Quiz Chapter 9 Answers
4 Pages

Quiz Chapter 9 Answers

Course Number: HDFS 2303, Fall 2011

College/University: Texas Tech

Word Count: 1492

Rating:

Document Preview

HDFS2303.003 LIFESPAN DEVELOPMENT KEY QUIZ CHAPTER 9 PHYSICAL AND COGNITIVE DEVELOPMENT IN MIDDLE CHILDHOOD 1) Piaget regarded __________ as an important achievement of the concrete operational stage because it provides clear evidence of __________. A) seriation; reversibility B) classification; hypothetico-deductive reasoning C) conservation; operations D) transitive inference; class inclusion Answer: C 2) Jamal...

Unformatted Document Excerpt
Coursehero >> Texas >> Texas Tech >> HDFS 2303

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

LIFESPAN HDFS2303.003 DEVELOPMENT KEY QUIZ CHAPTER 9 PHYSICAL AND COGNITIVE DEVELOPMENT IN MIDDLE CHILDHOOD 1) Piaget regarded __________ as an important achievement of the concrete operational stage because it provides clear evidence of __________. A) seriation; reversibility B) classification; hypothetico-deductive reasoning C) conservation; operations D) transitive inference; class inclusion Register to View Answer2) Jamal is able to think through a series of steps and then mentally return to the starting point. Therefore, Jamal is capable of A) reversibility. B) decentration. C) transitive interference. D) class inclusion. Register to View Answer3) During a conservation-of-water task, Emme can focus on several aspects of the problem and relate them, rather than centering on just one aspect. Therefore, Emme is capable of A) seriation. B) class inclusion. C) reversibility. D) decentration. Register to View Answer4) To test for ________, Piaget asked children to arrange sticks of different lengths from shortest to longest. A) classification B) spatial reasoning C) seriation D) decentration Register to View Answer5) A concrete operational child can _________ mentally, an ability called _________________. A) conserve; seriation B) seriate; transitive inference C) classify; decentration D) reverse; class inclusion Register to View Answer6) Kim Lee is able to mentally represent her neighborhood and describe it to others. Kim Lees representation is known as a A) class inclusion. B) large-scale route of travel. C) transitive inference. D) cognitive map. Register to View Answer7) According to Piaget, one limitation of concrete operational thought is that childrens mental operations work poorly with A) everyday decision making. B) logical constructs. C) abstract ideas. D) organized thoughts. Register to View Answer8) The very experience of ____________ seems to promote mastery of Piagetian tasks. A) aging B) learning to read C) going to school D) brain lateralization Register to View Answer9) Individuals skilled at ___________ can prevent their minds from straying to irrelevant thoughts. A) organization B) inhibition C) metacognition D) elaboration Register to View Answer10) When Mike had to learn the state capitals, he grouped the states by region to assist his memory. Which memory strategy did Mike use? A) elaboration B) organization C) rehearsal D) metacognition Register to View Answer11) According to one view of attention-deficit hyperactivity disorder (ADHD), A) all children with ADHD are hyperactive. B) environmental factors usually cause ADHD. C) girls are diagnosed with ADHD about four times as often as boys. D) deficient executive processing underlies ADHD symptoms. Register to View Answer12) Cross-cultural research on memory indicates that A) people in non-Western cultures who lack formal schooling do not use or benefit from