38 Pages

Genes powerpoint

Course: BIOL 1103, Fall 2010
School: UGA
Rating:
 
 
 
 
 

Word Count: 1915

Document Preview

the Decoding Flu 1 Learning Objectives 1. 2. 3. 4. Distinguish among the functions of DNA, mRNA, tRNA, and proteins. Explain how cells use information stored in DNA to make protein. Predict the protein coded for by a given DNA molecule. Predict how a change in a molecule of DNA of will potentially change the function of a protein. 2 Jason was excited! He had landed a summer internship at the National...

Register Now

Unformatted Document Excerpt

Coursehero >> Georgia >> UGA >> BIOL 1103

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
the Decoding Flu 1 Learning Objectives 1. 2. 3. 4. Distinguish among the functions of DNA, mRNA, tRNA, and proteins. Explain how cells use information stored in DNA to make protein. Predict the protein coded for by a given DNA molecule. Predict how a change in a molecule of DNA of will potentially change the function of a protein. 2 Jason was excited! He had landed a summer internship at the National Center for Preparedness, Detection, and Control of Infectious Diseases (NCPDCID). It didn't pay, but it helped boost his resume before applying to medical school, and his boss had let him tag along on a CDC research trip to rural Mexico. Jason's excitement changed to concern, though, when the research team accidentally contracted one of the flu viruses they had been studying. Other than Dr. Phillips, the research team leader, Jason was the only team member who was not sick! 3 Earlier that morning, Dr. Phillips told Jason she had a job for him. "Normally, I would give this to a senior staffer, but they're all sick. We think there may be a problem with the flu virus the team has caught. Here's some background. I'll be right back with your assignment." Hand out the Background information about Influenza 4 Clicker Question 1 Based on the Flu Fact Sheet, which of the following statements is true? A. B. C. D. Two important proteins on the surface of the Influenza virus are hemagglutinin and neuraminidase. New subtypes of Influenza usually arise due to major changes in the surface proteins of Influenza. The flu vaccine contains two types of live A virus and one type of live B virus. Worldwide, there are 500,000-1 million deaths due to the flu annually. 5 Dr. Phillips came back a few minutes later. "Here is the situation. The team appears to have contracted an atypical flu virus. For starters, the symptoms are worse than usual and even healthy adults are getting severely ill. "Also, none of the team's vaccinations seem to have protected them from the virus. "We're worried that we are dealing with a new strain of influenza we haven't seen before. We need to figure out how this virus is different." 6 "Flu viruses often vary in the structure of their HA gene. I want you to compare the HA protein made by viruses the team was examining with a typical flu virus. Because we don't have power, you will have to do this the old fashioned way with pencil and paper. I will get you the nucleotide sequence for a typical HA gene. You can start by finding the coding region for the gene." Dr. Phillips left the tent. "Wait!" Jason called after her. "How do I do that?!" It was too late; Dr. Phillips was already gone. Jason hadn't thought about DNA and proteins since intro biology. He pulled the biology textbook he had brought with him to prepare for MCATs out of his backpack. He'd better relearn how DNA is used to make proteins quickly. 