21, 2010 Start Date of the Course: CLC Member
Amherst - MNG - 500
Ethical Marketing Running Head: Ethical Marketing1Allen Brown Ethical and Legal Issues in Business BUS-340 Module Six Exercise June 05, 2010Ethical Marketing Ethical Elements of Marketing2There are many ethical norms and practiced values which market
Amherst - MNG - 500
Individual: Reading Genes Refer to the following nucleic acid: 5- ATGCTATCATTGACCTTGAGTTATTAA 3 1) Is this a strand of DNA or RNA? How do you know?It is DNA since there is thymine (T) not uracil (U) in the sequence 2) If DNA, what is the complementary st
Amherst - MNG - 500
Native American Culture Running Head: Native American Culture1Allen Brown January 9, 2010 Native American CultureNative American Culture2Historians believe that Native Americans came to this continent around, anywhere from 12,000 to 60,000 years ago.
Amherst - MNG - 500
Cortez1Running Head: CortezAllen Brown History Pre 1877 January 17th 2010Cortez2Before the Spaniards came to Mexico there were many premonitions which casted a vision of the coming disaster, these visions were not enough to prevent the impending ove
Amherst - MNG - 500
Colonies1Running head: ColoniesAllen Brown January 23, 2010 Religions Affect on ColoniesColonies2American colonies developed in order to escape the tyranny in which the people were facing under the rule of a God appointed king. In England the king w
Amherst - MNG - 500
Revolution1Running head: RevolutionAllen Brown January 28th 2010 HIS 103 US History Pre 1877Revolution Causes of a Revolution2The Seven Years War was fought mainly on the European continent between Great Britain and France. The battles foughtin Nor
Amherst - MNG - 500
Parliament Acts1Running head: Parliament ActsAllen Brown January 27th 2010 History 103 American History Pre 1877Parliament Acts Road to the Revolution After the Seven Years War the British were in a bad way, suffering financially from the great econom
Amherst - MNG - 500
A r t icles of the Confederation1Running Head: Articles of the ConfederationAllen Brown February 3rd 2010 History 103 US History Pre 1877Articles of the Confederation In Witness whereof we have hereunto set our hands in Congress, done at Philadelphia
Amherst - MNG - 500
Federalist and Republicans Running Head: Federalist and Republicans1Allen Brown February 5th 2010 HIS 103 US History Pre 1877Federalist and Republicans Federalist and Republicans The differences between Thomas Jefferson, founder of the Republican Party
Amherst - MNG - 500
1800-18501Running head: 1800-1850Allen Brown February 13 2010 HIS 103 American History Pre 18771800-18502Effects on Social Change: 1800-1850 From 1800 to 1850 several events occurred which shaped the face of American culture and society. These event
Amherst - MNG - 500
JEFFERSON AND JACKSON Running head: JEFFERSON AND JACKSON1Allen Brown February 11th 2010 American History Pre 1877 HIS 103JEFFERSON AND JACKSON The early presidents of the United States of America faced many obstacles; establishing a new country and fi
Amherst - MNG - 500
KING COTTON1Running head:KING COTTONAllen Brown February 18th 2010 HIS 103 American History Pre 1877KING COTTON King Cotton Seeking a life line to keep pace with the vastly growing industries of the north the southern states turned to cotton and they
Amherst - MNG - 500
PRE CIVIL WAR SOCIETY1Running head: PRE CIVIL WAR SOCIETYAllen Brown February 19th 2010 HIS 103 American History Pre 1877PRE CIVIL WAR SOCIETY2Pre Civil War Society In the years prior to the Civil War several big changes occurred which advanced the
Amherst - MNG - 500
CAUSES OF THE CIVIL WAR Running head: CAUSES OF THE CIVIL WAR1Allen Brown February 27th 2010 HIS 103 American History Pre 1877 Causes of the Civil War Beginning in the late 1700s and early 1800s the division between the northern states and the southern
Amherst - MNG - 500
Factors Effecting DevelopmentVirginiaNew EnglandPoliticalPromoted the idea of slavery as a way of growth. Government was based heavily on working economy.Wanted to limit slavery to the states in which it was already occurring. Government was based he
Amherst - MNG - 500
RADICAL REPUBLICANS1Running head: RADICAL REPUBLICANSAllen Brown February 27, 2010 HIS 103 American History Pre 1877 Radical Republicans The post Civil War reconstruction plan of the Radical Republicans was vastly different than the plan of the Preside
Amherst - MNG - 500
The Pueblo revolt was the result of un-trust on the behalf of the Natives and the lack of understanding by the Spanish settlers who were pressing there on agenda. The Natives were never very accepting of the Spanish settlers, which was a fair assessment c