instruction in memory strategies. B) in all cultures, effective use of memory strategies is required for day-to-day problem solving. C) people in non-Western cultures who lack formal schooling have a more difficult time than formally schooled people using memory cues that are available in everyday life. D) memory strategies develop in a universal sequence among all cultures studied. Register to View Answer13) Luke has a science test on Friday and knows that he needs to focus his attention during class and apply memory strategies when studying. Luke is demonstrating A) long-term retrieval. B) metacognitive awareness. C) cognitive inhibition. D) false-belief understanding. Register to View Answer14) Quinn knows that he should group items when memorizing lists, but he does not always do so. Quinn is not yet good at A) selective attention. B) flexibility of attention. C) metacognition. D) cognitive self-regulation. Register to View Answer15 Research on reading proficiency in middle childhood shows that improvements in __________ releases working memory for higher-level activities. A) memory strategies B) visual scanning and discrimination C) practical intelligence D) transitivity Register to View Answer16) The Stanford-Binet Intelligence Scales, Fifth Edition, A) contains nonverbal subtests that do not require spoken language. B) emphasizes crystallized knowledge. C) provides separate scores for analytical, creative, and practical intelligence. D) offers only a measure of general intelligence. Register to View Answer17) The basic information-, visual-spatial processing, and working memory factors of the Stanford-Binet A) have only been tested on white, middle-class students. B) measure crystallized abilities, such as pattern analysis and matrices. C) are thought to be less culturally biased than the other factors. D) emphasize culturally loaded, fact-oriented information. Register to View Answer18) Componential research shows that A) measures of basic working-memory capacity do not correlate well with mental test scores. B) cultural and educational experiences contribute significantly to IQ. C) individuals whose nervous systems function efficiently appear to have an edge in intellectual skills. D) flexible attention and memory are not as important as efficient thinking in predicting IQ. Register to View Answer19) In Sternbergs triarchic theory, intelligent behavior involves balancing A) linguistic, and emotional, practical intelligences. B) spatial, kinesthetic, and interpersonal intelligences. C) creative, intrapersonal, and emotional intelligences. D) analytical, creative, and practical intelligences. Register to View Answer20) Sternbergs triarchic theory helps explain why A) even vastly different cultures are surprising similar in the behaviors they regard as intelligent. B) traditional intelligence tests accurately assess the complexity of human behavior. C) out-of-school practical forms of intelligence are vital for life success. D) a lengthy process of education is required to transform inborn abilities into mature intelligence. Register to View Answer21) Howard Gardner argues that A) emotional intelligence is highly correlated with general intelligence. B) traditional intelligence tests accurately assess the complexity of human behavior. C) all forms of intelligence follow the same course of development. D) each intelligence has a unique biological basis and a distinct course of development. Register to View Answer22) According to Gardners theory of multiple intelligences, A) all intelligences have a common end-state or expert