7 For Discussion Jason knows that Dr. Phillips wants him to compare the HA protein sequences of the viruses the team was examining with the HA protein of the typical flu virus. He will only have nucleotide sequences for the HA gene. A DNA sequence: 3'CGCTACATGGGAGTAGCTGGC 5' 5'GCGATGTACCCTCATCGACCG 3' A protein sequence: A-M-T-P-H-R-P What does Jason need to know to figure out the protein sequence from the nucleotide sequences Dr. Philips gives him? Come up with a list of ideas. 8 Clicker Question 2 What are some of the differences between DNA and protein sequences? A. B. C. D. E. They are composed of different types of subunits or building blocks. DNA has a 5' and a 3' end, but proteins do not. DNA sequences are double-stranded and protein sequences are single-stranded. Protein sequences are shorter than DNA sequences. All of the above. 9 Human chromosomes: 50 250 million base pairs Average gene: 3000 base pairs < 5% of DNA codes for protein How to find the genes? 10 What is a gene? Short stretch of DNA on chromosome Two parts Regulatory region Coding region DNA Information in genes used to make proteins Two stages Transcription Translation 11 Transcription Regulatory region has a binding site for RNA polymerase. RNA Polymerase Promoter Terminator Gene Coding Region copy of coding region messenger RNA (mRNA) 12 Transcription Similar to DNA replication, but different Copy only one of the two strands Makes a copy as RNA, not DNA http://www.dnai.org/a/index.html http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/transcription.s wf 13 Clicker Question 3 Which of the following is NOT a true difference between replication and transcription? A. B. C. D. E. In transcription RNA, not DNA, is produced. In transcription, uracil is used in place of guanine. In transcription one strand of nucleic acid is produced, while replication produces two strands. Transcription does not require as many accessory enzymes (e.g., primase, helicase) as replication. Transcription copies only a portion of a chromosome, while replication copies the whole chromosome. 14 Transcription RNA DNA 5'-UAGCCGUCCUGGAAUUUA-3' 3'-ATCGGCAGGACCTTAAAT-5' 5'-TAGCCGTCCTGGAATTTA-3' RNA3'-AUCGGCAGGACCUUAAAU-5' 15 Translation DNA/RNA Adenine Cytosine Guanine Thymine/Uracil Protein Alanine Arginine Asparagine Aspartate Cysteine Glutamine Glutamate Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tyrosine Tryptophan Valine 16 One letter code A G C U Two letter code AA CA GA UA AGCG GG UG AC CC GC UC AU CU GU UU 17 Bases in DNA/RNA form triplet code Codon Table: U U Fir C st ba A se G UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG Phe (F) Leu (L) Second Base C A UCU UCC UCA UAU UAC Ser (S) UAA Tyr (Y) UCG UAG CCU CAU His (H) CCC CAC Pro (P) CCA CAA Gln (Q) CCG CAG ACU AAU Asn (N) ACC AAC ACA Thr (T) AAA ACG AAG Lys (K) GCU GAU Asp (D) GCC Ala GAC (A) GCA GAA Glu (E) GCG GAG UGG CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG G UGU Cys (C) UGC UGA Trp (W) Arg (R) Ser (S) Arg (R) Gly (G) U C A G U C A G U C A G U C A G Leu (L) Thi rd bas e Ile (I) Met (M) Val (V) 18 Translation messenger RNA (mRNA) carries the nucleotide code for the protein to be made transfer RNA (tRNA) molecules "interpret" the nucleotide code Each tRNA carries an amino acid and an anticodon complementary to a codon in the mRNA Amino Acid tRNA 5' anticodon codon mRNA ACG UGC 3' 19 Translation Ribosomes use tRNA to "read" messenger RNA and assemble the amino acids they carry into a new protein http://www.dnai.org/a/index.html http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/translation.swf 20 Clicker Question 4 What are the four anticodons that should be found on the four tRNAs shown in this figure? A. GGG, AAA, UCG, GUC B. CCC, TTT, AGC, CAG C. CCC, UUU, AGC, CAG D. GAC, CGA, 21 Clicker Question 5 This RNA sequence was isolated from the beginning of a gene. How many amino acids does this fragment probably code for? 5'GCGAUGUAACCUCAUCGACCG 3' A. B. C. D. 5 6 7 10 22 Clicker Question 