3 Pages

9 Transcription & Translation Study Guide

Course: BS 111, Winter 2010
School: Michigan State University
Rating:
 
 
 
 
 

Word Count: 501

Document Preview

111 Study BS Guide Transcription and Translation Define, describe or illustrate the following terms: Promoter DNA-binding protein RNA polymerase genotype Phenotype auxotroph Prototroph mRNA TATA box post transcriptional -10 box template non-template zipper elongation termination general transcription factor transcription factor RNA polymerase I RNA polymerase II RNA polymerase III intron Exon RNA splicing Primary...

Register Now

Unformatted Document Excerpt

Coursehero >> Michigan >> Michigan State University >> BS 111

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
111 Study BS Guide Transcription and Translation Define, describe or illustrate the following terms: Promoter DNA-binding protein RNA polymerase genotype Phenotype auxotroph Prototroph mRNA TATA box post transcriptional -10 box template non-template zipper elongation termination general transcription factor transcription factor RNA polymerase I RNA polymerase II RNA polymerase III intron Exon RNA splicing Primary transcript ribozyme Spliceosome small nuclear ribonucleoprotein (snurp) 5 guanine cap poly A tail PolyA polymerase polyadenylation ORF 5 and 3 UTR Alternative splicing triplet code Codon anticodon Genetic code wobble tRNA rRNA amino acyl tRNA synthetase charged tRNA nucleolous P, A and E sites peptide release factor polysome post-translational signal peptide signal recognition particle (SRP) point mutation silent mutation missense nonsense frameshift mutation allele Spontaneous mutation Auxotroph One gene one enzyme hypothesis One gene one polypeptide hypothesis Non-overlapping code comma-less code Degenerate code start codon Stop codons Unambiguous code reverse transcriptase 1. What is the role of the promoter in transcription? In your answer tell what problem needs to be solved, where the promoter is and what is its relationship to transcription. 2. Given a gene sequence: 5GCGAAATGGAGAATGATGAACTTTAAAACCTTGTTATT 3 3CGCTTTACCTCTTACTACTTGAAATTTTGGAACAATAA 5 Transcribe into an RNA sequence and translate the protein. Use the genetic code in the text with the following short-hand one letter designation for the amino acids used by molecular biologists. Ala (A), arg R , asn (N), asp (D), cyc (C ), glu (E), gln (Q), gly (G), his (H), ile (I), (L), leu lys (K), met (M), phe (F), pro (P), ser (S), thr (T), trp (W), tyr (Y), val (V). 3. What three RNA processing steps occur to eukaryotic transcripts in the nucleus? Describe the process and what happens to the transcript if it does not occur. 4. What is the value to the eukaryotic cell to have genes in pieces? 5. Using box structures draw or otherwise describe the structure of a typical prokaryotic gene and compare it to a typical eukaryotic gene. 6 7. Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information flows from gene to protein 8. Compare transcription and translation in bacteria and eukaryotes 9. Explain what it means to say that the genetic code is redundant and unambiguous 10. Explain Cricks reasoning regarding the adaptor hypothesis? How do tRNAs act as adaptors. Which enzymes couple specific tRNAs to specific amino acids and how do they do it? 11. Take the mRNA from the Transcription study guide question 4 and describe the steps of initiation, elongation and termination of translation using it. Include 30 and 50 S subunits, initiation factors, Shine-Dalgarno sequence, mRNA, f-Met, codon, anticodon, A, P and E sites, peptide bond, charged amino acid, aminoacyl bond, start and stop codons. 12. A single mRNA can be translated many times by ribosomes. A new ribosome can even attach and start translation before other ribosomes have reached the stop codon. Why is repeated use of a single mRNA advantageous to the cell? 13. Make a table of mutations listing the type, modification in DNA and the effect on protein function.
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Michigan State University - BS - 111