performance. B) cultural values and learning opportunities affect the extent to which a childs intellectual strengths are realized. C) education often interferes with the transformation of raw potential into a mature social role. D) intelligence tests are a reliable measure of mental ability. Register to View Answer23) Herrnstein and Murrays 1994 book, The Bell Curve, implies that A) IQ variations are largely determined by differences in environment. B) ethnic and social class differences in IQ are unfounded. C) heredity plays a sizable role in individual and SES differences in IQ. D) IQ shows significant fluctuations over the lifespan. Register to View Answer24) Adoption studies reveal that A) adopted children show a significant decline in IQ across middle childhood and adolescence, regardless of rearing conditions. B) children of low-IQ biological mothers do as well as children with high-IQ biological mothers when placed in similar adoptive homes. C) genetic factors play a much greater role in IQ than environmental factors. D) when children of low-IQ mothers are adopted by parents who are above average in income and education, they score above average in IQ. Register to View Answer25) Carter, an African-American boy, is told by a researcher that certain verbal tasks are not a test. He is told that other verbal tasks are a test of how good children are at school problems. If Carter is aware of ethnic stereotypes, which of the following is probably true? A) He will perform better in the test condition. B) He will perform similarly in both conditions. C) He will perform far worse in the test condition. D) He will answer the test questions, but refuse to answer the not a test questions. Register to View Answer26) Which of the following is true about language development during middle childhood? A) Vocabulary growth is much slower in middle childhood than in early childhood. B) School-age childrens more reflective and analytical approach to language permits them to appreciate the multiple meanings of words. C) English-speaking children use the active voice more than the passive voice during the school years. D) Childrens use of the passive voice leads to a change in their humor. Register to View Answer27) African-American childrens narratives are usually longer and more complex than those of white children because African-American children A) tend to use a topic-focused narrative style. B) rarely use a classic form narrative style. C) tend to use a topic-associating narrative style. D) are more advanced in language and literacy development. Register to View Answer28) Children of bilingual parents who teach them both languages in infancy and early childhood A) generally take five to seven years to attain speaking and writing skills on par with those of monolingual agemates. B) attain language milestones in both languages far later than monolingual agemates. C) have a much smaller and less sophisticated vocabulary than monolingual children. D) separate the language systems from the start and attain early language milestones according to a typical timetable. Register to View Answer29) Research on bilingual education shows that A) non-English-speaking minority children acquire English more easily in English-only classrooms. B) providing instruction in two languages prevents adequate proficiency in both languages. C) a strategy that promotes childrens native-language skills while they learn English is most effective for nonEnglish-speaking minority children. D) providing instruction in two languages hinders childrens cognitive and linguistic development. Register to View Answer30) Which of the following is supported by research on group differences in IQ? A) On average, Hispanic children score slightly lower than African-American children on measures of IQ. B) Heredity is largely responsible for individual, ethnic, and SES variations in intelligence. C) Differences in SES do not fully explain the blackwhite IQ gap. D) Differences in SES are primarily responsible for the blackwhite IQ gap. Register to View Answer