6 This RNA sequence was isolated from the beginning of a gene. How many amino acids does this fragment probably code for? 5'GCGAUGUAACCUCAUCGACCG 3' A. B. C. D. 5 6 7 10 23 Clicker Question 7 Dr. Phillips returned with a sheet of paper. "Without computers all I have found so far is a partial sequence for the beginning of the the HA gene. See if you can find the coding region and I'll get more sequence data." 5'UAACCAUGAAGACUAUCAUUGCUUUGAGCUACAUUC 3' Based on this RNA sequence, what are the first 5 amino acids you would find at the beginning of the HA protein? A. I-G-T-S-D B. M-K-T-I-I C. K-T-I-K-A D. Does not encode a protein 24 Dr. Phillips returned. "Good job finding the start for the HA gene coding region. "Here is data on the HA genes the team had collected for the flu strains they were studying. "I want to send a sample of the virus back to the lab for further testing but can only send one. The most likely candidate has probably suffered a mutation that results in a different but still functional version of the HA gene. "See if you can figure out which virus best fits this description. Remember, the HA protein is over 450 amino acids long and we only have the beginning of the gene." Jason went back to work. 25 Jason proceeded to compare the HA gene from the four new flu strains to the HA gene from the typical flu strain. 26 Typical HA 5'UAACCAUGAAGACUAUCAUUGCUUUGAGCUACAUUC 3' Strain #1 5'UAACCAUGAGGACUAUCAUUGCUUUGAGCUACAUUC 3' Jason noticed that the difference between the typical HA and strain #1 was a single nucleotide change (shown in red). Knowing that this mutation was in the second position of the second codon, Jason looked at the codon table to see if AGG codes for a different amino acid than AAG. Indeed, it does! 27 Typical HA 5'UAACCAUGAAGACUAUCAUUGCUUUGAGCUACAUUC 3 Lys Strain #1 5'UAACCAUGAGGACUAUCAUUGCUUUGAGCUACAUUC 3' Arg Mis-Sense (substitution) Mutation 28 Jason also compared the HA gene from the other three new flu strains to the HA gene from the typical flu strain; doing this he figured out the predicted severity of each of these mutations. Here is what he found. 29 Typical HA 5'UAACCAUGAAGACUAUCAUUGCUUUGAGCUACAUUC 3 Leu Strain #2 5'UAACCAUGAAGACUAUCAUUGCUUAGAGCUACAUUC 3' Stop Non-Sense Mutation (truncation) 30 Clicker Question 8 Typical HA 5'UAACCAUGAAGACUAUCAUUGCUUUGAGCUACAUUC 3 Leu Strain #2 5'UAACCAUGAAGACUAUCAUUGCUUAGAGCUACAUUC 3' Stop How is the HA protein produced by the Strain #2 flu virus different from a typical flu virus? A. There is no difference B. One amino acid has been changed C. Several amino acids have been changed D. The protein is too short E. The protein is too long 31 Typical HA 5'UAACCAUGAAGACUAUCAUUGCUUUGAGCUACAUUC 3 Thr Strain #3 5'UAACCAUGAAGACCAUCAUUGCUUUGAGCUACAUUC 3' Thr Silent Mutation 32 Clicker Question 9 Typical HA 5'UAACCAUGAAGACUAUCAUUGCUUUGAGCUACAUUC 3' Thr Strain #3 5'UAACCAUGAAGACCAUCAUUGCUUUGAGCUACAUUC 3' Thr Why is the type of mutation in strain #3 referred to as a silent mutation? Because . . . A. B. C. D. the mutation makes the protein too short. the mutation makes the protein too long. the mutation leads to no change in the amino acid. The mutation leads to many different amino acids. 