Answers to BS 111 Study Guide 1 (Kopachik)Lecture 1 and Chapter 3 questions.Fill in the blank space to make a true statement.The basic biochemical pathways of metabolism are the same in _prokaryotic and eukaryotic cells. Even the enantiomers of amino
Michigan State University - BS - 111
Study Guide 1 for lecture 1 Overview - Chemical BondsThe following vocabulary terms were introduced in lecture.Define, describe or illustrate the following vocabulary terms and use the term in context in asentence to make a.enantiomer (optical isomer)
Michigan State University - BS - 111
Answers to Study Guide 2 (Kopachik)Fill in the blank:Carbon has _4_ valence electrons and can form a _tetrahedron_-shaped moleculearound the _asymmetric carbon.Left-handed and right-handed versions of glycine are called _enantiomers_. Geometricisomer
Michigan State University - BS - 111
BS 111 Study Guide 2 (Kopachik)Hydrocarbons/ Functional Groups Ch. 4 pp. 58-66Define, describe or illustrate the following vocabulary terms and use the term incontext in a sentence.TetrahedronhydrocarbonStructural isomerGeometric isomerCis isomer
Michigan State University - BS - 111
Answers to study guide 3 (Kopachik)1. Why are protein polymers so versatile in numbers of proteins and in ability to interactwith other molecules in the cell and so cause physiological changes to occur?Proteins can be made to be different in the number
Michigan State University - BS - 111
Study Guide 3 Proteins/structure (Kopachik)PolymerMonomerCondensation reactionDehydrationHydrolysisPeptidePolypeptideProteinAmino acidAlpha carbonAsymmetric carbonR groupPolar R groupNonpolar R groupElectrically charged R groupMethionineP
Michigan State University - BS - 111
Answers to study guide 4 Proteins/Metabolism (Kopachik)Questions:Some reactions are endergonic whereas others are _exergonic. In comparing the twowith regard to reactants and product chemical bonds and stability we find that theproducts are more stabl
Michigan State University - BS - 111
Study Guide 4 Proteins/Metabolism (Kopachik)Terms to know:First lawSecond lawEnergy (E)Entropy (S)G (delta G)Spontaneous reactionEnthalpy (H)Exergonic reactionEndergonic reactionEquilibrium constant (Keq)Reaction couplingSummary of main point
Michigan State University - BS - 111
Answers to study guide 5 Proteins/ EnzymesQuestions:What determines the reaction rate of an exergonic reaction and how enzymes speed upthe reaction rate?The rate (all reactant and product concentrations, temperature, pressure being heldconstant) is d
Michigan State University - BS - 111
Study Guide 5 Proteins/ Enzymes (Kopachik)Terms to know:EnzymeActivation energy EaCatalystActive siteTransition stateCofactorCoenzymeCompetitive inhibitorNoncompetitive inhibitorAllosteric regulationFeedback regulationcooperativitySummary of
Michigan State University - BS - 111
Answers to Study Guide 6 Nucleic Acids (Kopachik)Questions:There are two forms of bases _pyrimidines with three types (_thymine, cytosine and uracil )andpurine with two types (_adenine and _guanine). Any _base_ plus either of two types of sugars_ribos
Michigan State University - BS - 111
Study Guide 6 Nucleic Acids (Kopachik)Terms to knowPolynucleotideBasePurineAdenineGuaninePyrimidineCytosineThymineUracilNucleosideDeoxyriboseriboseNucleotidePhosphodiester bondDNA (deoxyribonucleic acid)PolarityAntiparallelComplementari
Michigan State University - BS - 111
Answers to Study Guide 7 Carbohydrates (Kopachik)Questions:1. Describe the structure of the monosaccharide glucose by answering thefollowing questions:What is the molecular formula, the functional groups present and the arrangement ofthem to the numb
Michigan State University - BS - 111
Study Guide 7 Carbohydrates (Kopachik)Terms to know:CarbohydrateMonosaccharidePolysaccharideGlycoproteinGlycolipidTriosePentoseHexoseGlycosidic bondalpha bondbeta bondStarchCelluloseGlycogenChitinpeptidoglycanMain points:1. Carbohydrate
Michigan State University - BS - 111