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Texas Tech - HDFS - 2303
HDFS2303 LIFESPAN DEVELOPMENTCHAPTER 18EMOTIONAL AND SOCIAL DEVELOPMENT IN LATE ADULTHOOD1) Mr. Martin reached the last years of his life feeling whole, complete, and satisfied with his achievements. Herealized that the paths he followed, abandoned, a
Broward College - MCB - MCB2010
ACTION OF ANTIMICROBIAL DRUGSAntimicrobialdrugsareeithercidal,whichmeanstheyactuallykillthepathogens,orstatic,whichmeanstheysloworpreventreproduction.Ineithercase,thedefensesofthehostwillalsobeneeded.1.INHIBITIONOFCELLWALLSYNTHESISSINCEthisattacksthec
Broward College - MCB - MCB2010
ADHERENCEOncethepathogenhasgainedaccesstothebody,itusuallymusthavesomemeansofattachingitselftothehoststissues.Thisattachmentiscalledadherenceandisanecessarystepinpathogenicity.Thisattachmentisaccomplishedbymeansofsurfacemoleculesonthepathogencalledadh
Broward College - MCB - MCB2010
AEROBICCELLULARRESPIRATIONInaerobiccells,thenextmajorstepwillbeaseriesofreactionsknownastheKrebsCycle(tricarboxylicacidorcitricacidcycle).Beforethisbegins,apreparatorystepwillchangethepyruvicacidleftoverfromglycolysistoacetylcoenzymeA.Onemoleculeofcar
Broward College - MCB - MCB2010
ALPHAPROTEOBACTERIA( PROTEOBACTERIA)thisgroupincludesmostoftheproteobacteriathatcangrowwithlowlevelsofnutrients. Somehaveunusualmorphology Nitrogenfixingbacteriaareimportantinagriculture Severalplantandhumanpathogensareincluded Allaregramnegative Th
Broward College - MCB - MCB2010
ANAEROBICGROWTHMEDIAANDMETHODSRemember,strictorobligateanaerobesdonottoleratethepresenceofoxygenatnormalatmosphericlevels,althoughaerotolerantanaerobescan.Specialmediaandtechniquesarerequiredforstrictanaerobes.1.Specialreducingmediasuchasfluidthioglyc
Broward College - MCB - MCB2010
ANTIBACTERIALCHARTONFOLLOWINGPAGE:DRUGSBYMODEOFACTIONCOMMENTSINHIBITORSOFCELLWALLSYNTHESISNATURALPENICILLINSPenicillinGGrampositivebacteria,injected.Bactericidal.PenicillinVGrampositivebacteria,oral.Bactericidal.SEMISYNTHETICPENICILLINSAmpicilli
Broward College - MCB - MCB2010
ANTIBODIES(IMMUNOGLOBULINS)Theseareproteinsthataremadeinresponsetothepresenceofanantigen.Theyareabletorecognizeandbindtothatsameantigenandsomehowinactivateordestroyit.Eachantibodymoleculehasatleasttwoareascalledantigenbindingsitesthatbindtotheantigenic
Broward College - MCB - MCB2010
ANTIGENANTIBODYREACTIONWhenamatchingantigenandantibodycometogether,anantigenantibodycomplexforms.Theantibodybindstotheantigenattheantigenbindingsiteandmarkstheantigenfordestructionbyphagocytesandcomplement.Theantibodyitselfdoesnotdamagetheantigen,butbe
Broward College - MCB - MCB2010
ANTIGENIC VARIATIONAntigensarethepartofaninvaderthttriggersanimmuneresponseinthehost.Antibodiesarethespecificproteinsproducedinresponsetothepresenceofanantigen.Whenanantibodycombineswiththespecificantigenthattriggereditsproduction,theantigenissomehowi
Broward College - MCB - MCB2010
ANTIMICROBIALDRUGSChemotherapeuticdrugs(chemotherapy)combatdiseaseinthebody,whetheritiscausedbyapathogenicmicrobeorsomethingelse(cancer)Anantimicrobialdrugisachemicalthatdestroyspathogenicmicrobeswithminimaldamagetothetissuesofthehost.Antibioticthisi