33 Typical HA 5'UAACCAUGAAGACUAUCAUUGCUUUGAGCUACAUUC 3 Met Lys Thr Ile Ile Ala Leu Ser Tyr Ile Strain #4 5'UAACCAUGAAGACAUCAUUGCUUUGAGCUACAUUC 3' Met Lys Thr Ser Leu Leu STOP Frame shift Mutation 34 Clicker Question 10 Typical HA 5'UAACCAUGAAGACUAUCAUUGCUUUGAGCUACAUUC 3 Met Lys Thr Ile Ile Ala Leu Ser Tyr Ile Strain #4 5'UAACCAUGAAGACAUCAUUGCUUUGAGCUACAUUC 3' Met Lys Thr Ser Leu Leu STOP How is the HA protein produced by the Strain #4 different from a typical flu virus? A. There is no difference B. One amino acid has been changed C. Several amino acids have been changed D. The protein is too short E. The protein is too long 35 "Good job Jason," Dr. Phillips commented as she headed out to the truck that would carry her and the samples to the airport. "This will hopefully give the lab back home a head start investigating this new strain of flu. I'll be back in a couple of hours. "The team's condition seems to be getting better so I don't think you will have much trouble while I am gone. Give them plenty of fluids and remember to wash your hands frequently to help keep you from catching this bug. It doesn't appear to be as bad as we feared, but it is still pretty nasty." 36 Clicker Question 11 Rank this case using the following scale: This case was . . . Engaging Boring 1 2 3 4 5 Clicker Question 12 Rank this case using the following scale: This case made me feel . . . Emotional Unemotional 1 2 3 4 5
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

UGA - BIOL - 1103
Bloodline*Human Genetics and Pedigrees*Based on the CBS show, Ghost Whisperer, Season 4, episode 5 &quot;Bloodline&quot;. Original Airdate: October 31st, 2008 http:/www.yidio.com/show/ghost-whisperer/season-4/episode-5/22854 1Learning Objectives1.2.3.4.Give
UGA - BIOL - 1103
Mendelian GeneticsLearning Objectives Describe some of the history of Mendel's work on patterns of inheritance. Explain the blending hypothesis. Explain the law of the segregation of alleles. Explain the law of independent assortment. Set up a Punnet
UGA - BIOL - 1103
Mitosis/Meiosis: Learning Objectives1. 2. Differentiate between haploid (n) and diploid cells (2n) Compare the number and type of chromosomes in a cell in G1, S, G2, and then after M phase. Define homologues and sister chromatids, when do you see each. R
UGA - BIOL - 1103
Mitosis/Meiosis: Learning Objectives1. 2. Differentiate between haploid (n) and diploid cells (2n) Compare the number and type of chromosomes in a cell in G1, S, G2, and then after M phase. Define homologues and sister chromatids, when do you see each. R
UGA - ENGL - 4320
2.6.12 Twelfth Night ACT 1 - Think about the two shipwrecked twins o Viola does not know if her twin made it - Two court spaces o Olivia's (who is a countess) and the Duke's - Olivia cannot love because she is mourning the loss of her brother - Olivia's h
UGA - ENGL - 4320
2/6/12 As You Like It and 12th Night Paper: only use rhetorical terms if they help your argument. If it doesn't help, leave it out. - Look at who is opening the scene/who is closing the scene - Verse vs. prose As You Like It ACT 4.1 Orlando is an hour lat
UGA - ENGL - 4320
Paper notes:- Do not block quotes unless absolutely necessary- Spell out act and scene numbers- Differentiate between actor and charactero Discuss how they relate How that relationship impacts the sceneo Malcom-character and Malcom-actor helps to di
UGA - ENGL - 4320
-Made up of two householdso Orsinos household Open to input from servants Laidback, idle, leisurely Orsino is a count, and part of his gentleman quality is that he loungesaround listening to music Listens to music because hes wallowing in love Als
UGA - ENGL - 4320
ACT 1 SCENE 1- Olivia is overwhelmed by her brothers death and will not/ cannot love- Orsino feels an all-consuming passion for Olivia and is certain she will feel the sameo Mourning because she is not returning his loveo Less like love, more like an
UGA - ENGL - 4320
ACT 1 SCENE 2- Another woman also mourning her brother: Viola.o Ship-wrecked, doesnt know if her brother is dead or alive.- Viola questions captain about Olivia.o Wishes to serve Olivia because they are in similar positions- Vague decision: why does
UGA - ENGL - 4320