Answers to study guide 8-10 Lipids (Kopachik)Questions:Lipids:1. Describe the structure of a fatty acid. Use the terms hydrocarbon chain, single anddouble bonds, saturated and unsaturated, cis versus trans. How would the meltingtemperature of a fatty
Michigan State University - BS - 111
Study Guides 8-10 Lipids (Kopachik)Terms to know:LipidTriglyceride (triacylglycerol)Fatty acidGlycerolEster bondSaturated fatty acidUnsaturated fatty acidPhospholipidHeadTailAmphipathicMicelleBilayercholesterolFluid mosaicIntegral protein
Michigan State University - BS - 111
Study guide (Kopachik)Cell StructureTerms to know:CytologyMycoplasmaYeastCapsuleGram negative and gram positiveNucleoidNucleolusChromatinDifferential centrifugationNuclear envelope, pores, laminaSmooth endoplasmic reticulumRough endoplasmic
Michigan - ENGR - 101
ENGR 101 Fall 2010 (Section 100)What is ENGR 101?ENGR 101: Intro to Computers andProgrammingEngineering 101 introduces first-year students to theconcept of an algorithm: a well-defined set of instructionsthat achieve a particular goal. Constructing
Michigan - ENGR - 101
ENGR 101 (Sec 100), Fall 2010AnnouncementsOffice hours begin this weekProject 1 is postedIntroduction to C+schedule posted on CTools (exceptions TBA)Due Wednesday 15 Sep at 9pmMake sure you know how to submit your projectExam conflictsNotify Nade
Michigan - ENGR - 101
ENGR 101 (Sec 100), Fall 2010AnnouncementsProject 1 due tonight (Wed 9pm)Look for Project 2 release by thenWarning: Considerably more difficult, time consumingDue Wednesday, 22 Sep at 9pmFunctions and ProceduresENGR 101, Lecture 3: 15 Sep 10Exampl
Michigan - ENGR - 101
File StreamsENGR 101, Lecture 4: 20 Sep 10AnnouncementsProject 2 is due Wednesday night at 9pmMore on the project later in this lecture1StreamsSequences of data made available over timeInput StreamSource of data, accessedincrementallyIn C+, acc
Michigan - ENGR - 101
Iteration and ConditionalsENGR 101, Lecture 5: 22 Sep 10AnnouncementsProject 2 due tonight (Wed 9pm)Exam #1 Tue 5 OctM. Wellmanif you have a potential conflict, contact Nader Jawad(njawad@umich.edu)Classroom evacuation routes1Fundamental Algorit
Michigan - ENGR - 101
ENGR 101, Sec 100, Fall 10SelectionENGR 101, Lecture 6: 27 Sep 10AnnouncementsProject 3 due Wed 9PM (29 Sep)Exam #1 Tue 5 OctM. Wellmanif you have a potential conflict, contact Nader Jawad(njawad@umich.edu) ASAP1ENGR 101, Sec 100, Fall 10Fundam
Michigan - ENGR - 101
ENGR 101 Sec. 100 Fall 10Predicates and LoopsENGR 101, Lecture 7: 29 Sep 10AnnouncementsProject 3 due Wed 9PM (29 Sep)Exam #1 Tue 5 OctProf. M. Wellmansample exams available this weekendtake practice gateway exam for participation creditreview se
Michigan - ENGR - 101
ENGR 101, Sec 100, Fall 10Counting LoopsENGR 101, Lecture 8: 6 Oct 10AnnouncementsM. WellmanProject 4 out, due Wed 13 Oct 9pmExam #1 grades1ENGR 101, Sec 100, Fall 10Finite SumsSuppose we want to compute a summationSum(m) =Sum(4) =Summation F
Michigan - ENGR - 101
ENGR 101Data TypesENGR 101, Lecture 9: 11 Oct 10Today's QuestionHow high can you count on the fingers of one hand?1ENGR 101AnnouncementsProject 4 due Wed 9pmHow is your progress on Project 4?Have not started yetB. Started, not very far yetC. H
Michigan - ENGR - 101
ENGR 101Names: Variable, Scope, LifetimeENGR 101, Lecture 10: 13 Oct 10AnnouncementsProject 4 due tonight, 9pmProject 5 out soon, 2-week (almost) assignment1ENGR 101NamesProgramming entails introduction and management ofnamesfor procedure: func
Michigan - ENGR - 101
ENGR 101Classes and Generic RoutinesENGR 101, Lecture 11: 20 Oct 10AnnouncementsProject 5 due Wed 27 Oct (9pm)Exam 2 on Wed 3 Nov (6pm)contact Nader Jawad (njawad@umich.edu) about conflictsMid-term course evaluationsthanks for constructive feedbac
Michigan - ENGR - 101
ENGR 101String Class, Array SemanticsENGR 101, Lecture 12: 25 Oct 10AnnouncementsProject 5 due Wed 27 Oct (9pm)Exam 2 on Wed 3 Nov (6pm)contact Nader Jawad (njawad@umich.edu) about conflictsHow is your progress on Project 5?A.B.C .D.E.Have no
Michigan - ENGR - 101
ENGR 101, Section 100VectorsENGR 101, Lecture 13: 27 Oct 10AnnouncementsProject 5 due tonight (9pm)Exam 2 on Wed 3 Nov (6pm)M. Wellmancontact Nader Jawad (njawad@umich.edu) about conflictsGateway exam coming (probably in lab)1ENGR 101, Section 1