Broward College - MCB - MCB2010
APPLICATIONS OF GENETICENGINEERING1.Geneticallyengineeredproductsformedicaltherapya.Humaninsulinb.Humangrowthhormonec.HepatitisBvaccined.tPAe.Erythropoietinf.Interferong.ClottingFactorVIII2.DiagnostictoolsDNAprobesforthepresenceofparticulargenes
Broward College - MCB - MCB2010
ARCHAEAMoreaboutthisdomainthesearethestrange,unusualbacteriawhichhavealsobeencalledarchaeobacteria.Althoughtheirappearancethroughamicroscopeorasvisiblecoloniesmaybeverysimilaroridenticaltootherbacteria,theyhavesomedifferenceswhichputtheminagroupapart:
Broward College - MCB - MCB2010
ARTIFICIALLYACQUIREDIMMUNITY1.Artificiallyacquiredactiveimmunityoccursasaresultofvaccines.Vaccination(immunization)introducespreparedantigenscalledvaccinesintothebody.Theantigeninthevaccinehasbeenmodifiedinsomewaysothatitwillnotcausedisease,butwillstil
Broward College - MCB - MCB2010
ASSORTEDMISCELLANEOUSBACTERIAA.Chlamydiathesearetiny,gramnegative,coccoidbacteria.Theyareobligateintracellularparasiteswithcomplicatedlifecycles.Reproductionmustoccurwithinthehostcellandthisgroupalsomustusethehostcell'sATP.Theyaretransmittedbypersonalc
Broward College - MCB - MCB2010
ASSORTEDMISCELLANEOUSBACTERIABacteroidesliveintheintestinaltractinhugenumbers,andalsointhemouth.Theyareanaerobicandgramnegative.Theymaybefoundcausingdeeptissueinfectionsinpuncturewoundsandcauseperitonitisfollowingintestinalsurgeryorinjury.Theyarenonmot
Broward College - MCB - MCB2010
AUGCUGCCUUAUUACAGAGGGCAUUAA5.AsecondtRNA,withananticodoncomplementarytothesecondcodon(CUG)bringsthesecondaminoacidtotheribosomeandbindstemporarilytothecomplementarycodononmRNA.6.Thefirsttwoaminoacidsarejoinedbyapeptidebond(enzymesassociatedwiththerib
Broward College - MCB - MCB2010
AUTOIMMUNE DISEASESInspiteofnatureswaysofpreventingit,itispossibleforonesownimmunesystemtolosetheabilitytodistinguishselfortochoosenottorespondtoself.Theresultisanattackonatissueortissuesofthebody.1.TypeIAutoimmunityantibodiesmadeinresponsetoavirusfin
Broward College - MCB - MCB2010
BacteriaGonorrheaNeisseria gonorrhoeaepainful urination & discharge in males; often fewersymptoms in femalesSyphilisTreponema pallidumdisease occurs in 3 stages1st sore at point of entry; 2ndrash over skin & mucous membranes; 3rd lesions called gummas
Broward College - MCB - MCB2010
BETAPROTEOBACTERIA( PROTEOBACTERIA)oftenusenutrientsubstancesthatdiffuseawayfromdecomposingorganicmatterbutseveralpathogensareinthisgroupa.Thiobacillususesulfurinenergyproductionb.Spirillumspiralshape,liveinwaterandaremotilebypolarflagella.Theyarerelat
Broward College - MCB - MCB2010
BIOSYNTHESISOFDNAVIRUSESIngeneral,DNAvirusnucleicacidentersthenucleusofthehostcelladisreplicatedthere,usingviralenzymes.Thecapsidandotherproteinsaresynthesizedinthecytoplasm,usinghostcellribosomesandenzymes.Theseproteinsthenmigrateintothenucleusandarej
Broward College - MCB - MCB2010
CAPSIDANDENVELOPEThenucleicacidissurroundedbyaproteincoatcalledthecapsid.Thecapsidcomposedofproteinsubunitscalledcapsomeres.Thestructureoftheseviralproteinsisdeterminedbygenesofthevirus.Thearrangementofthecapsomeresischaracteristicofthevirus.Withtheele
Broward College - MCB - MCB2010
CARBOHYDRATECATABOLISMCarbohydratesaretheprimarysourceofenergyforlivingorganisms,althoughlipidsandproteinscanalsobeusedwhencarbohydratesarenotavailable.Glucoseisthefuelofchoice,socarbohydratemetabolismisusuallystudiedasglucosemetabolism.Energyisproduc
Broward College - MCB - MCB2010
CELLWALLComplex,semirigidstructurethatgivesshapeandprotectiontothecell.1.Functionsa.Preventscellfromrupturingduetoentranceoftoomuchwater.b.Helpsgiveshapec.Pointofanchorageforflagellad.Maycontributetoabilitytocausediseasee.Siteofactionforsomeantibio