ACT 1 SCENE 3- Sir Andrew enters.o A man with money who is quite foolisho Character type is the gull/fop/foolish gentleman Gentleman because of birth and money, not because of educationo Why is he a fool? He confuses words Misses puns and word-mean
UGA - ENGL - 4320
ACT 1 SCENE 5- Olivia orders the fool taken awayo Mourning her brother, even though she believes he went to heaveno Foolish to mourn him in this world Wears a veil this whole time- Olivia accuses Malvolio of being sick with self-love- Malvolio is cr
UGA - ENGL - 4640
Reading Film: Semiotics and Cinematography 2/6/12 Semiotics: study of language and meaning Seed: Themes Intent/Message Metaphors Images that gain relevance over time due to repetition in the film Subtext What is implied beneath the surface of the text Tit
UGA - ENGL - 4640
War of the Worlds Discussion Notes 2/1/12 The power of the atom in the movie: how is it used? Shows the United States is the highest power and yet they cannot even dent the spacecrafts Used as a technological marker When thinking about war, tend to consid
UGA - ENGL - 4640
1) In the novel by H.G. Wells, we primarily experience the story through the perspective of the unnamed narrator. In the 1953 film, several characters contribute to the action and we see their reactions to the alien menace. How does the ability to identif
UGA - ENGL - 4640
Metropolis (1927) Discussion Notes2/8/12- At the time of production, the movie cost about $5 million. The most expensive movie atthe time- Difficulty of syncing acting with the score after the filming- Bizarre scenes and extreme acting give clues to
UGA - ARHI - 2300
Venus of Willendorf 28,000 BC Civ./Period: Paleolithic Material: limestone Seen as a symbol of fertility due to large breasts and accentuated feminine figure. Very healthy given her weight. Head is covered in plaited headdress, possibly a royal figure?Ve
UGA - ARHI - 2300
ARHI 2300 Spring 2012 Study Guide for Quiz I The format of the quiz will be as follows:First, you will be shown three different works for about five minutes each. You will need to identify each work with the correct information and describe it in a short
UGA - ARHI - 2300
Ancient Greek Art Notes 2/6/12 Acropolis, Athens, Greece Persians ransacked it in about 480 BC and left it ruined Reminder to the Greeks about the damage done to them at the hands of the Persians. Perecles is at the forefront of renovating the Acropolis t
UGA - ARHI - 2300
Art of Greece 2/1/12 Civilizations disappear around 1200 BC Crete and Mycenae Tholos of the Treasury of Atreus Mycenae, Greece 1300-1250 BC Ashlar masonry: blocks fit very nicely and perfectly in with each other. Flat surfaces, blocks are carved specifica
Rutgers - PLANET EAR - 01:460:100
Photosynthesis &amp; Calcium Carbonate: carbon in the marine ecosystem
Rutgers - PLANET EAR - 01:460:100
Plate TectonicsMANTLE CONVECTIONle ant ction m ve concoreMagma Formation: up from the mantlecrustal bulgecoreSeafloor SpreadingDivergent BoundariesDivergent BoundariesDivergent BoundariesPlate TectonicsSeafloor Sinking:subductionConvergent B
Rutgers - PLANET EAR - 01:460:100
What is Earth made of?Layers Rocks Mineral ElementsWh at is the What are the Eart different layers of the h Earth? mad e of?What is the Earth made of?Layers Rocks Minerals ElementsWhat are the different layers of the Earth made of?Natural solidWhat
Rutgers - PLANET EAR - 01:460:100
What is life?Life is the distinction between organic and inorganic Ma tte r is classified a c c o rd ing to its p ro p e rtie sClassification is the placing of organisms into groups Based on their similarities &amp; differences Prevents improper ID'sSea H
Rutgers - PLANET EAR - 01:460:100
Carbon &amp; Water cyclesAll living things on are carbon organisms Water is essential for life CO2 gas is responsible for the amount and state of water that exists onCarbon &amp; Water cyclesCO2 gas is responsible for the amount and state of water that exists