Amherst - MNG - 500
WILLIAM LLOYD GARRISON Running head: WILLIAM LLOYD GARRISON1Allen Brown February 19th 2010 HIS 103 American History Pre 1877WILLIAM LLOYD GARRISON William Lloyd Garrison You must be the change you want to see in your life. (About.com) This quote, from
Amherst - MNG - 500
Postmodernism1Running Head: PostmodernismPostmodernism Allen Brown UNV 200 Grand Canyon University August 21th 2009 Electronic communication and information processing technology permits information to be both more densely concentrated in virtual space
Amherst - MNG - 500
The Abolitionist Movement [I will write my research paper on the Abolitionist Movement because I am interested in learning more about the people and steps that were taken to abolish slavery. I have always wondered how overtime something that was widely ac
Amherst - MNG - 500
1. How does an understanding of management and organizational behavior lead to organizational effectiveness and efficiency? Why is the study of historical management theories important today?Organizational Behavior is the study of individuals and their b
Amherst - MNG - 500
1. What are Geert Hofstede's dimensions of national culture and GLOBE patterns of cultural differences? Using any one of Hofstedes or the GLOBE dimensions, provide a practical example that demonstrates cultural relativism and cultural universalism? Hofste
Amherst - MNG - 500
1) Visit the following Web sites and complete the self assessments:Learning Styles http:/www.engr.ncsu.edu/learningstyles/ilsweb.html Take the Emotional Intelligence, Terminal Values, and Instrumental Values Assessment http:/bcs.wiley.com/he-bcs/Books? a
Amherst - MNG - 500
What are group norms, and what role do they play in behavior and cohesiveness of the group? Group norms are accepted standards of behavior which a group shares among it members. Cohesiveness is affected by norms because members of the group will be more a
Amherst - MNG - 500
1) What role does effective interpersonal communication play in decision makingw ithin organizations?Communication is the exchange and flow of information and ideas from one person to another; it involves a sender transmitting an idea, information, or f
Amherst - MNG - 500
Which power bases lie within the individual? Which are derived from the organization? How are power and politics related? Personal powers such as expert power, rational persuasion, reference power, and coalition power are the powers that are the bases of
Amherst - MNG - 500
How do the needs of an organization decide what human and capital resources are required t o be successful? In what way is the HR function important to the success of the everyday t asks in an organization? Discuss the competitive advantages that can accr
Amherst - MNG - 500
Identify the main types of traditional and horizontal organization structure. Using an organization of your choice as an example, how is the structure of the organization a reflection of its environment (including national culture), its goals and competen
Amherst - MNG - 500
In the VDOT, construction is the main form of labor. The Scientific Theory focuses on the common goal of workers and management, project completion. This theory pushes labor and management toward the common goal, a medium of increased productivity while l
Amherst - MNG - 500
Servant Leadership1Running Head:Servant LeadershipAllen Brown Organizational Behavior and Management MGT- 420 Module 6 AssignmentServant Leadership2Servant LeadershipServant leadership is a very popular leadership model in todays business world. T
Amherst - MNG - 500
Winshape Retreat Running Head: Winshape Retreat1Allen Brown Module 7: HR recruiting, developing, and retaining Organizational Behavior and Management MGT- 420 Aug 7th 2010It is important for an organization to attract talented employees so that the org
Amherst - MNG - 500
TeamPurpleCrocsIncorporatedClicktoeditMastersubtitlestyleWilliamBrown JulianMccroy JessicaReno RosebiaKendrick4/5/11StockChartThreeYearChangesNov.07 Nov.09June08 March10Dec.08Feb.094/5/11CrocsIncorporated SuccesssUniqueDesign TargetMarket Com
Amherst - MNG - 500
Discuss the order of the gaps model you would employ as the manager of a service organization to improve service. As a manager of a service organization I would use gaps 1 and 3 to improve customer service. Gap 1 is the knowledge gap; if there is an issue
Amherst - MNG - 500
What are 3 brands of the same product (e.g. breakfast cereal) that arepositioned differently? How are they differentiated? The big three shoe companies each produce a top of the line basketball shoe that is differently positioned in markets. Nike produce