Broward College - MCB - MCB2010
CELLSANDHUMORAL(ANTIBODYMEDIATED)IMMUNITYThisresponseiscarriedoutbyantibodies,whichareproducedbyBlymphocytesactivatedintoplasmacells.Bcells(Blymphocytes)developfromstemcellslocatedinredbonemarrow.Aftermaturationinthebonemarrow,theBcellsmigratetolymphoi
Broward College - MCB - MCB2010
CELLSANDHUMORAL(ANTIBODYMEDIATED)IMMUNITYItcouldbesaidthattheantigenSELECTSthelymphocytethatrespondsthisway,andtheprocessiscalledclonalselection.Itisbelievedthatweareallpreparedtorespondtoasmanyas100milliondifferentantigens,whichmeansthatwehavethatmany
Broward College - MCB - MCB2010
CHARACTERISTICSOFALGAEAlgaearesimpleeukaryoticphotoautotrophs.Mostarefoundintheocean.Algaecanbeunicellularormulticellular.1.Vegetativestructuresthebodyofamulticellularalgaiscalledathallus.Thiswouldincludesuchalgaeasseaweed.Thethalliconsistofbranchedho
Broward College - MCB - MCB2010
CHARACTERISTICSOFFUNGIb.Yeastsnonfilamentous,unicellularfungithataresphericalorovalinshape.Theyarewidelydistributedinnatureandmaymakeawhitepowderycoatingonfruitsandleaves.Someyeastsundergobinaryfissiontoproducetwocellsofequalsizeandarecalledfissionyeas
Broward College - MCB - MCB2010
CHARACTERISTICSOFFUNGISpecificyeastsareidentifiedmainlybybiochemicaltests.Multicellularfungiareidentifiedonthebasisofphysicalappearance,colonycharacteristics,andreproductivespores.1.Vegetativestructuresthesearefungalcoloniescomposedofthecellsinvolvedin
Broward College - MCB - MCB2010
CHARACTERISTICSOFFUNGISporesareformedfromaerialhyphaeinvariousways,andcanbesexualorasexual.a.Asexualsporesformedbythehyphaeofoneorganism.Whenthesegerminate,theorganismtheyproduceisgeneticallyidenticaltotheoriginal.Theyareproducedbymitosisandcelldivisi
Broward College - MCB - MCB2010
CHEMICALFACTORS1.SEBUMsebaceous(oil)glandsoftheskinproducethissecretiontohelpskinandhairretainmoisture.Sebumalsoformsaprotectivefilmthatinhibitsgrowthofmanypathogenicbacteriaandfungi.ByproducingafairlyacidpH(35),sebumdiscouragesgrowthofmanymicrobes.No
Broward College - MCB - MCB2010
CHEMICALLYDEFINEDMEDIAChemicallydefinedmediumonewhoseexactchemicalcompositionisknown.Thismeansthateverysubstancepresent,nomatterhowsmalltheamount,isknown,andalsothatexactlyhowmuchofeverysubstancepresentisknown.Mediaofthistypearenotusedforgenerallabwork
Broward College - MCB - MCB2010
CHEMOAUTOTROPHSUseelectronsfromreducedinorganiccompoundsastheirenergysourceandcarbonfromcarbondioxide.Energysourcesincludehydrogensulfide,elementalsulfur,ammonia,nitrite,hydrogengasandiron.TheseproduceATPbyoxidativephosphorylation.CHEMOHETEROTROPHSEn
Broward College - MCB - MCB2010
CLASSIFICATIONOFINFECTIONSACCORDINGTOTHEEXTENTOFHOSTINVOLVEMENTLocalinfectionlimitedtoarelativelysmallareaofthebodySystemic(generalized)infectionmicrobesortheirproductsarespreadthroughoutthebodybybloodorlymphFocalinfectionagentsofinfectionenterablood
Broward College - MCB - MCB2010
CLASSIFICATIONOFMICROORGANISMSThescienceofclassificationiscalledtaxonomy.Theobjectiveistofindhowgroupsoforganismsarealikeandhowtheyaredifferent.Scientistsbelievethatmostlivingorganismshavenotyetbeendiscoveredorclassified.Whenpossiblenewspeciesarediscov
Broward College - MCB - MCB2010
Classification of Microorganismsthree domains of organisms (developed by Carl Woese, 1978)o bacteria (cell walls contain peptidoglycan, no true nucleus)o archae (cell walls, if present, do not have peptidoglycan, no truenucleus)o eukarya (true membra
Broward College - MCB - MCB2010