Rutgers - PLANET EAR - 01:460:100
Replacement of fossil with another mineral such as silica or pyrite Trace fossils critter burrows in siltstone Feeding traces of Trilobites (425 Ma) Trace fossils - dinosaur tracks in mudstone Carbonized impressions organic compounds removed, thin C film
Rutgers - PHYSICS - 441/541
Physics 441/541Dr. Tad PryorIntroductory AstrophysicsSpring 2011445-5500 x5462 pryor@physics.rutgers.edu302W Serin Physics LabOverview: This is a combined undergraduate/graduate course on the structure and evolution of stars. The development of our
Rutgers - PHYSICS - 441/541
Ph 441/541Problem Set 2Due: Friday, February 10, 20121. Stars near the Sun: In this problem you will use the on-line services of the Centre de Donnes Astronomiques de e Strassbourg (CDS; Astronomical Data Center in English) to identify stars near the S
Rutgers - PHYSICS - 441/541
Ph 441/541Problem Set 1Due: Friday, February 3, 20121. Hydrostatic Equilibrium: Consider a sphere of mass M and radius R. Calculate the gravitational potential energy of the sphere assuming (a) a density which is independent of the distance from the ce
Rutgers - PHYSICS - 441/541
Lecture 6February 3, 2012 Properties of StarsNews Undergraduate-level talks by astronomy facultyorganized by Rutgers Astronomical Society Thursday nights, ~8:00 PM 9:15 PM Next talk: Professor Chuck Keeton, &quot;Black Holes and the Fifth Dimension&quot; Seco
Rutgers - PHYSICS - 441/541
Lecture 5January 31, 2012 Introduction to Stellar Structure and Evolution Properties of StarsNews Hand in reviews of faculty candidate talks bytoday. First homework due Friday, February 3rd Available on class website Can discuss the homework with cla
Rutgers - PHYSICS - 441/541
Lecture 2January 20, 2012 Introduction to structure in the universe and the properties of stars.News Undergraduate talks by astro faculty candidates Noon 1 PM (free pizza and soda); Serin 401 Undergraduates can earn extra credit by handing in a 1-2 pa
Rutgers - PHYSICS - 441/541
Stars and Star Formation Physics 441/541 Lecture 1January 17, 2012 Introduction to course. Introduction to structure in the universe and the properties of stars.Ph 441/541 Stars and Star Formation Joint undergraduate/graduate course Separately graded;
Rutgers - PHYSICS - 444
Ph 444Solutions for Problem Set 61. (Ryden 9.3) This problem examines the recombination of helium in the early universe. For simplicity, it considers a universe containing only He and assumes that the amount of doubly ionized helium is negligible. The l
Rutgers - PHYSICS - 444
Ph 444Solutions for Problem Set 61. (Ryden 7.5) The flux, f , received from a standard candle of luminosity L is (Ryden equation 7.21) L f= , (1) 4d2 L where dL is the luminosity distance. The angular diameter, , of a standard yardstick of size is (Ryde
Rutgers - PHYSICS - 444
Ph 444Solutions for Numerical Assignment 11. The particle horizon at the time t is calculated by taking each interval of proper distance, cdt , covered by a photon between t and t + dt , increasing it by the expansion of the universe between t and t, a(
Rutgers - PHYSICS - 444
Ph 444Solutions for Problem Set 51. (Ryden 5.4) The proper distance today to a galaxy with redshift z in a flat, singlecomponent universe with an equation of state defined by the parameter w is given by equation (5.54) from Ryden: dp (t0 ) = c H0 2 1 +
Rutgers - PHYSICS - 444
Ph 444Solutions for Problem Set 41. (Ryden 4.2) The acceleration of the universe is governed by equation (4.64) from Ryden: 4G a = - 2 ( + 3P ) + . (1) a 3c 3 Initially only a density of non-relativistic matter is present. Non-relativistic matter has P
Rutgers - PHYSICS - 444