Michigan - ENGR - 101
ENGR 101, Section 100, Fall 10Recursion and SortingENGR 101, Lecture 14: 1 Nov 10AnnouncementsExam 2 on Wed 3 Nov (6pm)Project 6 due Wed 10 Nov (9pm)M. Wellmanwatch for room announcementsOpen book/notes, same style/rules as Exam 1Samples posted,
Michigan - ENGR - 101
ENGR 101, Section 100Matrix CalculationsENGR 101, Lecture 15: 8 Nov 10Background SurveyA.B.C .D.M. WellmanHow much do you already know about matrix algebra?Good facility with linear algebraSome basic matrix operations (e.g., multiplication)Hav
Michigan - ENGR - 101
ENGR 101, Section 100Gaussian Elimination, andIntro to MATLABENGR 101, Lecture 16: 10 Nov 10AnnouncementsProject 6 due tonight at 9pm1ENGR 101, Section 100Q1: Triangular?Q2: How to solve?Convert to a Matrix-1 1/20 -1/2000010000 -1/20 1/2
Michigan - ENGR - 101
ENGR 101, Section 100, Fall 09Matrices in MATLABENGR 101, Lecture 17: 15 Nov 10AnnouncementsLook for Project 7 this week (due Wed 1 Dec)First MATLAB assignment1ENGR 101, Section 100, Fall 09MATLAB Data Elements (review)all data is some kind of ar
Michigan - ENGR - 101
ENGR 101, Section 100, Fall 10Scripts, Functions, Input/OutputENGR 101, Lecture 18: 17 Nov 10AnnouncementsProject 7 posted (due Wed 1 Dec)My office hoursM. Wellmanmay require some constructs from next week, but you haveenough Matlab to get a good
Michigan - ENGR - 101
ENGR 101 Section 100, Fall 10MATLAB Programming (Part I)ENGR 101, Lecture 19: 22 Nov 10AnnouncementsProject 7 due Wed 1 DecM. WellmanTry to get done early, to avoid MATLAB license contention1ENGR 101 Section 100, Fall 10Save/LoadMATLAB provides
Michigan - ENGR - 101
ENGR 101 Section 100MATLAB Programming (Part II)ENGR 101, Lecture 20: 24 Nov 10AnnouncementsProject 7 due Wed 1 DecM. WellmanTry to get done early, to avoid MATLAB license contention1ENGR 101 Section 100Relational Operators on ArraysRelational o
Michigan - ENGR - 101
ENGR 101, Section 100, Fall 10Subarrays and VectorizationENGR 101, Lecture 21: 29 Nov 10AnnouncementsProject 7 due Wed 1 DecM. WellmanTry to get done early, to avoid MATLAB license contentionNote on conversion to doublesWatch for Project 8 soon1
Michigan - ENGR - 101
ENGR 101, Section 100, Fall 10Visualizing DataENGR 101, Lecture 22: 1 Dec 10AnnouncementsProject 7 due tonight: Wed 1 DecProject 8 out tonight, due Mon 13 DecM. WellmanNo extensions possibleDealing with MATLAB license contention1ENGR 101, Sectio
Michigan - ENGR - 101
ENGR 101, Section 100, Fall 10Fractals and the Mandelbrot SetENGR 101, Lecture 23: 8 Dec 10AnnouncementsProject 8 due Mon 13 DecExam 3 Thu 16 Dec, 810amM. Wellmanopen book & notesno computation or communication devicessimilar format to previous e
Michigan - ENGR - 101
10/3/10 Review: C+ FundamentalsENGR 101: 4 Oct 10Where Weve BeenAlgorithms (what its all about)A high-level programming language: C+Data types and declarationExpression statementsOperators: Arithmetic, Assignment, Input/Output,Relational, Logica
Michigan - ENGR - 101
ENGR 101, Sec,on 100, Fall 10 11/2/10 Review: Programming and C+ENGR 101: 3 Nov 10Where Weve Been Since Exam 1Counting Loopscounting patterns, for, nested loopsData TypesNamesvariables, constants, scope, lifetimeClassesdata types, encodi
Michigan - ENGR - 101
ENGR 101, Sec,on 100, Fall 10 12/12/10 Review: Programming in MATLABENGR 101: 13 Dec 10AnnouncementsProject 8 due tonight 9pmAll regrade requests must be in before Final examExam 3 Thu 16 Dec, 810amTo be graded asapopen book & notesno com
Michigan - ENGR - 101
Exam 2 - AnswersFall 2009 SemesterEngr101: Introduction to Computers and ProgrammingSection 100 / 200You are allowed to use the books, your notes, and a calculator.You cannot use devices that allow the passing of information between others.You canno
Michigan - ENGR - 101
Exam 2Fall 2009Engr101: Introduction to Computers and ProgrammingSection 100 / 200You are allowed to use the books and your notes.You cannot use electronic devices including, but not limited to, calculators, laptops, and cell phones.You cannot acces