CLASSIFICATIONOFPROKARYOCYTESBergeysManualofSystematicBacterilogy,2ndedition,isthestandardforclassificationofprokarocytes.Twodomains,BacteriaandArchaea,areincluded.Eachdomainisdividedintophyla,basedonsimilaritiesinrRNA.Organismscontinuetobedividedintot
Broward College - MCB - MCB2010
CLASSIFYING INFECTIOUS DISEASESDiseasescause:SymptomschangesnotapparenttoanobserverSignschangesthatcanbeobservedormeasuredAsyndromeisagroupofsignsandsymptomsthatalwaysaccompaniesaparticulardisease.Infectiousdiseasesmaybeclassifiedinseveralways:1.How
Broward College - MCB - MCB2010
COMMONDNAVIRUSES1.Adenoviridaenamedfortheadenoids,wheretheyviruswasfistisolated.Causesacuterespiratorydiseasesuchasthecommoncold.2.Poxviridaediseasescausingskinlesionssuchassmallpoxandcowpoxandthatiswherethenamecamefrom(pox=pusfilledlesion).Viralmulti
Broward College - MCB - MCB2010
COMMONRNAVIRUSES1.Picornaviridaethesearethesmallestvirusesandarenamedwiththeprefixpico(meaningsmall)plusRNA.Poliovirusisanexample.TheirkindofRNAiscalledsensestrandRNAor+strandRNA,becauseitcanactdirectlyasmRNA.Afterattachment,penetration,anduncoatingar
Broward College - MCB - MCB2010
COMMONRNAVIRUSES4.Reoviridaethesearefoundintherespiratoryandenteric(digestive)tractsofhumans.TheycontaindoublestrandedRNA.ViralmRNAisproducedinthecytoplasm,whereitisusedtosynthesizeviralproteins,includinganRNAdependentRNApolymerase.ManystrandsofviralR
Broward College - MCB - MCB2010
COMPARESTYPESOFCELLWALLSAtypicalcellwallsa.Afewprokaryocytesdonothaveacellwall.1)MembersofthegenusMycoplasmahavenocellwalls.Theseorganismsarealsoextremelytiny.2)Sincetheylackacellwall,theirplasmamembranesneedextrastrength.Toprovidethis,Mycoplasmaorg
Broward College - MCB - MCB2010
CONDITIONSINFLUENCINGMICROBIALCONTROLBYCHEMICALSBacterialspeciesvaryintheirsusceptibilitytochemicalaswellasphysicalagents.Somefactorstoconsider:1.Typeofmicrobea.Ingeneral,gramnegativebacteriatendtobelesssusceptibletochemicalagentsthangrampositiveba
Broward College - MCB - MCB2010
CONTROL OF NOSOCOMIALINFECTIONSHospitalsarerequiredtohaveaninfectioncontrolcommittee,aninfectioncontrolnurse,oranepidemiologist.Theirjobistoidentifyproblemsources,checkequipmentforcontamination,checksterilizationprocedures,etc.Somemeansofcontrollingi
Broward College - MCB - MCB2010
CONTROL OF NOSOCOMIALINFECTIONSFactorswhichmaycontributetotheemergenceofnewinfectiousdiseasesinclude:1.Familiarmicroorganismschangenewstrainsappear2.Thewidespreaduseofantibioticsandpesticidesencouragesthegrowthofresistantmicrobesandresistantinsectsan
Broward College - MCB - MCB2010
CYTOPLASMtheeukaryoticdefinitioniscellsubstanceinsidetheplasmamembranebutoutsidethenucleus.Inmanywayseukaryoticcytoplasmissimilartoprokaryoticcytoplasm,butonedifferenceisthateukaryoticcellshaveacomplexinternalstructurecalledacytoskeleton,madeofthreekin
Broward College - MCB - MCB2010
DAMAGETOTHEPLASMAMEMBRANEBYANTIMICROBIALSTheplasmamembraneisvitaltothesurvivalofthebacterialcell.Somechemicaldisinfectantsactbydamagingtheplasmamembrane.Thisincludesaldoholsandquaternaryammoniums.Inaddition,polymixinantibioticsalsoactontheplasmamembra
Broward College - MCB - MCB2010
DELTAPROTEOBACTERIA( PROTEOBACTERIA)includesbacteriathatpreyonotherbacteriaandalsocontributorstothesulfurcycle.a)Bdellovibrioisthemaingenus.Thereattachtoothergramnegativebacteriaandpenetrateintotheperiplasmicspace(betweenoutermembraneandplasmamembrane)
Broward College - MCB - MCB2010
DETAILSOFAEUKARYOTICCELLFLAGELLAANDCILIAwhenpresent,theseareusedtoprovidemotilityfortheentirecellortomovesubstancesalongthesurfaceofthecell.1.Flagellaoccurasoneorafewandarerelativelylong2.Ciliaareshortandoccurinlargenumbersovertheentiresurfacethecell.