Ph 444Solutions for Problem Set 32 1. The critical energy density is c = 3H0 /(8Gc2 ) and so the critical density is 2 c = 3H0 /(8G). The uncertainty in the critical density isc = c cc H0 = H0 H0 H0 = 2 H02 3H0 6H0 H0 = H0 8G 8G(1) (2)I find that f
Rutgers - PHYSICS - 444
Blk imgPOSSII.F.DSS2.443N1'12:59:48.72 +27:58:49.3 / 13.12' x 12.92'EBlink sequence by AladinProduced by Aladin (Centre de Donnees astronomiques de Strasbourg)http:/aladin.u-strasbg.frBlk img2MASS.K.000128N_KI1120173N1'12:59:48.72 +27:58:49.3
Rutgers - PHYSICS - 444
Ph 444Solutions for Problem Set 11. (Ryden 2.2) To decide how far one can see on average in a universe filled with spherical objects of radius R, it is simplest to think of a long cylinder along the line of sight. If an object is closer than R to the li
Rutgers - PHYSICS - 444
Ph 444Problem Set 8Due: Tuesday, November 30, 20101. Ryden problem 10.1 (Suppose the neutron decay time were n = 89 s instead of n = 890 s . . . ) 2. Ryden problem 10.2 (Suppose the difference in rest energy of the neutron and proton were Qn = (mn - mp
Rutgers - PHYSICS - 444
Rutgers - PHYSICS - 444
Ph 444Problem Set 7Due: Friday, November 19, 20101. Ryden problem 9.3 (Imagine that at the time of recombination, the baryonic portion of the universe consisted entirely of 4 He. . . ) A slightly tricky point here is what to use for nbaryon when calcul
Rutgers - PHYSICS - 444
Ph 444Problem Set 6Due: Friday, November 12, 20101. (Ryden problem 7.5) The surface brightness of an astronomical object is defined as its observed flux divided by its observed angular area; thus, f /()2 . For a class of objects that are both standard
Rutgers - PHYSICS - 444
Ph 444Numerical Assignment 1Due: Friday, November 5, 2010The fluctuations in the cosmic microwave background (CMB) radiation provide some of our most powerful constraints on the properties of the universe. We will see later in the course that an import
Rutgers - PHYSICS - 444
Ph 444Problem Set 5Due: Friday, October 15, 20101. Ryden problem 5.4. 2. Ryden problem 6.3. 3. In class this week, I presented an interesting derivation for a flat, dust-filled Universe of the proper distance of a photon as a function of time that orig
Rutgers - PHYSICS - 444
Ph 444Problem Set 4Due: Friday, October 8, 20101. Ryden problem 4.2. Assume that the value of is held fixed as some nonrelativistic matter is turned into radiation. 2. Ryden problem 5.2. Note that in this problem, the source of light remains at a fixed
Rutgers - PHYSICS - 444
Ph 444Problem Set 3Due: Friday, October 1, 20101. Calculate the critical mass density and its uncertainty using the current best estimate of the Hubble constant, H0 = 70.6 1.8 km s-1 Mpc-1 . 2. The Millennium Galaxy Catalog yields a local luminosity de
Rutgers - PHYSICS - 444
Ph 444Problem Set 2Due: Tuesday, September 21, 20101. A simple model for the lumpiness of the universe is that all of the matter is collected into clumps, each of mass mc , with a number density nc . These clumps could represent galaxies, clusters of g
Rutgers - PHYSICS - 444
Ph 444Problem Set 1Due: Tuesday, September 14, 20101. Ryden problem 2.2 2. Ryden problem 2.4 3. Ryden problem 2.5 4. As discussed in lecture, the number of galaxies per unit area on the sky as a function of magnitude is one way to test for the the homo
Rutgers - PHYSICS - 301
Rutgers - PHYSICS - 301
Rutgers - PHYSICS - 301
Physics H7C Fall 1999Solutions to Problem Set 7Derek KimballAbove the front door of Niels Bohr's cottage was nailed a horseshoe. A visitor who saw it exclaimed: &quot;Being as great a scientist as you are, do you really believe that a horseshoe above the en
Rutgers - PHYSICS - 301
Rutgers - PHYSICS - 301
Rutgers - PHYSICS - 301
Rutgers - PHYSICS - 301
Rutgers - PHYSICS - 301
Rutgers - PHYSICS - 301
Rutgers - PHYSICS - 301