Michigan - ENGR - 101
Exam 3 AnswersFall 2009Engr101: Introduction to Computers and ProgrammingSection 100 / 200You are allowed to use the books and your notes.You cannot use electronic devices including, but not limited to, calculators, laptops, and cell phones.You cann
Michigan - ENGR - 101
Exam 3Fall 2009Engr101: Introduction to Computers and ProgrammingSection 100 / 200You are allowed to use the books and your notes.You cannot use electronic devices including, but not limited to, calculators, laptops, and cell phones.You cannot acces
Michigan - ENGR - 101
Exam 2 - AnswersWinter 2010Engr101: Introduction to Computers and ProgrammingSection 200You are allowed to use the books and your notes.You may not use electronic devices: including, but not limited to, calculators, laptops, and cell phones.You may
Michigan - ENGR - 101
Exam 2Winter 2010Engr101: Introduction to Computers and ProgrammingSection 200You are allowed to use the books and your notes.You may not use electronic devices: including, but not limited to, calculators, laptops, and cell phones.You may not access
Michigan - HIST - 303
Notes on the Balinese CockfightChapter I s/Deep Play:N otes o n t heB alinese CockfightT he RaidEarly in April o f 1958, my wife and I arrived, malarial and diffident,ina Balinese village we intended, as ianthropologists, to study. A smallplace, ab
Michigan - HIST - 303
174",\A n Essay on Sport and Violencemorals stood on one side, morals without manners o n t he other. Earlyin the eighteenth century the two traditions began to move closer toeach other. The attempt made by Addison and Steele to reconcilemorals and
Michigan - HIST - 303
IF;\':~I NTRODUCTION>':l~- - - <"~:;-'.'itT he M exican radicals h ad a lready received enthusiastic suppOrt fro.:~G iuseppe G aribaldi a nd o ther r evolutionaries who h ad b een t he heroes : .;~]t he 1 848 rebellioris against authority i n E ur
Michigan - HIST - 303
I.T he body o f the condemnedO n 2 March 1757 Damiens the regicide was condemned 'to makethe amende honorable before the main door o f the Church o f Paris',where he was to be 'taken and conveyed in a cart, wearing nothingbut a shirt, holding a torch
Michigan - HIST - 303
Sport as a Sociological Problem3''T he G enesis o f S port as aSociological P roblemN orbert EliasIMany types o f sports which today are played in a more o r less identicalmanner all over the world originated in England. 1 They spread fromthere
Michigan - HIST - 303
Michigan - HIST - 303
1P UBLICISTS, P ROPAGANDISTS A NDP ROSELYTIZERSIdeals o f Empirefor Public SchoolboysO nce the Empire was established, the public schools sustained it.In the words o f G. Kendall, onetime headmaster o f U niversityCollege School, ' The public school
Michigan - HIST - 303
Tennyson, Charles, Sir, THEY TAUGHT THE WORLD TO PLAY , Victorian Studies, 2:3(1959:Mar.) p.211Tennyson, Charles, Sir, THEY TAUGHT THE WORLD TO PLAY , Victorian Studies, 2:3(1959:Mar.) p.211Tennyson, Charles, Sir, THEY TAUGHT THE WORLD TO PLAY , Victo
Michigan - HIST - 303
C HRIST A ND T HE I MPERIAL G AMES F IELDS/./\tl'1:91\ / , \ ". ~ ~y\\ ,J/~'~.') \l.~r ")l.,~~V\"> .'ic;r7C HRIST A ND T HE I MPERIALG AMES F IELDSEvangelical Athletes o j the Empire_ 1iOi>C hristianity, B uddhism a nd I slam have i n
Michigan - HIST - 303
, ;~.~Chapter 4The Recreational Experienceso f Early American WomenNancy L. StrunaI cannot say that I think you very generous to the ladies, f or whilstyou are proclaiming peace and good will to men, emancipating allnations, you insist upon retain
Michigan - HIST - 303
Chapter 9V ARIETIES O FF OOTBALLj'Of all the team sports t hat became organized in the nineteenth century,football was t he m ost i nternational i n a ppeal a nd diverse i n form. Nourishedin England's prestigious " public" (private) schools, the ol
Michigan - HIST - 303
PRAYING AND PLAYING IN THE YMCA3PRAYING ANOPlAYING IN THE YMCAThe ideological trailblazers of muscular Christianity were not run-of-themill folk. Most came from highly privileged backgrounds, were trained inthe classics at private boys' schools, and r