Broward College - MCB - MCB2010
DEVELOPMENT OF DISEASE1.Incubationperiodtimebetweeninitialinfectionandfirstappearanceofsignsorsymptoms.Thiscanvarydueto:a.Microorganisminvolvedb.Virulenceofinfectingmicrobesc.Originalnumberofinvadersd.Resistanceofthehost2.Prodromalperiodearly,milds
Broward College - MCB - MCB2010
DIAGNOSTIC IMMUNOLOGYInadditiontoprovidingprotectionagainstdisease,immunologicfunctionsarewidelyusedtodaytoaidindiagnosis.Forthispurpose,antibodiesareusedtodetectthepresenceofspecificantigens.1.PRECIPITATIONREACTIONSsolubleantigensreactwithantibodiest
Broward College - MCB - MCB2010
DIRECT CONTACTBacteriaTetanusClostridium tetanianaerobe that may establish an infection in puncture wounds &produce a toxin that leads to severe convulsionsGas gangreneClostridium perfringenswound infection causes spreading necrosis oftissue; often f
Broward College - MCB - MCB2010
DIRECTMEASUREMENTOFMICROBIALGROWTHLiquidculturesareusuallyusedandpopulationnumbersarerecordedasthenumberofcellspermilliliteroftheculturemedium.Usuallynumbersinaverysmallsamplearecountedandthenthenumberpermilliliter(ml)iscalculated.Togetthesmallsample
Broward College - MCB - MCB2010
DISEASES&REACTIONSRELATEDTOTHEHUMANLEUKOCYTEANTIGEN(HLA)COMPLEXAllnucleatedhumancellsbearonthesurfaceoftheirplasmamembranesspecialproteincomplexesthatarethethingtheimmunesystemusestorecognizeself(ornonself).Theseproteinsarecapableofactingasantigens,bu
Broward College - MCB - MCB2010
DNAONCOGENICVIRUSESSeveralfamiliesofDNAvirusescontainoncoviruses.1.Papovaviridaepapillomavirusescauseuterineandcervicalcancer2.HerpesviridaeEpsteinBarrviruscausesinfectiousmononucleosisandtwohumancancers,Burkittslymphomaandnasopharyngealcarcinoma.Itma
Broward College - MCB - MCB2010
DNA REPLICATIONBeforeanytypeofcelldivision,theDNAmustbecopied(replicated)sothatacompletesetcanbepassedontothedaughtercells.Thisistruewhetheritisaeukaryoticcelldividingbymitosisoraprokaryoticcelldividingbybinaryfission.Theplanisthatthetwooriginalstrands
Broward College - MCB - MCB2010
DNA REPLICATIONDNApolymerasecanaddnewnucleotidesonlytothe3'end,orinthe5'3'direction.Keepingthisinmind,herearethestepsinDNAreplication:1.EnzymeunwindsthedoublestrandandproteinsstabilizetheunwoundDNA.2.Areplicationforkformsatafixedsitecalledtheoriginofr
Broward College - MCB - MCB2010
EFFECTIVENESS OFCHEMOTHERAPEUTIC AGENTSWhatdobacteriadothatmakesthemresistanttoanantibiotic?1.Microbesreleaseanenzymethatmodifiesordestroystheantibiotic.Penicillinaseisanexampleofthis.2.Somethingaboutthemicrobechangesandmakesitdifficultorimpossiblefo
Broward College - MCB - MCB2010
ELECTRONMICROSCOPYObjectssmallerthan0.2mcannotbeclearlyviewedwithalightmicroscope.Theyrequiretheuseofanelectronmicroscope.Virusesandtinyinternalcellstructureswouldbeexamples.Thesemicroscopesuseabeamofelectrons,withitsmuchshorterwavlength,forilluminatio
Broward College - MCB - MCB2010
ELECTRONTRANSPORTCHAINThisisaseriesofcarriermoleculesthatwillpasselectronsalong,releasingenergystepbystep,smallamountsperstep.ThisenergywilldrivethegenerationofATP.Anelectrontransportchainalwaysinvolvesamembrane:ProkaryocytestheplasmamembraneEukaryoc
Broward College - MCB - MCB2010
ELECTRONTRANSPORTCHAINInprokaryocytescarryingoutaerobiccellularrespiration,oneglucose38ATPsTofigurethis,weneedtoknowthat:EachNADH3ATPsEachFADH2ATPs(becausetheirelectronsentertheETCfurtheralong)GLYCOLYSIS4ATPproduced2ATPused2ATP2ATPnetgain2NADH6AT