Amherst - MNG - 500
Identify and describe a potential ethical dilemma that a marketer might face when segmenting. How might this concern be appropriately addressed given the need to satisfy often-conflicting stakeholders? Segmenting is simply, directly targeting an audience
Amherst - MNG - 500
Identify and describe a potential ethical dilemma that a marketer might face when segmenting. How might this concern be appropriately addressed given the need to satisfy often-conflicting stakeholders? Segmenting is simply, directly targeting an audience
Amherst - MNG - 500
ENVIRONMENTAL SCAN 1 Running Head: Environmental ScanAllen Brown November 18, 2010 Principles of Marketing MRK-245 Module One: Economic Impact on an Environmental Scan2ENVIRONMENTAL SCAN Environmental scanning can be as simple as planning your next sho
Amherst - MNG - 500
1 Running Head: The AtlasT he AtlasAllen Brown Module 2: The Atlas MKT 240: Principles of Marketing2 Nov 27 2010The Atlas The Atlas is a complete online business solutions center. The services that a business can subscribe to from Atlas are; full busin
Amherst - MNG - 500
What do you think is the market positioning of the car you drive? Assuming costand features remained the same, how would you reposition your car in Mexico? In China? In Germany?I drive a 2003 Dodge Dakota; Quad Cab, 4x4. The market positioning on my car
Amherst - MNG - 500
1 Running Head: APSAPSWilliam Brown Module 3: All Pro Science December 4, 2010 MKT 240: Principles of Marketing2 All Pro Science APS, or All Pro Science, is a all natural alternative work out supplement source.; APS was started by Tony Gonzalez of the
Amherst - MNG - 500
1 Running Head: Goods and ServicesGoods and ServicesWilliam Brown Module 4: Goods and Services December 9th, 2010 MKT 240: Principles of Marketing2 Goods and Services There are four primary contrasts between goods and services. The main difference betw
Amherst - MNG - 500
Whatissupplychainmanagement?Supply chain management (SCM) is the combination of art and science that goes into improving the way your company finds the raw components it needs to make a product or service and deliver it to customers. The following are fi
Amherst - MNG - 500
Public Relation Campaign- OutlineDefine the Campaigns Objectives: Influence Public Opinion The Corporation has to deflect the negative feedback and produce a positive spin for public appearance to retain current customers and gain prospective customers.
Amherst - MNG - 500
1 Running Head: Executive SummaryExecutive SummaryWilliam Brown Module 6: Executive Marketing Summary December 23, 2010 MKT 240: Principles of Marketing2 Executive Marketing Summary: NinjaKnife Entertainment NinjaKnife Entertainment is a revolutionary
UIllinois - PHYSICS - 214
Physics 214Waves and Quantum PhysicsLecture 1, p 1Welcome to Physics 214Faculty: Lectures A&B: Paul Kwiat Discussion: Nadya Mason Lectures C: Bob Clegg Labs: Alexey BezryadinAll course information is on the web site. Read it !http:/online.physics.ui
UIllinois - PHYSICS - 214
Lecture 2: InterferenceldS1S2 Interference of sound waves Two-Slit Interference PhasorsLecture 2, p.1The Many Fathers of QM1900 Planck solves the blackbody problem by postulating that the oscillators in the walls have quantized energy levels. Un
UIllinois - PHYSICS - 214
Review, Examples and Phasors ExamplesA1 dS2Lecture 3:S1A1=45 = /8Lecture 3, p 1Review: The Harmonic Waveform 2 ( x vt ) A cos ( kx 2 ft ) A cos ( kx t ) y is the displacement from equilibrium . is the displacement from equilibriumy ( x, t ) =
UIllinois - PHYSICS - 214
Lecture 4: Diffraction & SpectroscopyydLSpectra of atoms reveal the quantum nature of matterTake a plastic grating from the bin as you enter class.Lecture 4, p 1Todays TopicsSingle-Slit Diffraction* Multiple-slit Interference* Diffraction Gratings
UIllinois - PHYSICS - 214
Lecture 5:Applications of Interference and DiffractionI0 I 0 2I0=2cI0 I 0 2I0=cI0 I 0 2I0=c/3Sum0Sum y0Sum y0yLecture 5, p 1TodayCircular DiffractionAngular resolution (Rayleigh criterion) Angular resolution (Rayleighs criterion) Minimum
UIllinois - PHYSICS - 214
Lecture 6: Waves Review, Crystallography, and ExamplesLecture 6, p. 1Single-Slit Diffraction ExampleSuppose that when we pass red light ( = 600 nm) through a slit of unknown width a, the width of the spot (the distance between the first zeros on each s
UIllinois - PHYSICS - 214
Einsteins paper is a bold, not to say reckless, hypothesiswhich flies in the face of thoroughly established facts of interference. -R. Millikan (discover of electric charge) Its unambiguous experimental verification in spite of its unreasonableness since